Published online before print June 30, 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

* Division of Cardiology, University Hospital Geneva, Faculty of Medicine, Foundation for Medical Research, Geneva, Switzerland; and
Kennedy Institute of Rheumatology, Imperial College London, United Kingdom
2 Correspondence: Cardiology Division, University Hospital Geneva, Faculty of Medicine, 64 Avenue Roseraie, 1211 Geneva, Switzerland. E-mail: francois.mach{at}medecine.unige.ch
|
|
|---|
Key Words: atherosclerosis inflammation adhesion molecules leukocytes
|
|
|---|
RI (CD64) and Fc
RII (CD32) on cell membranes [6
]. The strong association between CRP serum levels and the risk of future atherosclerotic events supports a role for CRP as a factor contributing to atherogenesis [7
]. Among several in vitro and in vivo studies, the most important finding was the demonstration of CRP production, not only by liver cells but also within atherosclerotic lesions, rheumatoid synovium, kidney, neurons, and lung, suggesting a new role for CRP as a local inflammatory factor [8
9
10
11
12
]. Different cell populations, localized in the atherosclerotic plaque and in other tissues, have been found to produce and release CRP, as determined on the mRNA level or in its secreted protein form [8
, 11
, 13
14
15
]. To better clarify the activity of CRP as a paracrine (local) and endocrine (systemic) atherosclerotic factor on monocytes, we stimulated these cells in the presence of CRP in different culture dishes, mimicking circulating condition or adherence to the vessel wall. In particular, we investigated chemokine secretion, chemokine receptor, and adhesion molecule expression as well as chemotaxis, which are crucial processes during atherosclerotic plaque development. |
|
|---|
Recombinant and human (rh)CRP immunodepletion
rhCRP was from R&D Systems Europe Ltd. (Abingdon, UK). hCRP, obtained from human pleural fluid, was from Lee Biosolutions, Inc. (St. Louis, MO, USA). As shown by the manufacturers (R&D Systems Europe Ltd. and Lee Biosolutions, Inc.), the purity of the compound was >97% (for rCRP) and >98% (for hCRP; determined by SDS-PAGE and visualized by silver stain), and endotoxin level was <1.0 EU per 1 µg rCRP (determined by the Limulus amoebocyte lysate method). However, to exclude a possible effect of contaminants, the reconstituted rCRP (at 10 µg/mL and 100 µg/mL) and hCRP (at 10 µg/mL) were immunodepleted (ID) and used as a vehicle control in all experiments. rCRP and hCRP were incubated with 1 µg (for CRP reconstituted at 10 µg/mL) or 10 µg (for rCRP reconstituted at 100 µg/mL) anti-hCRP mAb in the presence (ID) or the absence [ID without Protein A-agarose (IDWA)] of Protein A-agarose (both from Santa Cruz Biotechnology, Santa Cruz, CA, USA) on a rotating wheel (overnight at 4°C), as described previously [17
, 18
]. Prior to immunodepletion, the anti-hCRP mAb and hCRP were dialyzed against the buffer for 1 h at 4°C using Slide-A-Lyzer dialysis cassettes (Pierce, Rockford, IL, USA) to avoid a contamination of the CRP compound with sodium azide. Immunoprecipitated CRP was removed, and the supernatant was collected and stored at –20°C. The CRP levels in the ID compound were measured by ELISA (R&D Systems Europe Ltd.) and found undetectable (<0.78 ng/mL).
Chemokine secretion assay
Monocytes (5x106/mL) were cultured in the presence or absence of rCRP or hCRP (0.1, 0.3, 1, 3, 10 µg/mL) for 12 h. In selective experiments, cells were preincubated for 30 min with 20 µg/mL-blocking anti-hCD11b (BD PharMingen, Franklin Lakes, NJ, USA) and 10 µg/mL anti-hICAM-1, 50 µg/mL anti-hCD32a, 50 µg/mL anti-hCD32b, or 50 µg/mL anti-hCD64 antibodies (all from R&D Systems Europe Ltd.), followed by 12 h of incubation in the presence or absence of 10 µg/mL rCRP. CCL2, CCL3, CCL4, and CXCL8 levels were measured in supernatants of monocyte cultures in polystyrene, Teflon, and polystyrene coated with a monolayer of HUVEC (Cambrex BioScience, Walkersville, MD, USA) dishes by using ELISA kits (R&D Systems Europe Ltd.). HUVEC were maintained in RPMI-1640 medium in the presence of 10% heat-inactivated FCS (Invitrogen, Basel, Switzerland), 10% heat-inactivated newborn calf serum (Invitrogen), 1% penicillin/streptomycin (Invitrogen), 15 µg/mL endothelial cell growth supplement (BD Biosciences, Allschwil, Switzerland), and 50 IU/ml heparin (Drossapharm AG/SA, Basel, Switzerland) in flasks precoated with 1% gelatin (Sigma, Poole, UK). For experiments, HUVEC were used at the fourth or fifth passage in culture. Then, HUVEC culture medium was removed, and HUVEC-monocyte coculture experiments were conducted by applying 5 x 106 monocytes to gelatine-coated polystyrene dishes containing a monolayer of confluent HUVEC, and HUVEC and monocytes were coincubated for 12 h in the presence of different stimuli in RPMI-1640 medium containing 25 mmol/L Hepes and 500 ng/mL polymixin B. In selective experiments, monocytes were preincubated for 60 min with 20 µg/mL-blocking anti-CD11b, 10 µg/mL anti-ICAM-1 antibody, 50 µg/mL anti-CD32a, 50 µg/mL anti-CD32b, or 50 µg/mL anti-CD64 antibodies, followed by 12 h of incubation in the presence or absence of 10 µg/mL rCRP.
Flow cytometry
Monocytes were cultured in polystyrene dishes in the presence or absence of 10 µg/mL rCRP or 10 µg/mL hCRP for 30 min (CD11b and CD18 analysis) or 24 h (ICAM-1 analysis), respectively, or different doses of rCRP for 12 h to study CCR1, CCR2, and CCR5 expression. fMLP (100 nmol/L; Sigma-Aldrich) or 100 U/mL IFN-
(R&D Systems Europe Ltd.) were used as positive controls [19
, 20
]. In selective experiments, monocytes were preincubated for 30 min with 50 µg/mL anti-CD32a, 50 µg/mL anti-CD32b, or 50 µg/mL anti-CD64 antibodies and then stimulated with 10 µg/mL rCRP. In parallel experiments, monocytes were incubated with rCCL2 (1 ng/mL), CCL3 (1 ng/mL), or CCL4 (2 ng/mL; all from R&D Systems Europe Ltd.) for 8 h or in the presence of 10 µg/mL CRP plus neutralizing anti-hCCL2 (2 µg/mL), anti-hCCL3 (2 µg/mL), or anti-hCCL4 (10 µg/mL) antibodies (R&D Systems Europe Ltd.) for 12 h. After incubation time, culture supernatants were removed, and cells were washed with PBS to remove nonadherent cells. Adherent monocytes were collected by scraping with a plastic policeman (Costar Cambridge, MA, USA) and energetically pipetting to stain FITC- or PE-labeled antibodies to anti-hCCR1, -hCCR2, -hCCR5, -hCD11b, and -hCD18 (R&D Systems Europe Ltd.) and anti-hCD54 and -hCD14 (BD PharMingen), as well as corresponding isotype controls. CellQuest software was used for acquisition and analysis on a FACSCalibur (BD Biosciences, Heidelberg, Germany). Data were expressed as mean fluorescence intensities (MFI), compared with baseline expression (defined as 100%).
CRP-binding assay
For estimation of specific CRP binding to human monocytes, we adapted the previously published method for THP-1 monocytes [6
]. Briefly, after isolation, 105 monocytes were incubated with different concentrations of rCRP in PBS containing 1% BSA (Sigma-Aldrich) at 4°C for 30 min. In selective experiments, to displace CRP binding to its receptors, monocytes were incubated with 50 µg/mL rCRP and blocking anti-hCD32a, anti-hCD32b, anti-hCD64, anti-hCD11b, or anti-hICAM-1 antibodies (1, 50, and 100 µg/mL). Then, cells were washed once, and surface-bound CRP was detected by rabbit polyclonal anti-hCRP IgG (Sigma) or rabbit serum (as isotype control), followed by PE-conjugated goat IgG anti-rabbit IgG (Invitrogen). Nonspecific CRP binding was determined by incubating labeled cells with an excess of CRP (100 µg/tube). Specific binding of CRP to monocytes was calculated by subtracting nonspecific binding from total binding of CRP. Data were expressed as MFI values determined by flow cytometry. Kd of CRP binding was calculated by using Prism 4 GraphPad Software (San Diego, CA, USA).
Cytotoxicity assay
Cell death was determined by quantification of lactate dehydrogenase (LDH) release in cell culture supernatants of adherent and suspension cultures after 12 and 24 h (BioVision, Mountain View, CA, USA).
Real-time RT-PCR
Monocytes were cultured in the presence or absence of 10 µg/mL CRP ± neutralizing anti-hCCL2 (2 µg/mL), anti-hCCL3 (2 µg/mL), or anti-hCCL4 (10 µg/mL) antibodies for 12 h. Total RNA was extracted using TRI Reagent (Molecular Research Center, Inc., Cincinnati, OH, USA) and reverse-transcribed using the Quantitect kit (Qiagen, Hilden, Germany), according to the manufacturers instructions. Real-time PCR was performed with the ABI Prism 7000 sequence detection system (Applied Biosystems, Foster City, CA, USA). hCCR2 primers and probe were designed with Primer Express software (Applied Biosystems): 5' GCGTTTAATCACATTCGAGTGTTT (forward), 5' CCACTGGCAAATTAGGGAACAA (reverse), 5' FAM AGTGCTTCGCAGATGTCCTTGATGCTC TAMRA (probe). hCCR1, hCCR5, and hypoxanthine guanine phosphoribosyl transferase primers and probes were described previously [21
, 22
].
Modified Boyden chamber migration assay
Monocytes were collected after 12 h of incubation in the presence or absence of 10 µg/mL CRP. Culture supernatants were removed, and cells were washed with PBS to remove nonadherent cells. Then, adherent monocytes were collected by scraping with a plastic policeman (Costar Cambridge) and energetically pipetting. After washing three times in chemotaxis medium (RPMI containing 25 mmol/L Hepes and 1% BSA, Sigma-Aldrich), cells were tested for migration to 10 nmol/L CCL2 or 10 nmol/L CCL3. Monocyte chemotaxis was assessed in a 48-well microchemotaxis-modified Boyden chamber (NeuroProbe, Gaithersburg, MD, USA) using a 5-µm pore size, 5-µm-thick polyvinylpyrrolidone-free polycarbonate filter (NeuroProbe). Cells were seeded in upper wells, and medium or chemoattractant solutions were added to the lower wells. The chamber was incubated for 60 min at 37°C in a humidified atmosphere with 5% CO2. Then, filters were removed from the chambers and stained with Diff-Quick (Baxter, Rome, Italy). Cells in five random oil-immersion fields were counted at 1000x magnification (blinded observer), and the chemotaxis index calculated from the number of cells migrated to the chemokine divided by the number of cells migrated to the medium.
Statistical analysis
All data were expressed as mean ± SEM. One-way ANOVA with Bonferronis post-test was performed using GraphPad InStat, Version 3.05 (GraphPad Software). Differences between P values below 0.05 were considered significant.
|
|
|---|
![]() View larger version (28K): [in a new window] |
Figure 1. rCRP induces CCL2, CCL3, and CCL4 secretion in adherent human monocytes. Chemokine secretion in adherent versus circulating monocytes (suspension culture) treated with increasing concentrations of rCRP [n=12 for rCRP from 0 to 10 µg/mL and rCRP (10 µg/mL) ID, and n=6 for rCRP (100 µg/mL) ID compound (ID 10x), rCRP (10 µg/mL) IDWA, and rCRP (100 µg/mL) IDWA (10x)]. (A) CCL2: ***, P < 0.001; *, P < 0.05, versus medium alone or rCRP ID compounds. (B) CCL3: **, P < 0.01, versus medium alone or rCRP ID compounds. (C) CCL4: ***, P < 0.001; *, P < 0.05, versus medium alone or rCRP ID compounds.
|
![]() View larger version (23K): [in a new window] |
Figure 2. hCRP induces CCL2, CCL3, and CCL4 secretion in adherent human monocytes. Chemokine secretion in adherent versus circulating monocytes (suspension culture) treated with increasing concentrations of hCRP (n=7). (A) CCL2: ***, P < 0.001, versus medium alone, hCRP (10 µg/mL) ID, or hCRP (10 µg/mL) IDWA. (B) CCL3: **, P < 0.01, versus medium alone or hCRP ID compounds. (C) CCL4: ***, P < 0.001, versus medium alone or hCRP ID compounds.
|
![]() View larger version (28K): [in a new window] |
Figure 3. rCRP induces CCL2, CCL3, and CCL4 secretion through the binding to CD32a, CD32b, and CD64 (3 Abs) on human adherent monocytes. Effect of anti-CD32a, anti-CD32b, or anti-CD64 antibodies on CRP-induced chemokine secretion. (A) CCL2 [n=6; ***, P<0.001, vs. control (CTL); #, P<0.05, and ##, P<0.01, vs. CRP]. (B) CCL3 (n=6; **, P<0.01, vs. CTL; #, P<0.05, and ##, P<0.01, vs. CRP). (C) CCL4 (n=8; ***, P<0.001, vs. CTL; #, P<0.05, and ###, P<0.001, vs. CRP). (D) Binding of rCRP to human monocytes, which were incubated with increasing concentrations (0.01–100 µg/mL) of rCRP. Cell-bound CRP was labeled with rabbit polyclonal anti-hCRP and PE-conjugated goat anti-rabbit IgG. MFI was determined by flow cytometry (n=7; mean±SEM). (E) Displacing of the binding of rCRP to human monocytes. Increasing concentrations (1–100 µg/mL) of blocking anti-hCD32a, anti-hCD32b, or anti-hCD64 were incubated in the presence of 50 µg/mL rCRP (n=6; mean±SEM; **, P<0.01, vs. CTL; #, P<0.05, vs. CRP). (F–H) Representative flow cytometric analyses of CRP binding to human monocytes. The respective histograms show isotype control (solid filled-in gray) and staining of 50 µg/mL CRP-treated (thin black line, unfilled) or 50 µg/mL CRP-treated in the presence of (F) 100 µg/mL anti-CD32a antibody, (G) 100 µg/mL anti-CD32b antibody, or (H) 100 µg/mL anti-CD64 antibody (bold black line each) for the anti-CRP MFI analysis.
|
(positive control) induced a strong (
2.5-fold) up-regulation of ICAM-1 in adherence and a weak (
1.5-fold), but still significant, increase in suspension culture (Fig. 4C)
. In all of these experiments, ID CRP did not have any effect (Fig. 4 A-C)
. rCRP-induced CD11b, CD18, and ICAM-1 up-regulation was reversed by pretreatment with anti-hCD32a, anti-hCD32b, and anti-hCD64 antibodies (Fig. 5 A-C
). These data indicate that CRP induced up-regulation of adhesion molecules on the adherent monocyte surface via CD32a, CD32b, and CD64.
![]() View larger version (25K): [in a new window] |
Figure 4. CRP induces CD11b, CD18, and ICAM-1 surface expression on adherent monocytes. Adhesion molecule expression in adherent versus circulating monocytes (suspension culture) in response to 10 µg/ml rCRP, 10 µg/ml hCRP, or positive controls (fMLP or IFN- , respectively). (A) CD11b [n=10 for CTL, fMLP, rCRP, and rCRP ID, and n=6 for hCRP and hCRP ID: ***, P<0.001, vs. medium alone (CTL), rCRP ID, or hCRP ID]. (B) CD18 (n=10 for CTL, fMLP, rCRP, and rCRP ID, and n=6 for hCRP and hCRP ID: *, P<0.05, and **, P<0.01, vs. CTL, rCRP ID, or hCRP ID). (C) ICAM-1 (adherent: n=11 for CTL, IFN- , rCRP, and rCRP ID, and n=5 for hCRP and hCRP ID; circulating: n=7 for CTL, IFN- , rCRP, and rCRP ID, and n=3 for hCRP and hCRP ID); *, P<0.05; **, P<0.01; ***, P<0.001, vs. CTL, rCRP ID, or hCRP ID. (D) Representative flow cytometric analyses of CD11b, CD18, and ICAM-1 expression on adherent monocytes. The respective histograms show isotype control (solid filled-in gray) and staining of untreated (black line, unfilled), CRP-treated (bold line), or fMLP-treated monocytes (dotted line) for the CD11b and CD18 expression analysis. ICAM-1 expression was measured in untreated (black line, unfilled), CRP-treated (bold line), or IFN- -treated monocytes (dotted line).
|
![]() View larger version (14K): [in a new window] |
Figure 5. CRP induces CD11b, CD18, and ICAM-1 surface expression on adherent monocytes via CD32a, CD32b, and CD64. Effect of anti-CD32a, anti-CD32b, and anti-CD64 antibodies on rCRP-induced (A) CD11b, (B) CD18, and (C) ICAM-1 expression on human adherent monocytes (n=5: ***, P<0.001; **, P<0.01, vs. medium alone; #, P<0.05; ##, P<0.01; ###, P<0.001, vs. CRP).
|
![]() View larger version (21K): [in a new window] |
Figure 6. rCRP-induced chemokine secretion depends on the CD11b/ICAM-1 interaction. Effect of anti-CD11b or anti-ICAM-1 antibodies alone or in combination with anti-CD32a, anti-CD32b, and anti-CD64 antibodies on rCRP-induced secretion of (A) CCL2 (n=11 for control medium, rCRP alone, anti-CD11b plus rCRP, or anti-ICAM-1 plus rCRP, and n=6 for the other conditions: ***, P<0.001, vs. CTL; #, P<0.05; ##, P<0.01, vs. CRP). (B) CCL3 (n=10 for control medium, rCRP alone, anti-CD11b plus rCRP, or anti-ICAM-1 plus rCRP, and n=6 for the other conditions: **, P<0.01, vs. CTL; #, P<0.05; ##, P<0.01, vs. CRP). (C) CCL4 (n=13 for control medium, rCRP alone, anti-CD11b plus rCRP, or anti-ICAM-1 plus rCRP, and n=8 for the other conditions: ***, P<0.001, vs. CTL; #, P<0.05; ###, P<0.001, vs. CRP). (D) Anti-CD11b or anti-ICAM-1 antibodies do not displace the binding of rCRP to human monocytes. Increasing concentrations (1–100 µg/mL) of blocking anti-CD11b or anti-ICAM-1 were incubated in the presence of 50 µg/mL rCRP (n=6, mean±SEM; **, P<0.01, vs. CTL). (E and F) Representative flow cytometric analyses of CRP binding to human monocytes. The respective histograms show isotype control (solid filled-in gray) and staining of 50 µg/mL CRP-treated (thin black line, unfilled) or 50 µg/mL CRP-treated in the presence of (E) 100 µg/mL anti-CD11b antibody or (F) 100 µg/mL anti-ICAM-1 antibody (bold black line each) for the anti-CRP MFI analysis.
|
![]() View larger version (26K): [in a new window] |
Figure 7. CRP induces CCL2, CCL3, and CCL4 secretion in human monocytes adherent to the HUVEC monolayer. One hour before coincubation with HUVEC, human monocytes were incubated with anti-CD32a, anti-CD32b, and anti-CD64 and anti-CD11b or anti-ICAM-1 alone or in combination. Then, the control medium alone, rCRP (1 and 10 µg/mL), hCRP (1 and 10 µg/mL), rCRP (10 µg/mL) ID, or hCRP (10 µg/mL) ID were added (n=6). (A) CCL2: ***, P < 0.001, versus medium alone or CRP ID compounds; #, P < 0.05; ##, P < 0.01; ###, P < 0.001, versus 10 µg/mL hCRP or 10 µg/mL rCRP. (B) CCL3: ***, P < 0.001; **, P < 0.01, versus medium alone or CRP ID compounds; ##, P < 0.01; ###, P < 0.001, versus 10 µg/mL hCRP or 10 µg/mL rCRP. (C) CCL4: ***, P < 0.001, versus medium alone or CRP ID compounds; ##, P < 0.01; ###, P < 0.001, versus 10 µg/mL hCRP or 10 µg/mL rCRP.
|
![]() View larger version (19K): [in a new window] |
Figure 8. CRP decreases CCR1, CCR2, and CCR5 expression on adherent monocytes. Chemokine receptor expression in adherent versus circulating monocytes (suspension culture) in response to increasing concentrations of CRP (n=4). (A) CCR1 (***, P<0.001, vs. CTL). (B) CCR2 (**, P<0.01, vs. CTL). (C) CCR5 (*, P<0.05, vs. CTL). (D) Representative flow cytometric analyses of CCR1, CCR2, and CCR5 expression on adherent monocytes. The respective histograms show isotype control (solid filled-in gray) and CCR staining of untreated (thin line) or 10 µg/mL CRP-treated monocytes (bold line).
|
![]() View larger version (19K): [in a new window] |
Figure 9. Effect of CRP on monocyte migration to CCL2 or CCL3. Migration of monocytes to chemokines after pretreatment with 10 µg/mL CRP in adherence (n=10) or suspension culture (circulating monocytes, n=6). (A) Migration to CCL2 (***, P<0.001, vs. CTL). (B) Migration to CCL3 (***, P<0.001, vs. CTL).
|
![]() View larger version (16K): [in a new window] |
Figure 10. The CRP-induced chemokine secretion modulates CCR1, CCR2, and CCR5 expression. Adherent monocytes were incubated in the presence of control medium alone or CRP ± neutralizing antichemokine antibodies (anti-CCL2, anti-CCL3, and anti-CCL4) or together. Alternatively, cells were alone or incubated with recombinant chemokines. (A) CCR1 (n=6; *, P<0.05, vs. CTL). (B) CCR2 (n=7; *, P<0.05; ***, P<0.001, vs. CTL). (C) CCR5 (n=10; *, P<0.05; **, P<0.01, vs. CTL).
|
![]() View larger version (26K): [in a new window] |
Figure 11. Chemokines induced by CRP modulate CCR1, CCR2, and CCR5 expression of the mRNA level. (A) CCR1, CCR2, and CCR5 mRNA expression in adherent monocytes after treatment with increasing concentrations of CRP (n=4 for CCR1; n=3 for CCR2 and CCR5). (B) CCR1, CCR2, and CCR5 mRNA expression in adherent monocytes incubated in medium alone or with CRP ± neutralizing antichemokine antibodies alone (anti-CCL2, anti-CCL3, and anti-CCL4) or together (n=3 for CCR1 and CCR2; n=4 for CCR5).
|
|
|
|---|
The major findings of the present study were that CRP induced CCL2, CCL3, and CCL4 secretion in human monocytes only in adherent conditions. These data are in agreement with a previous study showing that human monocytes secreted CCL2 in the presence of a synthetic peptide derived from CRP [50 ]. Similar data have been shown by Zhang and Wahl [51 ] in human monocytes activated by cytokines. Our data about CRP-induced CCL3 and CCL4 secretion from human primary monocytes are novel. The poor effect of CRP in suspension cultures suggests that adhesion is a crucial step in monocyte activation. Additional experiments support the hypothesis that induction and interaction of adhesion molecules are the main mechanisms implicated in CRP-induced chemokine secretion in adherent monocytes: CRP induced Mac-1 and ICAM-1 up-regulation, and antibody-mediated adhesion blockade inhibited chemokine secretion. Furthermore, the increase of Mac-1/ICAM-1 interactions coincubating human monocytes and HUVEC [52 ] results in a consequent CRP-mediated up-regulation of chemokine secretion by human monocytes. No significant CRP-induced increase in chemokine secretion by HUVEC alone has been observed. These data are in accordance with a recent paper [53 ] showing that contaminants rather than CRP induced chemokine secretion in endothelial cells and further support the purity of the rCRP used in our study. Thus, combined signaling of the two CRP receptors (CD32 and CD64) together with Mac-1/ICAM-1 is necessary for inducing CCL2, CCL3, and CCL4 secretion. Adhesion molecules are well known to influence leukocyte functions [54 ]. CD11b is expressed on human monocytes and binds different ligands [19 , 55 , 56 ]. Among the molecules capable of binding CD11b, ICAM-1 is probably the most important one for adhesion to endothelium [20 ]. The effect of CRP on CD11b and ICAM-1 has not been well investigated in the past. Recent studies reported a modulation of CD11b integrin expression induced by CRP [49 , 57 ], which has been described previously to promote monocyte migration to the classical chemoattractant CCL2 [6 ]. On the other hand, CRP has been described as a monocyte chemoattractant itself [31 ]. This activity might lead to a cross-desensitization of cells for migration in response to other chemoattractants, which may explain different observations on monocyte migration [58 ]. Han and co-workers [6 ] have shown that CRP promotes monocyte migration to CCL2 through CCR2 up-regulation. This is in conflict with our finding that CRP inhibited monocyte migration to CCL2 and CCL3 through the down-regulation of their cognate receptors CCR1 (CCL3 receptor), CCR2 (CCL2 receptor), and CCR5 (CCL3 and CCL4 receptors). These opposite results might be explained by the different methodological approaches used for monocyte isolation and culture. This supports the notion that the methods and materials may have a crucial effect on cell function and should be considered carefully when interpreting in vitro data. In our model, we also provide evidence for the mechanism underlying CCR1, CCR2, and CCR5 down-regulation. The recombinant chemokines CCL2, CCL3, and CCL4 synergistically mimicked the CRP-induced down-regulation of CCR1, CCR2, and CCR5. In line with these findings, the effect of CRP was reversed by neutralizing antichemokine antibodies, and anti-CCL2 and anti-CCL3 are more efficient than anti-CCL4. These data suggest that CCL2, CCL3, and CCL4 are synergistically involved, at least in part, in chemokine receptor down-regulation. The finding that chemokines, upon binding with their cognate receptors, trigger receptor down-regulation, not only through receptor internalization, has already been reported for CCL3 [59 , 60 ]. In agreement with this, our data indicate that chemokine receptor down-regulation is not only a result of receptor internalization but also the reduction of their mRNA level.
To summarize, we provide evidence that adherence and adhesion molecules are crucial for CRP-mediated effects on human monocytes. Although highly speculative, CRP-mediated effects on adherent cells might suggest a proinflammatory role, not only for circulating CRP but also for CRP deposits in the atherosclerotic plaque on adherent monocytes.
Received February 18, 2008; revised May 13, 2008; accepted May 28, 2008.
|
|
|---|
tvicka, V. (1993) CR3 (CD11b, CD18): a phagocyte and NK cell membrane receptor with multiple ligand specificities and functions Clin. Exp. Immunol. 92,181-184[Medline]This article has been cited by other articles:
![]() |
F. Montecucco, F. Burger, G. Pelli, N. K. Poku, C. Berlier, S. Steffens, and F. Mach Statins inhibit C-reactive protein-induced chemokine secretion, ICAM-1 upregulation and chemotaxis in adherent human monocytes Rheumatology, March 1, 2009; 48(3): 233 - 242. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||