Accuri C6 Flow Cytometer System
Originally published online as doi:10.1189/jlb.1207833 on June 17, 2008

Published online before print June 17, 2008
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.1207833v1
84/2/519    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moeenrezakhanlou, A.
Right arrow Articles by Reiner, N. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moeenrezakhanlou, A.
Right arrow Articles by Reiner, N. E.
(Journal of Leukocyte Biology. 2008;84:519-528.)
© 2008 by Society for Leukocyte Biology

Myeloid cell differentiation in response to calcitriol for expression CD11b and CD14 is regulated by myeloid zinc finger-1 protein downstream of phosphatidylinositol 3-kinase

Alireza Moeenrezakhanlou*,{ddagger}, Lindsay Shephard*, Lucia Lam* and Neil E. Reiner*,{dagger},1

* Departments of Medicine (Division of Infectious Diseases) and
{dagger} Microbiology and Immunology, University of British Columbia, Faculties of Medicine and Science, and Vancouver Coastal Health Research Institute, Vancouver, British Columbia, Canada; and
{ddagger} School of Medicine, Hamadan University of Medical Sciences, Hamadan, Iran

1 Correspondence: Division of Infectious Diseases, University of British Columbia, Rm. 452D, 2733 Heather St., Vancouver, BC V5Z 3J5, Canada. E-mail: ethan{at}interchange.ubc.ca


arrow
ABSTRACT
 
Immature cells of the mononuclear phagocyte series differentiate in response to calcitriol. This is accompanied by increased expression of both CD11b and CD14 and has been shown to be phosphatidylinositol 3-kinase (PI3K) dependent. The events downstream of PI3K that regulate mononuclear phagocyte gene expression, however, remain to be fully understood. In the present study, we show that incubation of THP-1 cells with calcitriol brings about activation of the myeloid zinc finger-1 (MZF-1) transcription factor dependent upon PI3K. In addition, we show that the proximal promoter regions of both CD11b and CD14 contain functional MZF-1 binding sites that are calcitriol responsive. Site-directed mutagenesis of the putative MZF-1 elements abolished MZF-1 binding to the promoters of both CD11b and CD14. Not only did calcitriol treatment increase MZF-1 DNA binding activity to these sites, but it also up-regulated cellular levels of MZF-1. Silencing of MZF-1 resulted in a markedly blunted response to calcitriol for induction of both CD11b and CD14 mRNA transcript levels. Cell surface expression of CD11b and CD14 was also reduced, but to a lesser extent. Taken together, these results show that MZF-1 is involved downstream of PI3K in a calcitriol-induced signaling pathway leading to myeloid cell differentiation and activation of CD11b and CD14.

Key Words: MZF-1 • PI3K • THP-1 • transcription factor • 1,25-dihydroxyvitamin D3


arrow
INTRODUCTION
 
Both the innate and acquired immune systems rely heavily upon the effector and regulatory activities of monocytes and macrophages [1 ], and recent research has highlighted the important role of phosphoinositides in mononuclear phagocyte cell regulation. Phosphatidylinositide 3-kinase (PI3K) through the production of 3'-phosphoinositides has been shown to regulate numerous monocyte/macrophage activities, including cytokine production downstream of Toll-like receptors (TLRs) [2 3 4 ], phagocytosis [5 ], and activation of the phagocyte oxidase [6 ], among other properties. These lipid kinases act as crucial signal transducing elements that regulate communication across the plasma membrane. The products of PI3K activity act as lipid secondary messengers that serve to regulate many intracellular responses [7 ]. Developing a more complete understanding of the agonists that activate monocytes and macrophages through PI3K is important toward understanding the mechanisms of mammalian homeostasis.

One well-studied hormone that has been linked to P13K is 1{alpha},25-dihydroxyvitamin D3, also known as 1,25-dihydroxycholecalciferol or calcitriol. While calcitriol is known best for its role in regulating plasma calcium homeostasis [8 9 10 ] and bone remodeling [11 , 12 ], it has also been shown to regulate the activities of myeloid cells and to promote host resistance to infection [13 14 15 16 ]. The latter appears to involve activation of innate immunity through effects on mononuclear phagocytes [17 , 18 ]. Thus, calcitriol promotes phagosome maturation [19 ] and has been shown to enhance macrophage microbicidal activity toward both Mycobacterium tuberculosis and Salmonella typhimurium [13 14 15 , 20 , 21 ]. Notably, these properties of calcitriol were shown to be PI3K dependent.

Calcitriol induces the differentiation of immature myeloid cells, such as the promonocytic cell line THP-1 along the monocyte/macrophage lineage leading to enhanced expression of the monocyte differentiation markers CD11b and CD14 [10 , 22 ]. CD11b is the {alpha} subunit of the integrin cell surface receptor complement receptor 3 and functions in a heterodimer with CD18 to allow recognition and phagocytosis of iC3b opsonized particles. CD11b is exclusively expressed on the surface of mature monocytes, macrophages, neutrophils, and natural killer cells [23 ]. Consequently, it is a widely used marker for monocyte/macrophage differentiation. CD14, on the other hand, functions in concert with LPS binding protein and TLR-4 in the detection and binding of lipopolysaccharide [24 ]. Previous studies have shown that CD14 surface expression is increased upon the differentiation of THP-1 cells treated with calcitriol [25 ].

The mechanisms by which calcitriol promotes the differentiation of mononuclear phagocytes are not fully understood. Classically, calcitriol regulates gene expression through the vitamin D receptor (VDR). Heterodimerization of VDR with the retinoid X receptor (RXR) and the subsequent translocation of this complex into the nucleus allows targeting of the vitamin D response element (VDRE) in the promoters in a large group of calcitriol-responsive genes [26 ]. Paradoxically, the CD14 and CD11b promoters do not contain a VDRE [27 ], though evidence has been presented to show that calcitriol regulates CD11b and CD14 expression via a phosphatidylinositol 3-kinase (PI3K)-dependent pathway [22 ]. Many other calcitriol-regulated genes that are involved in differentiation also do not contain a VDRE in their promoters, implying that calcitriol regulates these genes via a distinct signaling pathway [10 , 22 ]. Previous studies identified several transcription factors that appear to be involved in regulating expression of CD11b. Sp1 and PU.1 are known to activate the expression of CD11b, while ZBP89 inhibits CD11b expression during myeloid differentiation [28 , 29 ]. It has also been shown recently that CREB functions to promote calcitriol-induced CD14 promoter activity in a PI3K-dependent manner [30 ].

The aim of the present study was to examine further the regulation of gene expression in myeloid cells in response to calcitriol. Analysis of the proximal promoters of both CD11b and CD14 identified several candidate binding sites for the transcription factor myeloid zinc finger -1 (MZF-1). These findings, together with its preferential expression in myeloid cells and its role in regulating differentiation suggested that MZF-1 might be calcitriol responsive. In this report, we have shown that MZF-1 is activated by calcitriol and involved in regulating the promoter activities of both CD11b and CD14 downstream of PI3K.


arrow
MATERIALS AND METHODS
 
Reagents and chemicals
Calcitriol (1{alpha}-25 dihydroxyvitamin D3), LY294002, and wortmannin were from Calbiochem (San Diego, CA, USA). RPMI 1640, DMEM, HBSS, penicillin/streptomycin, PMSF, aprotinin, leupeptin, pepstatin A, and polyisonic:polycytidylic [poly(dI-dC)] were purchased from Sigma Chemical (St. Louis, MO, USA). Restriction enzymes, Taq DNA polymerase, buffers, deoxy-NTPs, T4 DNA ligase, eukaryotic genome extraction kits, and DNA ladder were purchased from Fermentas (Burlington, Ontario, Canada). All custom-synthesized primers, oligos, and FCS were from Invitrogen (Carlsbad, CA, USA). Gel extraction, oligo purification kits, and plasmid isolation kits were purchased from Qiagen (Mississauga, Ontario, Canada). pRL-TK-Renilla reniformis luciferase (Rr-luc), pGL3-Basic, and luciferase detection kits were purchased from Promega (Madison, WI, USA). Transfection reagents were purchased from Invitrogen and Dharmacon RNA Technologies (Lafayette, CO, USA). Anti-MZF-1 antibody was a kind gift from Dorothy Tuan (Medical College of Georgia, Augusta, GA, USA), and anti-actin was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Cell lines and cell culture
The human promonocytic cell line THP-1 and the human epithelial carcinoma cell line HeLa were from the American Type Culture Collection (Manassas, VA, USA). THP-1 cells were grown in RPMI 1640 supplemented with 10% FCS, L-glutamine (2 mM), penicillin (100 U/ml), and streptomycin (100 µg/ml). Prior to use in most experiments, cells were grown overnight in fresh RPMI/10% FCS from a concentration of ~3 x 105 cells/ml, then washed with HBSS, and incubated for 5 h in RPMI/0.5% FCS for serum starvation. HeLa cells were cultured in DMEM with nonessential amino acids and 10% FCS, penicillin (100 U/ml), and streptomycin (100 µg/ml). Cells were washed in HBSS and incubated in DMEM/0.5% FCS for 5 h for serum starvation.

Nuclear and cytoplasmic protein extraction
THP-1 cells were serum starved as previously mentioned. Samples of ~2 x 107 cells were treated or not treated with PI3K inhibitors LY294002 (10 µM) or wortmannin (50 nM) for 45 min, then treated or not treated with calcitriol (100 nM) for 30 min. After washing with HBSS twice, nuclear and cytoplasmic fractions were prepared based on a protocol from the Skirbal Institute of Biomolecular Medicine, New York University Medical Centre (New York, NY, USA) [31 ]. Cell pellets were then resuspended in 500 µl of harvest buffer (10 mM HEPES pH 7.9, 50 mM NaCl, 0.5 M sucrose, 0.1 mM EDTA, 0.5% Triton-X 100, 1 mM DTT, 100 mM NaF, 17.5 mM β-glycerophosphate, 1 mM PMSF, and protease inhibitor cocktail (Sigma St. Louis, MO, USA) and incubated on ice for 5 min. Nuclei were pelleted at 7,000 rpm for 6 min at 4°C. The supernatant representing the cytoplasmic fraction was transferred into a new tube, adjusted to 10% glycerol, and stored at –70°C. The nuclei were washed and resuspended in 500 µl buffer A (10 mM HEPES pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 1 mM PMSF, and protease inhibitor cocktail) then centrifuged at 7,000 rpm for 6 min at 4°C. Supernatant was discarded and 40 µl of buffer C (10 mM HEPES pH 7.9, 500 mM NaCl, 0.1 mM EDTA, 0.1 mM EGTA, 0.1% IGEPAL, 1 mM DTT, 1 mM PMSF, and protease inhibitor cocktail) was added to the pellet. Samples were vortexed for 15 min and kept cool by placing samples on ice intermittently. They were then centrifuged at 11,000 rpm for 20 min at 4°C. This supernatant, representing the nuclear fraction, was transferred to a new tube and adjusted to 10% glycerol. Samples were aliquotted and stored at –70°C. Protein concentrations were measured using the Bio-Rad protein assay kit.

Electrophoretic mobility shift assay
Two to five micrograms of nuclear extract per reaction and 10 ng/µl of biotinylated oligonucleotides encoding candidate MZF-1-binding motifs were used. The following custom-synthesized oligonucleotides were used based upon the following sequences in the promoter of CD11b: MZF-1a 5'-AGCTGGGGAG-3' at –132 to –122 bp, MZF-1b 5'-GGGTGGGCAG-3' at –119 to –109 bp and MZF-1c 5'-CTCCGCCCTC-3' at –57 to –47 bp. The sequence 5'-AGGTGGGGAG-3' at –89 to –79 bp of the CD14 promoter was also used for synthesis of a fourth biotinylated oligo. Nuclear extract was mixed with binding buffer (20 mM HEPES pH 7.9, 50 mM KCl, 0.1 mM EDTA, 1 mM DTT, 5% glycerol, and 200 µg/ml BSA) and 10 µg/µl of poly (dI-dC). Samples were incubated at room temperature for 5 min then mixed with biotin-labeled oligonucleotides. To control for nonspecific binding, unlabeled oligonucleotide was added in 10-fold excess or a biotin-labeled oligonucleotide containing the mutated sequence of 5'-AGCTGAAGAG-3' was added prior to the addition of the biotin-labeled oligonucleotide probe. To confirm the identity of the binding protein, a supershift assay was done by the addition of anti-MZF-1 antibody to the samples either prior to or immediately after addition of labeled oligonucleotides. The samples were incubated at room temperature for 30 min, then at 4°C for 30 min. Samples were run on a 6% nondenaturing polyacrylamide gel at 4°C in 0.5x chilled TBE buffer (0.1 M Tris, 0.09 M boric acid and 1 mM EDTA). After electrophoresis, oligonucleotides were transferred to nylon membranes by electrophoresis and UV cross-linked for 3 min. Membranes were then blocked in blocking buffer for 1 h prior to the addition of streptavidin-HRP. After 30 min of incubation, the membranes were washed and developed with ECL solution.

Plasmid construction and site-directed mutagenesis
Genomic DNA was isolated from THP-1 cells using a kit from Fermentas Life Sciences, (#K0512), and the sequence –150 to –20, relative to the transcription start site from the CD11b promoter, was amplified by PCR using a forward primer with an XhoI site, 5'GGCTCGAGGGTATTGACTTTGAAAGTTTGGGTC-3' and a reverse primer with a HindIII site, 5'CAGAAGCTTCAGAAAAGGAGAAGTAGGAGG3'. The amplified DNA was extracted from a 1.5% agarose gel using a QIAquick gel extraction kit (Qiagen), digested with XhoI and HindIII, cleaned using QIAquick nucleotide removal kit (Qiagen), and ligated into pGL3-basic (Promega). Plasmids were transformed into TOP10F’ competent Escherichia coli, then isolated with a endotoxin free Maxi Prep Kit (Qiagen). Plasmid constructs were sequenced to verify the presence of correct insert. A pGL3 plasmid construct containing the –1 to –150 bp proximal region of the CD14 promoter was prepared as described previously [30 ]. Site-directed-mutagenesis at the proposed sites of MZF-1 binding was done according to the manufacturer’s protocol (Stratagene QuickChange site-directed mutagenesis kit) with the following primers (changes are highlighted in bold): CD11b forward primers with 3 nucleotides changed in the MZF-1 binding sequence 5'- GTTTGGGTCAGGAGCTTTTGAGGAAGGGTGGGCAGGCTGTG-3' and reverse primer 5'-CACAGCCTGCCCACCCTTCCTCAAAAGCTCCTGACCCAAAC-3' CD14, forward primer 5'-CGGAGGAAGAGAGGTATAGAGGTGATCAGGGTT-3' and reverse primer 5'-AACCCTGATCACCTCTATACCTCTCTTCCTCCG-3'.

Transient transfections and luciferase reporter assay
HeLa cells were grown to 70% confluence, then subcultured without antibiotics in 12-well plates (0.2 million cells/well) overnight. Lipofectamine 2000 (Invitrogen) was used according to the protocol provided for the transient cotransfection of 0.5 µg of the pGL3 reporter construct of interest with 0.25 µg (both per well) of pRL-TK (Promega) (to control for transfection efficiency). Approximately 6 h after transfection, cells were treated or not with a PI3K inhibitor, either LY294002 (10 µM) or wortmannin (50 nM), for 45 min before the addition (or not) of calcitriol (100 nM x 30 min). PI3K inhibitors were added in again after 24 h of culture. After a total of 72 h, cells were washed with HBSS, and cell lysates were prepared using passive lysis buffer according to the instructions provided (Promega, dual luciferase assay kit). Protein concentrations were measured using Bio-Rad protein assay kit. Prior to measurement of luciferase activity, cell lysates were adjusted with lysis buffer, resulting in samples with identical protein concentrations. Dual luciferase activity was examined using an EG&G Berthold microplate luminometer (LB96V; Berthold Technologies, Dresden, Germany) and reported as ratios of Photinus pyralis luciferase (Pp-luc)/Rr-luc.

Western blot analysis
After agonist and inhibitor treatments, cells were pelleted and washed with HBSS once, then lysed with modified radioimmunoprecipitation assay buffer (50 mM Tris pH 7.4, 1% IPEGAL, 0.25% Na-deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM PMSF, 1 mM Na3VO4, 1 mM NaF, and protease inhibitor cocktail), and incubated on ice for 10 min. Samples were boiled for 7 min and then centrifuged at 11,000 rpm for 1 min at room temperature. Samples were separated in a 10% SDS-polyacrylamide gel, then transferred to nitrocellulose membrane, and probed with anti-MZF-1 (mouse IgG) or actin (goat IgG) antibodies, followed by washing and incubation with HRP-conjugated secondary antibodies. Blots were developed using enhanced chemiluminescence solution (Amersham).

Cell surface expression of CD11b and CD14
After agonist and inhibitor treatments, THP-1 cells were washed with binding buffer (HBSS, 10% FBS, 0.1% NaN3) and then incubated for CD14 detection with mAb 3C10 antibody in binding buffer (containing 1% normal mouse serum to reduce nonspecific binding) or for CD11b with 10% FITC-conjugated CD11b antibody (Invitrogen, Caltag Laboratories) in binding buffer (containing 1% mouse IgG to reduce nonspecific binding). After 30 min at room temperature, cells were washed and anti-CD14-treated cells were incubated with FITC-conjugated mouse IgG antibody for 30 min at room temperature. After antibody treatments, cells were washed with binding buffer and fixed with 5% formaldehyde and analyzed using a BD Biosciences FACSCalibur flow cytometer. Data were acquired using BD CellQuest software and analyzed with WinMDI V2.9 software (Joseph Trotter).

Silencing of MZF-1
Small interfering (si)RNA was used to down-regulate MZF-1 expression. THP-1 cells were grown to a concentration of 0.5 x 106 cells/ml in RPMI 1640 medium supplemented with 10% FBS without antibiotics. Three different siRNA sequences were used to target human MZF-1 (GenBank accession number NM_003422.2): #1 5'-CCAGCGAUCUGAGGAGUGAACAGGA-3', #2 5'-GACAAGUCCUUUGGCUGCGUCGAGU-3' (Invitrogen), and #3 5'-UUUCCGGUGCUUCCACUAUTT-3' (Sigma-Proligo, Woodlands, TX, USA). THP-1 cells were transected with siRNAs at a final concentration of 100 nM using DharmaFECT-2 Dharmacon RNA Technology), according to the protocol provided by the manufacturer. Cells were then incubated overnight at 37°C at 5% CO2, after which they were washed with warmed HBSS, then resuspended in complete RPMI and incubated for 72 h. Equal amounts of cells were removed as analyzed for MZF-1 content by Western blot analysis. In parallel experiments, MZF-1-silenced cells were incubated with calcitriol and CD11b and CD14 mRNA levels (after 24 h of calcitriol), and surface expression (after 48-72 h of calcitriol) were measured using qPCR and flow cytometry, respectively.

RT-qPCR analysis of mRNA levels of CD14 and CD11b
After silencing of MZF-1 and 24 h postaddition of calcitriol, 5 x 106 cells for every condition were washed with HBSS then collected by centrifugation. Total RNA was isolated using an RNeasy Kit (Qiagen). cDNA was synthesized using SuperScript first-strand synthesis system for RT-PCR (Invitrogen). Briefly, 5 µg of total RNA was reverse transcribed in a 20-µl reaction volume for 50 min at 42°C with SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen Life Technologies) and oligo dT15 primer, according to the manufacturer’s protocol. Real-time PCR with LightCycler System, OPTICON MJ Research, Inc. (South San Francisco, CA, USA) was performed in a reaction mixture of 25 µl using the DYNAMO SYBR Green PCR kit (FINNZYMES MJ Research), according to the manufacturer’s instruction. Primers designed for analysis were CD11b Forward 5'- GCCGGTGAAATATGCTGTCT-3' and CD11b reverse 5'-GCGGTCCCATATGACAGTCT-3' and CD14 forward 5'-GCCCTTACCAGCCTAGACCT-3' and CD14 reverse 5'-CCCGTCCAGTGTCAGGTTAT-3'. mRNA levels were analyzed relative of those for β-actin. Actin primer sequences were, forward 5'-TGACGGGGTCACCCACACTGTGCCCATCTA-3' and reverse 5'-CTAGAAGCATTGCGGTGGACGATGGAGGG-3'. The PCR mixtures were incubated for 3 min at 95°C, and amplification was performed for 40 cycles, consisting of denaturation at 94°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 20 s. Melting curve analysis was performed from 65°C to 95°C. Real-time PCR was performed in duplicate with a 25-µl reaction mixture containing 1 µl of cDNA, 400 nm each of the primers and 23 µl of 1x master mix.


arrow
RESULTS
 
1{alpha},25-dihydroxyvitamin D3 induces binding of MZF-1 to an MZF-1 binding element dependent upon PI3K
Incubation of immature myeloid cells with calcitriol induces their differentiation into mature monocytes and macrophages. This is reflected by increased surface expression of both CD11b and CD14, and this response is regulated by PI3K [22 ]. To identify potential transcription factors responsible for these effects of calcitriol, we analyzed the 450 bp proximal promoters of CD14 and CD11b, which have been shown to be important for regulating gene expression [23 , 27 ] using TFSEARCH (http:www.cbrc.jp/research/db/TFSEARCH.html). In the regions encompassing –150 bp upstream from the transcription start sites of both CD11b and CD14, several candidate MZF-1 binding sites were found (Fig. 1A and 1B ). These were of potential interest since MZF-1 has previously been shown to regulate hematopoiesis and to be preferentially expressed in myeloid cells [32 ]. In the –150 proximal region of the CD11b promoter, three candidate MZF-1 binding sites were identified (Fig. 1A) , with 70–80% homology to the consensus MZF-1 binding sequence AGTGGGGA [33 ]. In the CD14 promoter, one candidate site was identified at –89 to –79 (Fig. 1B) with 98% homology to the MZF-1 consensus binding sequence. Oligonucleotides corresponding to these potential binding sites were designed for use in electrophoretic mobility shift assay. We found that treatment of THP-1 cells with calcitriol for 30 min increased DNA binding activity to one of the three candidate sequences in the CD11b promoter (Fig. 2A ). This sequence was located at position –132 to –123 in CD11b, and of the three candidate sequences, it had the highest degree of homology to the MZF-1 consensus sequence (80%). In addition, calcitriol treatment induced increased protein binding to the single candidate MZF-1 sequence identified in the promoter of CD14 (Fig. 2B) . Of interest, this site and the active sequence in the promoter of CD11b were identical except for a single nucleotide difference. In addition, preincubation of cells with PI3K inhibitors, either wortmannin or LY294002, abrogated hormone-induced activation of MZF-1 for binding to the active sites in both promoters (Fig. 2A and 2B) . Competition assays carried out using unlabeled wild-type oligonucleotides (Fig. 2B and 2C) , as well as a mutated oligonucleotide (Fig. 2C) carrying a single base pair mutation, revealed that transcription factor binding to the putative MZF-1 binding sites was sequence specific. Thus, in the presence of excess unlabeled wild-type CD14 oligonucleotide (Fig. 2B) or CD11b oligonucleotide (Fig. 2C) , no binding of MZF-1 to labeled oligo was seen. In contrast, the addition of excess mutated CD11b oligonucleotide failed to displace MZF-1 binding (Fig. 2C) .


Figure 1
View larger version (66K):
[in this window]
[in a new window]

  		Figure 1. The 450 bp proximal promoters regions of CD11b and CD14 with candidate MZF-1 sites highlighted. (A) Three potential MZF-1 binding sites within CD11b are underlined, all with greater than 80% homology to the consensus binding sequence, AGTGGGGA. The site at –132 bp to –122 bp showed actual MZF-1 binding activity induced by calcitriol and is shown in boldface, and the other two candidate sites are located at –119 bp to –109 bp and –58 bp to –48 bp. (B) One candidate MZF-1 binding site within the CD14 promoter at –89 bp to –79 bp, which shows 98.3% homology to the consensus binding sequence, AGTGGGGA, is shown in boldface. Position-1 is relative to the transcription start site.


Figure 2
View larger version (62K):
[in this window]
[in a new window]

  		Figure 2. PI3K-dependent activation of MZF-1 binding to specific sites in the CD11b and CD14 promoters in calcitriol-treated THP-1 cells. THP-1 cells, preincubated (x45 min) or not with PI3K inhibitors LY294002 (10 µM) and wortmannin (50 nM) were either untreated or incubated with calcitriol (100 nM x 30 min). Nuclear extracts were then isolated and processed for EMSA. (A) Three different biotin-labeled oligonucleotides based upon the candidate sequences in CD11b shown in Figure 1 ,A were used to examine whether any of these function as MZF-1 binding elements. Only the sequence located at –132 to –123 (5'-AGCTGGGGAG-3') showed binding activity 2,A (I). (B) The single candidate site in the CD14 promoter (Figure 1B , 5'-AGGTGGGGAG-3') when used as a probe also demonstrated calcitriol activated, PI3K dependent MZF-1 binding activity. (C) Protein binding to the 5'-AGCTGGGGAG-3' sequence from CD11b is sequence specific as it is not competed off by excess unlabeled, mutated oligo. (D) Supershift or blocking assay using anti-MZF-1 antibody confirms that MZF-1 is the protein in nuclear extracts from calcitriol treated cells that is activated for binding to candidate MZF-1 oligo located in CD14 promoter. Anti-MZF-1 antibody was added to labeled oligo either prior to (lane 2) or simultaneously with nuclear extract.

To confirm the identity of the transcription factor that was binding to the candidate MZF-1 site in CD14, an antibody specific for MZF-1 was used to conduct supershift assays. The addition of MZF-1 antibody resulted in either a supershift of the protein-DNA complex or blocked its formation entirely (Fig. 2D) , depending upon whether the antibody was added to the incubation prior to the addition of oligo and nuclear extract, or simultaneously. This result confirmed that the DNA binding protein in question was indeed MZF-1. Taken together, the results shown in Fig. 2 are consistent with a model in which calcitriol activates binding of MZF-1 to specific sequences in the proximal promoters of both CD14 and CD11b.

The –20 to –150 regions of the proximal CD11b and CD14 promoters are transcriptionally activated by calcitriol dependent upon both PI3K and MZF-1
The –150 bp of the proximal region of CD11b promoter, which was cloned into the pGL3-basic vector, was analyzed for transcriptional activity using a luciferase reporter assay. The results from three independent experiments showed that treatment with calcitriol activated the 150-bp proximal promoter regions in a consistent manner (Fig. 3A ). Notably, pretreatment of cells with PI3K inhibitors, either LY294002 or wortmannin abrogated hormone-induced increases in promoter activity. In fact, promoter activity was reduced significantly below that of untreated control cells, suggesting that basal MZF-1 promoter activity was also regulated by PI3K. We also examined the –1 bp to –150 bp region of the CD14 promoter and found this again to be transcriptionally activated by calcitriol in a PI3K dependent manner (Fig. 3B) as we had reported previously [30 ].


Figure 3
View larger version (35K):
[in this window]
[in a new window]

  		Figure 3. Reporter assays show that the proximal promoters of CD11b and CD14 have promoter activity dependent upon MZF-1 sites. Plasmid constructs containing 150 bp of the proximal promoters of CD11b (A) and CD14 (B) were made using pGL3-basic. Wild-type and mutated plasmid constructs were cotransfected into HeLa cells with pRL. Transfected cells were treated or not with PI3K inhibitors for 45 min, then treated or not with calcitriol for 72 h. Cells were then lysed and analyzed for luciferase and renilla expression. Results are reported as relative luciferase activity (sample/control) and are the means ± SE from three independent experiments. Site-directed mutagenesis (from AGCTGGGGAG to AGCTTTTGAG) of the MZF-1 site in CD11b (A) and (from GAGGTGGGGAGG to GAGGTTATGAGG) of the MZF-1 site in CD14 abolished calcitriol-induced promoter activity.

Next, we used site-directed-mutagenesis to determine whether these responses were dependent upon the putative sites in these promoters. We changed three nucleotides in the active MZF-1 binding sites in the promoters, changing AGCTGGGGAG to AGCTTTTGAG in CD11b and GAGGTGGGGAGG to GAGGTTATGAGG in CD14. Whereas the wild-type reported plasmids showed clear activation in response to calcitriol, cells transfected with the mutated constructs were essentially unresponsive to hormone treatment. These results provide direct evidence that MZF-1 is involved in bringing about transcriptional activation of both CD11b and CD14 in response to calcitriol.

Treatment of immature myeloid cells with calcitriol induces MZF-1 expression
Two isoforms of MZF-1 have been identified with approximate subunit sizes of 54 and 82 kDa [34 ]. To examine which isoform may be involved in monocyte/macrophage differentiation, we incubated THP-1 cells with either calcitriol or PMA for 48 h and examined MZF-1 levels by Western blot analysis. Calcitriol brought about a clear increase in expression of the 82-kDa MZF-1 isoform only (Fig. 4 ), and the magnitude of this response was comparable to that seen in response to PMA (Fig. 4) . In contrast, expression of the 54-kDa isoform of MZF-1 was not affected by treatment with either hormone or PMA (Fig. 4) .


Figure 4
View larger version (37K):
[in this window]
[in a new window]

  		Figure 4. Increased expression of MZF-1 occurs in response to either calcitriol or PMA. (A) THP-1 cells at a concentration of 0.5 x 106 cells/ml were incubated with either 100 nM or 200 nM calcitriol x 48 h or 10 µM PMA x 48 h and after cell lysis, expression of MZF-1 was measured by Western blot analysis. (B) Relative expression of MZF-1 based on scanning densitometry. Results are from one of three identical experiments that yielded similar results.

MZF-1 is required for up-regulation of transcript abundance of both CD11b and CD14 in response to calcitriol
We used siRNA combined with qPCR [35 ] to examine whether the expression of either CD11b or CD14 or both was dependent upon MZF-1. THP-1 cells were transfected separately with three different siRNA constructs in attempts to silence MZF-1. As shown in Fig. 5 , a 50% to 70% decrease in MZF-1 was observed by day 3 after the addition of siRNA, and this was the maximum silencing that we were able of achieving. We also used an irrelevant siRNA as a control transfection and ethanol as a vehicle control.


Figure 5
View larger version (42K):
[in this window]
[in a new window]

  		Figure 5. RNA silencing of MZF-1. THP-1 cells were either mock transfected or transfected with 100 nM of three different siRNA constructs to reduce MZF-1 expression. After 96 h, aliquots of cells were analyzed by Western blot analysis for MZF-1 and actin protein levels. The blots shown are from one of two experiments that yielded similar results. THP-1 cells were also treated with ethanol to test whether it has any effect on expression of MZF-1.

To investigate the requirement for MZF-1 in regulating transcript levels of CD11b and CD14, after silencing of MZF-1, cells were incubated with or without calcitriol and after 3 days, total RNA was extracted and converted to cDNA for quantitative real-time PCR. As expected, in control cells, induction of both CD11b and CD14 expression was observed at 48-72 h after incubation with hormone (Fig. 6A and 6B ). Similar kinetics were also observed in MZF-1 silenced cells. In the latter, however, transcript abundance for both CD11b (Fig. 6A) and CD14 (Fig. 6B) was significantly reduced (maximum inhibition, >90% for CD11b and ~70% for CD14). These findings indicate that MZF-1 is required for activation of transcription of both CD11b and CD14 in response to calcitriol.


Figure 6
View larger version (11K):
[in this window]
[in a new window]

  		Figure 6. Induction of CD11b and CD14 mRNA accumulation in response to calcitriol is dependent upon MZF-1. After silencing of MZF-1, as described in the legend to Fig. 5 , cells were incubated or not with 100 nM calcitriol for 48 h, and CD11b and CD14 mRNA expression was measured by qPCR. (A) CD11b transcript levels in wild-type THP-1 cells [1 ], wild-type cells treated with calcitriol and (3 and 4) MZF-1 silenced cells treated with calcitriol [2 ]. (B) Transcript levels for CD14. Numbers 1-4 are the same as in A.

MZF-1 is required for maximal cell surface expression of CD11b and CD14
We also used siRNA to examine whether cell surface expression of either CD11b or CD14 was dependent upon MZF-1. THP-1 cells were transfected with either of three different siRNA constructs and after MZF-1 silencing, samples were incubated or not with calcitriol for an additional 72 h. Analysis by flow cytometry showed that in cells with reduced levels of MZF-1, there was significant inhibition of surface expression of both CD11b and CD14 (Fig. 7 ). Notably, however, MZF-1 silencing had a greater impact on mRNA levels for CD14 and CD11b when compared with its impact on cell surface expression of these differentiation markers.


Figure 7
View larger version (36K):
[in this window]
[in a new window]

  		Figure 7. Surface expression of CD14 and CD11b after RNAi treatment. After silencing MZF-1 as described in the legend to Figure 5 , THP-cells were treated or not with calcitriol (100 nM, 48 h) and assayed for cell surface expression of CD11b (A) and CD14 (C). (A) Cells were incubated with FITC-conjugated anti- CD11b mouse antibody and analyzed by flow cytometry. The results shown are from one of two experiments that yielded similar results. (B) Statistical analysis of the results of two flow cytometry experiments for CD11b. (C) After treatment, cells were incubated with a monoclonal antibody against CD14, then incubated with FITC-conjugated mouse antibody, and analyzed by flow cytometry. Data shown are from one of two experiments that yielded similar results. (D) Statistical analysis of the results of four flow cytometry experiments for CD14.


arrow
DISCUSSION
 
Calcitriol is known to modulate multiple aspects of host immunity including the differentiation and activation of cells of the myeloid lineage [36 37 38 39 40 41 ]. CD11b and CD14 are important differentiation markers known to be induced by calcitriol [22 ], but the absence of a VDRE in the proximal promoters of the corresponding genes (Fig. 1) indicates that this likely does not involve classical genomic signaling. On the other hand, when we analyzed the proximal promoters of CD11b and CD14 we detected several sites that appeared to be good candidate binding sequences for MZF-1(Fig. 1) . Based upon the detection of these putative MZF-1 binding sites, combined with preferential expression of MZF-1 in myeloid cells [42 ] and its role in regulating differentiation, we inferred that MZF-1 may be involved in the response to calcitriol. This prediction turned out to be correct as the results presented above show that treatment of immature mononuclear cells with calcitriol brought about activation of MZF-1 in a PI3K dependent manner (Fig. 2A and 2B) . This in turn led to induction of the proximal promoters of CD11b and CD14 through what we have now shown to be functional, calcitriol responsive MZF-1 binding sites (Fig. 3A and 3B) . These results establish that MZF-1 is positioned downstream of PI3K in a calcitriol induced signaling pathway leading to myeloid cell differentiation.

MZF-1 belongs to the Kruppel family of zinc finger proteins and contains 13 C2H2 zinc fingers, with fingers 1-4 being found in one domain and the remainder located in a second domain. The MZF-1 gene is located on chromosome 19 and encodes multiple transcripts that are translated into three isoforms: MZF-1, MZF-1B and MZF-1C, with MZF-1 and MZF-1B being the major isoforms. MZF-1 is a 438 aa, 54 kDa protein containing all 13 zinc fingers, while MZF-1B is a 734 aa 82 kDa protein containing all 13 zinc fingers plus a SCAN binding domain [34 ]. SCAN [SRE-ZBP, CTfin51, AW-1 (ZNF174), and Number 18 cDNA] is a conserved motif of 84 residues found predominantly in zinc finger DNA binding proteins in vertebrates. The SCAN domain has oligomerization function and allows self-association or association with other SCAN-domain-bearing proteins [43 ].

MZF-1 has been shown to be preferentially expressed in myeloid progenitor cells [33 ] and transcript levels were observed to increase during retinoic acid-induced granulocytic differentiation in HL60 cells [44 ]. MZF-1 also has been shown to play a key role in regulating gene transcription, such as c-myb and CD34 in embryonic stem cells [45 , 46 ] and PADI1 during keratinocyte differentiation [47 ]. In addition, when antisense oligonucleotides directed against MZF-1 were used, this was found to block granulocyte colony formation induced by granulocyte colony stimulating factor [32 ]. Taken together, these findings provide support for a model in which MZF-1 regulates myeloid cell differentiation and hematopoiesis.

Differentiation of myeloid cells involves broad based and tightly regulated changes in gene expression induced in response to diverse cytokines, growth factors and other agonists [36 , 43 , 48 , 49 ]. Expression of CD11b and CD14 is up-regulated during myeloid cell differentiation and their promoters have binding sites for a number of different transcription factors such as Sp-1 [27 ], CREB [30 ], PU-1 [23 ] and GATA-2 [43 , 50 ]. Although the detailed hierarchy of the actions of each of these transcription factors and their cognate binding sites is not completely understood, the results of the present study show clearly that calcitriol induced MZF-1 binding activity under the control of PI3K within 30 min of cell treatment (Fig. 2A and 2B) . This was associated with a marked increased in transcript expression for both CD11b and CD14 (Fig. 6A and 6B) . Functional evidence that MZF-1 was required for this response was obtained through gene silencing. Here we found that even a 50 to 70% decrease in MZF-1 expression was sufficient to inhibit CD11b and CD14 transcript levels by respectively 90% and 70% (Fig. 6A and 6B) . Notably, the impact of silencing MZF-1 on expression of CD11b and CD14 was much greater at the level of transcript accumulation than it was at the level of cell surface expression (Fig. 7A and 7B) . Although the reasons for this dichotomy are not clear, one potential explanation is the influence of either translational or post-translational mechanisms which may compensate for reduced transcript levels by increasing the expression of membrane CD11b and CD14. The potential for such compensatory mechanisms is consistent with a recent report showing that lovastatin treatment increased the expression of membrane CD14 in RAW264.7 macrophages without any significant change in mRNA levels [51 ]. Of additional interest, in this same study increased expression of membrane-bound-CD14 was accompanied by reduced secretion of soluble CD14, suggesting dynamic post-transcriptional and post-translational regulatory mechanisms.

On the basis of our findings and those reported previously, we believe that the expression of CD11b and CD14 is highly regulated, with the involvement of multiple different transcription factors. Moreover, just as it has become clear that multiple transcription factors may interact with each other to modulate the expression of a wide variety of genes [52 , 53 ], this is also likely to be the case for CD11b and CD14 [54 , 55 ].

A principle finding of this report is that MZF-1 activity appeared to be under the control of a PI3K signaling pathway. As far as we are aware, this is the first report documenting that PI3K can regulate MZF-1. It is also worth noting that the proximal promoters of both CD11b and CD14 contain Sp-1-like sequences located in close proximity to or overlapping with the calcitriol-responsive MZF-1 sites that we identified. Specifically, we found two MZF-1 binding sites within the region spanning –132 to –107 (GCTGGGGAGGAAGGGTGGGCAAGGG) of the CD11b promoter and the Sp-1 binding site is located at the overlapping –116 to –107 position (highlighted in boldface above). In the CD14 promoter, the Sp-1 binding sequence located at position –90 to –82 (GAGGTGGGG) overlaps nearly completely with the active MZF-1 binding site (Fig. 1B) . These observations are of particular interest for two reasons. First, expression of CD11b and CD14 has been shown to be influenced by Sp-1 [28 , 55 , 56 ] and second, the activity of Sp-1 itself is regulated by PI3K downstream of PKC [56 ]. Sp-1 is a ubiquitous transcription factor in mammalian cells, and its activity appears to be influenced by both phosphorylation and glycosylation, as well as by the specific sequences of its binding sites [57 ]. Sp-1 and MZF-1 both belong to the Kruppel family of transcription factors and both bind to GC-rich DNA sequences [33 , 57 ]. Furthermore, it has been reported that Sp-1 interacts with other transcription factors, such as the receptor for calcitriol (VDR) and MEF2D [55 , 58 ]. It has also been found that MZF-1 and Sp-1 can bind to highly similar sequences, as well as to each other and attach to target DNA [59 ]. Taken together, these several lines of evidence suggest the possibility that calcitriol may modulate the activities of both MZF-1 and Sp-1 in a PI3K-dependent manner, leading to changes in the expression of both CD11b and CD14.

One additional point to consider is the potential contribution of extracellular signal-regulated kinases (ERK) to the calcitriol responses that we describe in this report. Using ERK inhibitor PD098059, we observed blunted responses to calcitriol (data not shown), and this was in agreement with published evidence that induction of CD14 and CD11b in response to hormone is ERK dependent [60 ]. Whereas this observation may be explained on the basis of proposed cooperation between PI3K and ERK in regulating Sp-1 [56 , 61 ], it is also possible that MZF-1 activity is dually regulated by these pathways. Initial results that we have obtained showing that inhibition of ERK eliminated MZF-1 DNA binding activity (data not shown) are consistent with such a model and is currently the focus of ongoing studies.

In summary, we show for the first time that calcitriol treatment of immature human mononuclear phagocytes brings about PI3K-dependent activation of MZF-1 DNA binding activity. This is associated with increased binding of MZF-1 to specific sites in the proximal promoters of both CD11b and CD14 and MZF-1-dependent increases in promoter activity. Taken together with other observations reviewed above, these findings show that VDRE-independent responses to calcitriol leading to myeloid cell differentiation likely involve the activity of multiple transcription factors, at least some of which are regulated by PI3K.


arrow
ACKNOWLEDGEMENTS
 
We thank Dorothy Tuan (Medical College of Georgia) for the gift of antibody to MZF-1, Emily Thi (University of British Columbia) for critically reading the manuscript and Jeffrey Helm (University of British Columbia) for editorial assistance and preparation of figures. This work was supported by Canadian Institutes of Health Research (CIHR) operating grants MOP-8633 and MOP-84582 (NR). L. S. and L. L. were supported by a CIHR Training Grant ST163299 for Translational Research in Infectious Diseases.

Received December 14, 2007; revised April 7, 2008; accepted April 21, 2008.


arrow
REFERENCES
 
    1
  1. Seljelid, R., Eskeland, T. (1993) The biology of macrophages: I General principles and properties Eur. J. Haematol. 51,267-275[Medline]
    2. 2
  2. Guha, M., Mackman, N. (2002) The phosphatidylinositol 3-kinase-Akt pathway limits lipopolysaccharide activation of signaling pathways and expression of inflammatory mediators in human monocytic cells J. Biol. Chem. 277,32124-32132[Abstract/Free Full Text]
    3. 3
  3. Fukao, T., Tanabe, M., Terauchi, Y., Ota, T., Matsuda, S., Asano, T., Kadowaki, T., Takeuchi, T., Koyasu, S. (2002) PI3K-mediated negative feedback regulation of IL-12 production in DCs Nat. Immunol. 3,875-881[CrossRef][Medline]
    4. 4
  4. Fukao, T., Koyasu, S. (2003) PI3K and negative regulation of TLR signaling Trends Immunol. 24,358-363[CrossRef][Medline]
    5. 5
  5. Araki, N., Johnson, M. T., Swanson, J. A. (1996) A role for phosphoinositide 3-kinase in the completion of macropinocytosis and phagocytosis by macrophages J. Cell Biol. 135,1249-1260[Abstract/Free Full Text]
    6. 6
  6. Yamamori, T., Inanami, O., Nagahata, H., Kuwabara, M. (2004) Phosphoinositide 3-kinase regulates the phosphorylation of NADPH oxidase component p47(phox) by controlling cPKC/PKCdelta but not Akt Biochem. Biophys. Res. Commun. 316,720-730[CrossRef][Medline]
    7. 7
  7. Hirsch, E., Costa, C., Ciraolo, E. (2007) Phosphoinositide 3-kinases as a common platform for multi-hormone signaling J. Endocrinol. 194,243-256[Abstract/Free Full Text]
    8. 8
  8. Boyle, I. T., Miravet, L., Gray, R. W., Holick, M. F., DeLuca, H. F. (1972) The response of intestinal calcium transport to 25-hydroxy and 1,25-dihydroxyvitamin D in nefrectomized rats Endocrinology 90,605-608[Abstract/Free Full Text]
    9. 9
  9. Nemere, I. (1995) Nongenomic effects of 1,25-dihydroxyvitamin D3: potential relation of a plasmalemmal receptor to the acute enhancement of intestinal calcium transport in chick J. Nutr. 125,1695S-1698S[Abstract/Free Full Text]
    10. 10
  10. Wang, T. T., Tavera-Mendoza, L. E., Laperriere, D., Libby, E., MacLeod, N. B., Nagai, Y., Bourdeau, V., Konstorum, A., Lallemant, B., Zhang, R., et al (2005) Large-scale in silico and microarray-based identification of direct 1,25-dihydroxyvitamin D3 target genes Mol. Endocrinol. 19,2685-2695[Abstract/Free Full Text]
    11. 11
  11. Holick, M. F., Garabedian, M., DeLuca, H. F. (1972) 1,25-dihydroxycholecalciferol: metabolite of vitamin D3 active on bone in anepheric rats Science 176,1146-1147[Abstract/Free Full Text]
    12. 12
  12. Raisz, L. G., Trummel, C. L., Holick, M. F., DeLuca, H. F. (1972) 1,25-dihydroxyvitamin D3 a potent stimulator of bone resorption in tissue culture Science 175,768-769[Abstract/Free Full Text]
    13. 13
  13. Crowle, A. J., Ross, E. J., May, M. H. (1987) Inhibition by 1,25(OH)2-vitamin D3 of the multiplication of virulent tubercle bacilli in cultured human macrophages Infect. Immun. 55,2945-2950[Abstract/Free Full Text]
    14. 14
  14. Liu, P. T., Stenger, S., Li, H., Wenzel, L., Tan, B. H., Krutzik, S. R., Ochoa, M. T., Schauber, J., Wu, K., Meinken, C., et al (2006) Toll-like receptor triggering of a vitamin D-mediated human antimicrobial response Science 311,1770-1773[Abstract/Free Full Text]
    15. 15
  15. Rockett, K. A., Brookes, R., Udalova, I., Vidal, V., Hill, A. V., Kwiatkowski, D. (1998) 1,25-Dihydroxyvitamin D3 induces nitric oxide synthase and suppresses growth of Mycobacterium tuberculosis in a human macrophage-like cell line Infect. Immun. 66,5314-5321[Abstract/Free Full Text]
    16. 16
  16. Zasloff, M. (2006) Fighting infections with vitamin D Nat. Med. 12,388-390[CrossRef][Medline]
    17. 17
  17. Ustianowski, A., Shaffer, R., Collin, S., Wilkinson, R. J., Davidson, R. N. (2005) Prevalence and associations of vitamin D deficiency in foreign-born persons with tuberculosis in London J. Infect. 50,432-437[CrossRef][Medline]
    18. 18
  18. Wilkinson, R. J., Llewelyn, M., Toossi, Z., Patel, P., Pasvol, G., Lalvani, A., Wright, D., Latif, M., Davidson, R. N. (2000) Influence of vitamin D deficiency and vitamin D receptor polymorphisms on tuberculosis among Gujarati Asians in west London: a case-control study Lancet 355,618-621[CrossRef][Medline]
    19. 19
  19. Hmama, Z., Sendide, K., Talal, A., Garcia, R., Dobos, K., Reiner, N. E. (2004) Quantitative analysis of phagolysosome fusion in intact cells: inhibition by mycobacterial lipoarabinomannan and rescue by an 1{alpha},25-dihydroxyvitamin D3-phosphoinositide 3-kinase pathway J. Cell Sci. 117,2131-2140[Abstract/Free Full Text]
    20. 20
  20. Sly, L. M., Lopez, M., Nauseef, W. M., Reiner, N. E. (2001) 1{alpha},25-dihydroxyvitamin D3-induced monocyte antimycobacterial activity is regulated by phosphatidylinositol 3-kinase and mediated by the NADPH-dependent phagocyte oxidase J. Biol. Chem. 276,35482-35493[Abstract/Free Full Text]
    21. 21
  21. Sly, L. M., Guiney, D. G., Reiner, N. E. (2002) Salmonella enterica serovar Typhimurium periplasmic superoxide dismutases SodCI and SodCII are required for protection against the phagocyte oxidative burst Infect. Immun. 70,5312-5315[Abstract/Free Full Text]
    22. 22
  22. Hmama, Z., Nandan, D., Sly, L., Knutson, K. L., Herrera-Velit, P., Reiner, N. E. (1999) 1{alpha},25-dihydroxyvitamin D(3)-induced myeloid cell differentiation is regulated by a vitamin D receptor-phosphatidylinositol 3-kinase signaling complex J. Exp. Med. 190,1583-1594[Abstract/Free Full Text]
    23. 23
  23. Pahl, H. L., Scheibe, R. J., Zhang, D. E., Chen, H. M., Galson, D. L., Maki, R. A., Tenen, D. G. (1993) The proto-oncogene PU.1 regulates expression of the myeloid-specific CD11b promoter J. Biol. Chem. 268,5014-5020[Abstract/Free Full Text]
    24. 24
  24. Methe, H., Kim, J. O., Kofler, S., Nabauer, M., Weis, M. (2005) Statins decrease Toll-like receptor 4 expression and downstream signaling in human CD14+ monocytes Arterioscler. Thromb. Vasc. Biol. 25,1439-1445[Abstract/Free Full Text]
    25. 25
  25. Martin, T. R., Mongovin, S. M., Tobias, P. S., Mathison, J. C., Moriarty, A. M., Leturcq, D. J., Ulevitch, R. J. (1994) The CD14 differentiation antigen mediates the development of endotoxin responsiveness during differentiation of mononuclear phagocytes J. Leukoc. Biol. 56,1-9[Abstract]
    26. 26
  26. Marcinkowska, E., Wiedlocha, A., Radzikowski, C. (1997) 1,25-dihydroxyvitamin D3-induced activation and subsequent nuclear translocation of MAPK is upstream regulated by PKC in HL-60 cells Biochem. Biophys. Res. Commun. 241,419-426[CrossRef][Medline]
    27. 27
  27. Zhang, D. E., Hetherington, C. J., Tan, S., Dziennis, S. E., Gonzalez, D. A., Chen, H. M., Tenen, D. G. (1994) Sp1 is a critical factor for the monocytic specific expression of human CD14 J. Biol. Chem. 269,11425-11434[Abstract/Free Full Text]
    28. 28
  28. Chen, H. M., Pahl, H. L., Scheibe, R. J., Zhang, D. E., Tenen, D. G. (1993) The Sp1 transcription factor binds the CD11b promoter specifically in myeloid cells in vivo and is essential for myeloid-specific promoter activity J. Biol. Chem. 268,8230-8239[Abstract/Free Full Text]
    29. 29
  29. Park, H., Shelley, C. S., Arnaout, M. A. (2003) The zinc finger transcription factor ZBP-89 is a repressor of the human beta 2-integrin CD11b gene Blood 101,894-902[Abstract/Free Full Text]
    30. 30
  30. Moeenrezakhanlou, A., Nandan, D., Shephard, L., Reiner, N. E. (2007) 1{alpha},25-dihydroxycholecalciferol activates binding of CREB to a CRE site in the CD14 promoter and drives promoter activity in a phosphatidylinositol-3 kinase-dependent manner J. Leukoc. Biol. 81,1311-1321[Abstract/Free Full Text]
    31. 31
  31. Giraudo, E., Primo, L., Audero, E., Gerber, H. P., Koolwijk, P., Soker, S., Klagsbrun, M., Ferrara, N., Bussolino, F. (1998) Tumor necrosis factor-alpha regulates expression of vascular endothelial growth factor receptor-2 and of its co-receptor neuropilin-1 in human vascular endothelial cells J. Biol. Chem. 273,22128-22135[Abstract/Free Full Text]
    32. 32
  32. Bavisotto, L., Kaushansky, K., Lin, N., Hromas, R. (1991) Antisense oligonucleotides from the stage-specific myeloid zinc finger gene MZF-1 inhibit granulopoiesis in vitro J. Exp. Med. 174,1097-1101[Abstract/Free Full Text]
    33. 33
  33. Morris, J. F., Rauscher, F. J., III, Davis, B., Klemsz, M., Xu, D., Tenen, D., Hromas, R. (1995) The myeloid zinc finger gene, MZF-1, regulates the CD34 promoter in vitro Blood 86,3640-3647[Abstract/Free Full Text]
    34. 34
  34. Peterson, M. J., Morris, J. F. (2000) Human myeloid zinc finger gene MZF produces multiple transcripts and encodes a SCAN box protein Gene 254,105-118[CrossRef][Medline]
    35. 35
  35. Wright, K. O., Murray, D. A., Crispe, N. I., Pierce, R. H. (2005) Quantitative PCR for detection of the OT-1 transgene BMC Immunol. 6,20[CrossRef][Medline]
    36. 36
  36. Gurlek, A., Pittelkow, M. R., Kumar, R. (2002) Modulation of growth factor/cytokine synthesis and signaling by 1{alpha},25-dihydroxyvitamin D(3): implications in cell growth and differentiation Endocr. Rev. 23,763-786[Abstract/Free Full Text]
    37. 37
  37. Liu, P. T., Stenger, S., Tang, D. H., Modlin, R. L. (2007) Cutting edge: vitamin D-mediated human antimicrobial activity against Mycobacterium tuberculosis is dependent on the induction of cathelicidin J. Immunol. 179,2060-2063[Abstract/Free Full Text]
    38. 38
  38. Noubir, S., Lee, J. S., Reiner, N. E. (2006) Pleiotropic effects of phosphatidylinositol 3-kinase in monocyte cell regulation Prog. Nucleic Acid Res. Mol. Biol. 81,51-95[CrossRef][Medline]
    39. 39
  39. Penna, G., Amuchastegui, S., Giarratana, N., Daniel, K. C., Vulcano, M., Sozzani, S., Adorini, L. (2007) 1,25-dihydroxyvitamin D3 selectively modulates tolerogenic properties in myeloid but not plasmacytoid dendritic cells J. Immunol. 178,145-153[Abstract/Free Full Text]
    40. 40
  40. Stec, M., Weglarczyk, K., Baran, J., Zuba, E., Mytar, B., Pryjma, J., Zembala, M. (2007) Expansion and differentiation of CD14+CD16(-) and CD14+ +CD16+ human monocyte subsets from cord blood CD34+ hematopoietic progenitors J. Leukoc. Biol. 82,594-602[Abstract/Free Full Text]
    41. 41
  41. Wintergerst, E. S., Maggini, S., Hornig, D. H. (2007) Contribution of selected vitamins and trace elements to immune function Ann. Nutr. Metab. 51,301-323[CrossRef][Medline]
    42. 42
  42. Hromas, R., Davis, B., Rauscher, F. J., III, Klemsz, M., Tenen, D., Hoffman, S., Xu, D., Morris, J. F. (1996) Hematopoietic transcriptional regulation by the myeloid zinc finger gene, MZF-1 Curr. Top. Microbiol. Immunol. 211,159-164[Medline]
    43. 43
  43. Stone, J. R., Maki, J. L., Blacklow, S. C., Collins, T. (2002) The SCAN domain of ZNF174 is a dimer J. Biol. Chem. 277,5448-5452[Abstract/Free Full Text]
    44. 44
  44. Hromas, R., Collins, S. J., Hickstein, D., Raskind, W., Deaven, L. L., O'Hara, P., Hagen, F. S., Kaushansky, K. (1991) A retinoic acid-responsive human zinc finger gene, MZF-1, preferentially expressed in myeloid cells J. Biol. Chem. 266,14183-14187[Abstract/Free Full Text]
    45. 45
  45. Nagamura-Inoue, T., Tamura, T., Ozato, K. (2001) Transcription factors that regulate growth and differentiation of myeloid cells Int. Rev. Immunol. 20,83-105[Medline]
    46. 46
  46. Perrotti, D., Melotti, P., Skorski, T., Casella, I., Peschle, C., Calabretta, B. (1995) Overexpression of the zinc finger protein MZF1 inhibits hematopoietic development from embryonic stem cells: correlation with negative regulation of CD34 and c-myb promoter activity Mol. Cell. Biol. 15,6075-6087[Abstract/Free Full Text]
    47. 47
  47. Dong, S., Ying, S., Kojima, T., Shiraiwa, M., Kawada, A., Mechin, M.C., Adoue, V., Chavanas, S., Serre, G., Simon, M., et al (2007) Crucial roles of MZF1 and Sp1 in the transcriptional regulation of the peptidylarginine deiminase type I gene (PADI1) in human keratinocytes J. Invest Dermatol. 128,549-557[Medline]
    48. 48
  48. Chen, R., Alvero, A. B., Silasi, D. A., Mor, G. (2007) Inflammation, cancer and chemoresistance: taking advantage of the toll-like receptor signaling pathway Am. J. Reprod. Immunol. 57,93-107[CrossRef][Medline]
    49. 49
  49. Kusmartsev, S., Gabrilovich, D. I. (2006) Effect of tumor-derived cytokines and growth factors on differentiation and immune suppressive features of myeloid cells in cancer Cancer Metastasis Rev. 25,323-331[CrossRef][Medline]
    50. 50
  50. Ohyashiki, J. H., Ohyashiki, K., Shimamoto, T., Kawakubo, K., Fujimura, T., Nakazawa, S., Toyama, K. (1995) Ecotropic virus integration site-1 gene preferentially expressed in post-myelodysplasia acute myeloid leukemia: possible association with GATA-1, GATA-2, and stem cell leukemia gene expression Blood 85,3713-3718[Abstract/Free Full Text]
    51. 51
  51. Frey, T., De, M. A. (2007) Increased expression of CD14 in macrophages after inhibition of the cholesterol biosynthetic pathway by lovastatin Mol. Med. 13,592-604[Medline]
    52. 52
  52. Cheng, H. T., Chen, J. Y., Huang, Y. C., Chang, H. C., Hung, W. C. (2006) Functional role of VDR in the activation of p27Kip1 by the VDR/Sp1 complex J. Cell. Biochem. 98,1450-1456[CrossRef][Medline]
    53. 53
  53. Saramaki, A., Banwell, C. M., Campbell, M. J., Carlberg, C. (2006) Regulation of the human p21(waf1/cip1) gene promoter via multiple binding sites for p53 and the vitamin D3 receptor Nucleic Acids Res. 34,543-554[Abstract/Free Full Text]
    54. 54
  54. Huang, Y. C., Chen, J. Y., Hung, W. C. (2004) Vitamin D3 receptor/Sp1 complex is required for the induction of p27Kip1 expression by vitamin D3 Oncogene 23,4856-4861[CrossRef][Medline]
    55. 55
  55. Park, S. Y., Shin, H. M., Han, T. H. (2002) Synergistic interaction of MEF2D and Sp1 in activation of the CD14 promoter Mol. Immunol. 39,25-30[CrossRef][Medline]
    56. 56
  56. Rojo, A. I., Salina, M., Salazar, M., Takahashi, S., Suske, G., Calvo, V., de Sagarra, M. R., Cuadrado, A. (2006) Regulation of heme oxygenase-1 gene expression through the phosphatidylinositol 3-kinase/PKC-zeta pathway and Sp1 Free Radic. Biol. Med. 41,247-261[CrossRef][Medline]
    57. 57
  57. Black, A.R., Black, J.D., Zizkhan-Clifford, J. (2001) Sp1 and kruppel-like factor family of transcription factors in cell growth regulation and cancer J. Cell Physiol. 188,143-160[CrossRef][Medline]
    58. 58
  58. Husmann, M., Dragneva, Y., Romahn, E., Jehnichen, P. (2000) Nuclear receptors modulate the interaction of Sp1 and GC-rich DNA via ternary complex formation Biochem. J. 352,763-772[CrossRef][Medline]
    59. 59
  59. Shiraga, T., Winpenny, J. P., Carter, E. J., McCarthy, V. A., Hollingsworth, M. A., Harris, A. (2005) MZF-1 and DbpA interact with DNase I hypersensitive sites that correlate with expression of the human MUC1 mucin gene Exp. Cell Res. 308,41-52[CrossRef][Medline]
    60. 60
  60. Wang, X., Studzinski, G. P. (2001) Activation of extracellular signal-regulated kinases (ERKs) defines the first phase of 1,25-dihydroxyvitamin D3-induced differentiation of HL60 cells J. Cell. Biochem. 80,471-482[CrossRef][Medline]
    61. 61
  61. Zaniolo, K., Gingras, M. E., Audette, M., Guerin, S. L. (2006) Expression of the gene encoding poly(ADP-ribose) polymerase-1 is modulated by fibronectin during corneal wound healing Invest. Ophthalmol. Vis. Sci. 47,4199-4210[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.1207833v1
84/2/519    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moeenrezakhanlou, A.
Right arrow Articles by Reiner, N. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moeenrezakhanlou, A.
Right arrow Articles by Reiner, N. E.