science pharmaceutical expo biotech jobs
Originally published online as doi:10.1189/jlb.0907659 on April 10, 2008

Published online before print April 10, 2008
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow HTML Page - index.htslp
Right arrow All Versions of this Article:
jlb.0907659v1
84/1/152    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vondenhoff, M. F. R.
Right arrow Articles by Golub, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vondenhoff, M. F. R.
Right arrow Articles by Golub, R.
(Journal of Leukocyte Biology. 2008;84:152-161.)
© 2008 by Society for Leukocyte Biology

Separation of splenic red and white pulp occurs before birth in a LT{alpha}β-independent manner

Mark F. R. Vondenhoff*,1, Guillaume E. Desanti{dagger},1, Tom Cupedo{ddagger}, Julien Y. Bertrand§, Ana Cumano{dagger}, Georg Kraal*, Reina E. Mebius* and Rachel Golub{dagger},2

{dagger} Unite du Développement des Lymphocytes, INSERM U668, Institut Pasteur, Paris, France;
* Department of Molecular Cell Biology and Immunology, VU University Medical Center, Amsterdam, The Netherlands;
{ddagger} Erasmus Medical Center, Department of Hematology, Rotterdam, The Netherlands; and
§ University of California, San Diego, La Jolla, California, USA

2Correspondence: Unite du Développement des Lymphocytes, INSERM U668, Institut Pasteur, 25, Rue du Dr Roux, 75724 Paris cedex 15, France. E-mail: rgolub{at}pasteur.fr


arrow
ABSTRACT
 
For the formation of lymph nodes and Peyer’s patches, lymphoid tissue inducer (LTi) cells are crucial in triggering stromal cells to recruit and retain hematopoietic cells. Although LTi cells have been observed in fetal spleen, not much is known about fetal spleen development and the role of LTi cells in this process. Here, we show that LTi cells collect in a periarteriolar manner in fetal spleen at the periphery of the white pulp anlagen. Expression of the homeostatic chemokines can be detected in stromal and endothelial cells, suggesting that LTi cells are attracted by these chemokines. As lymphotoxin (LT){alpha}1β2 can be detected on B cells but not LTi cells in neonatal spleen, starting at 4 days after birth, the earliest formation of the white pulp in fetal spleen occurs in a LT{alpha}1β2-independent manner. The postnatal development of the splenic white pulp, involving the influx of T cells, depends on LT{alpha}1β2 expressed by B cells.

Key Words: lymphoid tissue inducer cells • organogenesis • embryo • chemokines • stroma • mouse


arrow
INTRODUCTION
 
The spleen is composed of a branching splenic artery that eventually ends in venous sinuses. The arterial branches, central arterioles, are surrounded by a layer of lymphoid tissue, the white pulp. It consists of T cell areas and B cell follicles, more or less resembling the organization found in lymph nodes (LN). The arterial blood ends in a sinusoid system in the area surrounding the T and B cell zones, thereby forming an anatomical border between the white and red pulp, the marginal zone. Here, sinusoid spaces formed by lining cells continuous with the endothelium of the arterioles and reticular fibroblasts make up a network through which the blood freely percolates on its way to the red pulp and can be scanned for pathogens and debris by macrophages and dendritic cells (DC). The blood runs from the marginal zone through the red pulp cords into the venous sinuses, enabling the spleen to exert its function as a filter of the blood by removal of effete RBCs [1 2 3 4 5 ]. For development and organization of lymphoid organs, the members of the TNF superfamily are crucial. The organogenesis of Peyer’s patches (PP) and LN is dependent on the expression of lymphotoxin (LT){alpha}1β2 and other TNF family members [6 7 ]. During fetal and neonatal life, LT{alpha}1β2 is expressed by CD45+CD4+IL-7R{alpha}+CD3– lymphoid tissue inducer (LTi) cells in PP and LN anlagen [8 9 ]. LTi cells are attracted by nonhematopoietic stromal cells that express the homeostatic chemokines CCL19, CCL21, and CXCL13, as well as the adhesion molecules VCAM-1, ICAM-1, and mucosal addressin cell adhesion molecule-1 (MAdCAM-1) [10 11 12 ]. These molecules are thought to be induced by the interaction of LTi and stromal cells, which leads to LTβ receptor (LTβR) and TNFR-I triggering [13 ]. Expression of these molecules favors the subsequent recruitment and retention of more LTi cells as well as other hematopoietic cells [10 ].

For the proper development of the murine neonatal lymphoid part of the spleen, indications that LT{alpha}1β2 is involved so far only stem from data obtained after birth, which show that LT{alpha}1β2-expressing B cells are required for the induction of sufficient CCL21, produced by stromal cells in the T cell zone areas [14 ]. Considering the important role of LTi cells in the organogenesis of other lymphoid organs, relatively little is known about their role in spleen development, although their presence has been demonstrated in the fetal spleen as early as Embryonic Day 13.5 (E13.5) [8 15 ]. Transfer of in vitro, IL-7-activated, splenic LTi cells was shown to restore the B and T lymphocyte (B/T) segregation in spleens of LT{alpha}–/– mice [16 ], suggesting a role for LTi cells in white pulp development. As these experiments may not reflect the actual interactions and cellular requirements during fetal and neonatal spleen development, we studied the role of LTi cells in the developing splenic white pulp in more detail. Our results show that neonatal, splenic LTi cells lack LT{alpha}1β2 expression and that LT{alpha}1β2, required for correct formation of the splenic white pulp, is expressed by B cells starting approximately 4 days after birth. Analysis of the earliest events during spleen development demonstrates that compartmentalization of red and white pulp areas starts to be regulated during embryogenesis. By grafting fetal spleens, distinct white pulp areas containing donor-derived LTi and B cells and red pulp areas harboring erythrocytes can be observed. Therefore, the white pulp stroma are already primed before E15.5 to segregate away from the red pulp areas. Moreover, we suggest that this early phase of stroma instruction is independent of the LTβR pathway during murine spleen development.


arrow
MATERIALS AND METHODS
 
Animals
C57BL/6 mice were purchased from Harlan (Horst, The Netherlands) and from Charles River (Saint Germain sur l’Arbresie, France), and LT{alpha}–/– mice were purchased from Charles River (Maastricht, The Netherlands). All mouse strains were bred in the animal facilities of the VU University Medical Center (VUMC; The Netherlands) or the Institut Pasteur (France) and kept under routine laboratory conditions. The ethical committees of the VUMC and Institut Pasteur approved all animal procedures.

Timed pregnancies
Mice were mated overnight, and the day of vaginal-plug detection was marked as E0.5. Pregnant females were killed at different time-points, and embryos were harvested and frozen in OCT-embedding medium (Sakura Finetek Europe BV, The Netherlands) or used for dissection.

Immunofluorescence
Cryosections (7 µm) were fixed in dehydrated acetone for 2 min and air-dried for an additional 15 min. Endogenous avidin was blocked with an avidin-biotin block (Vector Laboratories, Burlingame, CA, USA). Sections were then preincubated in PBS supplemented with 5% (v/v) mouse serum for 10 min. Incubation with primary antibody for 45 min was followed by a 30-min incubation with Fluor-Alexa-labeled conjugate (Invitrogen Life Technologies, Breda, The Netherlands) when needed. All incubations were carried out at room temperature. Before embedding in polyvinyl alcohol, sections were counterstained with Hoechst 33342 (Invitrogen Life Technologies) for 10 min. Stainings were analyzed on a Leica TCS-SP2-AOBS confocal laser-scanning microscope (Leica Microsystems Nederland BV, The Netherlands), and images were obtained with Leica confocal software. Image processing involved contrast enhancement and region of interest selection, which was carried out with Jasc Paintshop Pro 7.0. Lenses used were dry lenses: 20x (HC PL APO CS 0.7); 40x (HCX PLAN APO 0.85).

Fetal spleens grafted under the kidney capsule were dissected and incubated overnight in 15% saccharose PBS at 4°C prior to cryosectioning. Sections were analyzed on a Zeiss Axioplan 2 imaging upright microscope with a Zeiss Axiocam Hrc camera and Zeiss Axiovision 4.2 software.

Whole-mount fetal spleen immunostaining
E15.5 fetal spleens were incubated overnight in 4% paraformaldehyde in PBS while agitating at 4°C. Spleens were washed twice in PBS 1x, 10% FCS, 0.1% Triton X-100 solution while agitating during 90 min and incubated overnight with RMA4-5 (anti-CD4-FITC) antibody at 4°C under agitation. After washes, spleens were stained with Hoechst 33342 for 90 min, washed, and then embedded in Vectashield (Vector Laboratories) and analyzed on a Zeiss Axioplan 2 imaging upright microscope with a Zeiss Axiocam Hrc camera and Zeiss Axiovision 4.2 software.

Fetal spleen grafts
The fetal spleen harvested from E14.5 to E16.5 C57BL/6 (CD45.2) embryos was placed under the kidney capsule of Rag2/{gamma}c–/– (CD45.1) mice by surgery. The Rag2/{gamma}c–/– (CD45.1) recipient mice [17 ] were anesthetized by peritoneal injection of 1.4 mg/g ketamine (Merial, France) and 7 µg/g xylazine (Sigma-Aldrich Steinheim, Germany) diluted in PBS. Two hours before the anesthesia, some Rag2/{gamma}c–/– (CD45.1) recipient mice were injected with a total C57BL/6 (CD45.2) fetal liver cell suspension. For negative control, sham-operated recipients were anesthetized, and their kidney capsule was opened without grafting a fetal spleen.

Antibodies
For flow cytometry and immunofluorescence, the following antibodies were used: GK1.5 (anti-CD4 [18 19 ]), MECA-367 (anti-MAdCAM-1 [20 ]), MP33 (anti-CD45, BD Biosciences, Belgium), 6B2 (anti-B220 [21 22 ]), 3E2 (anti-ICAM-1 [23 24 ]), and MOMA-2 (a pan macrophage marker) [25 ]. All of the antibodies were affinity-purified from hybridoma cell culture supernatants with protein G-Sepharose (Pharmacia, Uppsala, Sweden) and biotinylated or labeled with Alexa-Fluor 488, Alexa-Fluor 546, or Alexa-Fluor 633 (Invitrogen Life Technologies). 429 (anti-VCAM-1, BD Biosciences), A7R34 (anti-IL-7R{alpha}, eBioscience, San Diego, CA, USA), 11D4.1 [anti-vascular endothelial (VE)-cadherin, BD Biosciences], RMA4-5 (anti-CD4, BD Biosciences), 30-F11 (anti-CD45, BD Biosciences), 104 (anti-CD45.2, BD Biosciences), RA3-6B2 (anti-B220, BD Biosciences), 1D3 (anti-CD19, BD Biosciences), Ter-119 (BD Biosciences), PK136 (anti-NK1.1, BD Biosciences), RAM34 (anti-CD34, BD Biosciences), Avas 12{alpha}1 [anti-vascular endothelial growth factor receptor (VEGFR)-2, BD Biosciences], HL3 (anti-CD11c, BD Biosciences), 145-2C11 (anti-CD3{epsilon}, BD Biosciences), 7G6 (anti-CD21, BD Biosciences), and A20 (anti-CD45.1, BD Biosciences) anti-VE-cadherin (Alexis Corp., Switzerland) were used as biotinylated, fluorescently labeled or unconjugated, primary antibodies. The antibody anti-rat-IgG-tetramethylrhodamine-isothiocyanate (Chemicon International, El Segundo, CA, USA) was used as a secondary antibody.

Flow cytometry
LN and spleens were dissected using a stereomicroscope, and single cell suspensions were made by digestion with 0.5 mg/ml collagenase type IV (Sigma-Aldrich) in PBS, 2% FBS, for 30 min at 37°C while constantly stirring. For surface LT{alpha}1β2 detection, cells were pretreated with 2.4G2 (anti-CD16/32), supplemented with 5% normal mouse serum for 30 min, and subsequently incubated with a LTβR-human IgG fusion protein [26 ] for 60 min. Anti-human-IgG-PE (Jackson ImmunoResearch Laboratories, West Grove, PA, USA) was used as a second-step conjugate. Splenocytes from adult LT{alpha}–/– mice were used as negative controls. Flow cytometric analysis was performed on a FACSCalibur using CellQuest software (BD Biosciences). Cells were negatively gated for TCR-{alpha}β to exclude all T cells. 7-Aminoactinomycin D (Molecular Probes, Eugene, OR, USA) was used to exclude dead cells. For each staining, negative control stainings were carried out, in which LTβR-human IgG fusion protein was incubated together with anti-LTβ mAb (BBF6), which prevents the binding of LTβR-human IgG (Alexis Benelux, The Netherlands) to cell surface LT{alpha}1β2 [8 ].

For analysis of fetal spleen and fetal spleen grafts, the organs were dissected using a stereomicroscope, and single cell suspensions were made by dissociation with a 26-gauge, 3/8-inch needle. Propidium iodide (Sigma-Aldrich) was used to exclude dead cells. Flow cytometric analyses were performed in an upgraded LSR (Becton Dickinson, San Jose, CA, USA) using FlowJo software (Tree Star, Ashland, OR, USA).

RT-PCR, semi-quantitative PCR, and quantitative real-time PCR
Stromal cells from E15.5 fetal spleen were sorted by flow cytometry on a MOFLO (Dako, Fort Collins, CO, USA), lysed in RLT buffer (Qiagen, Germany), and frozen on dry ice. Total RNA was extracted with an RNeasy micro kit (Qiagen), according to the manufacturer’s protocol. The cDNA was prepared from 3 x 103 to 3 x 106 cells using random primers, SuperScript II RT, RNase OUT in a reaction volume of 24 µl. PCR reactions (Invitogen Life Technologies) were performed with Amplitaq Gold (Applied Biosystems, Bridgewater, NJ, USA) in a reaction volume of 25 µl.

The primers used were β-actin, forward: CCGCGAGCACAGCTTCTTT, β-actin, reverse: CTTTGCACATGCCGGAGC; Vcam-1, forward: GCTCTGGGAAGCTGGAACGA, Vcam-1, reverse: TTCATGAGCTGGTCACCCTTGA. cDNA was diluted at 1/10 and 1/100, and results from the 1/100 dilution were used to measure intensity of the band using the ImageJ 1.38 application. Intensity was normalized using the β-actin transcript levels (100%).

The cDNA samples used for quantitative real-time PCR were obtained by using RT2 PCR Array First Strand kit (SuperArray Bioscience Corp., Frederick, MD, USA) for the RT step. The RT2 Profiler PCR Array "Mouse Chemokines and Receptors" (SuperArray Bioscience Corp.) and the RT2 Real-Time SYBR Green/6-carboxy-X-rhodamine PCR Master Mix (SuperArray Bioscience Corp.) were used for real-time PCR quantification. The real-time PCR was performed on a 7300 Real-Time PCR system (Applied Biosystems). The products of each reaction were checked by 2% agarose gel electrophoresis migration.

CD4+IL-7R{alpha}+ CD3{epsilon}– cells from 3-day-old mice intestine previously dissociated by dispase (Gibco-BRL, Grand Island, NY, USA) treatment and CD4hiLin– (Lin: Gr-1, B220, Ter119, CD11c, CD19, NK1.1, CD3{epsilon}) cells from E15.5 fetal spleen were sorted by flow cytometry on a MOFLO (Dako), lysed in TRIzol (Gibco-BRL), and frozen at –20°C. Total RNA was extracted according to the TRIzol (Gibco-BRL) manufacturer’s protocol. Oligo (dT)-primed cDNA was prepared using SuperScript II RT (Invitogen Life Technologies) in a reaction volume of 20 µl. PCR reactions were performed with Amplitaq Gold (Applied Biosystems) in a reaction volume of 25 µl. The primers used were retinoid-related orphan receptor (ROR){gamma}/{gamma}t, forward: GCCTCCTGAGAGCCTCAGG, ROR{gamma}/{gamma}t, reverse: CACCTCCTCCCGTGAAAG.


arrow
RESULTS
 
Characterization of the developing spleen
Human fetal spleen development was recently characterized, and already at the 2nd stage of development when the first lymphocytes start to colonize the organ, distinct areas could be observed where the homeostatic chemokine CXCL13 was expressed. The presence of CXCL13 in arterial smooth muscle cells as well as cells around these arterioles [27 ] suggested the interaction of these stromal cells with LTi cells in analogy with the developing LN and a role in the further development of the spleen. To further define the earliest events in spleen development, we addressed whether these distinct areas could also be found in murine spleen. Here, fetal spleens from E18.5 were stained for endothelial, hematopoietic, as well as stromal markers. Combined staining of tyrosine kinase with Ig and epidermal growth factor homology domain 2 (Tie-2/Tek), a marker for endothelial cells [28 ], and CD45 revealed the presence of an artery with a contracted lumen and a vein with an open lumen in between hematopoietic cells at this time-point in development (Fig. 1A and D ). CD45+ hematopoietic cells were remotely located in a ring-like pattern around the artery (Fig. 1B) , and the venous blood vessel was immediately surrounded by hematopoietic cells (Fig. 1C) . To define the expression of MAdCAM-1, a marker for LN stromal organizer cells [29 ] as well as high endothelial venules [30 ], fetal spleens were stained for MAdCAM-1 in combination with the endothelial marker VE-cadherin [31 ]. The results showed that most VE-cadherin+ endothelial cells expressed MAdCAM-1 at high levels (Fig. 1E and Supplemental Fig. 1A–C). Stainings of subsequent sections showed that endothelial cells of large vessels also expressed ICAM-1, and VCAM-1 was absent or expressed at low levels (Fig. 1F) . In addition, around the artery, VCAM-1+ cells were found. As LTi cells were reported by us to be present at early stages in developing spleen [8 ], we performed additional stainings for IL-7R{alpha} and CD4 in subsequent sections to detect these cells. Interestingly, CD4+IL-7R{alpha}+ LTi cells were located in a ring-like pattern at the periphery of the VCAM-1+ stromal cells, adjacent to MAdCAM-1hiVE-cadherin+ endothelial cells (Fig. 1E 1F 1G) . The distinct locations of these cell types are depicted in a schematic drawing (Fig. 1H) . To confirm that CD4+IL-7R{alpha}+ cells were indeed LTi cells, we performed triple stainings for ROR{gamma}, which is indispensable for LTi differentiation [32 ], IL-7R{alpha}, and CD4. These stainings showed that all CD4+IL-7R{alpha}+ contained ROR{gamma}, indicating that these cells were indeed LTi cells (Supplemental Fig. 1D–H and Supplemental Fig. 2). Few ROR{gamma}–IL-7R{alpha}–CD4+ cells were found at developmental stage E18.5 (data not shown).


Figure 1
View larger version (44K):
[in this window]
[in a new window]

  		Figure 1. Murine fetal spleens at developmental stage E18.5. Immunofluorescence stainings (A–C and E–G) and schematic drawings (D and H). (E–G) Serial sections. (A) Murine fetal spleen consisting of Tie-2+ endothelial cells and CD45+ hematopoietic cells (Tie-2 in green; CD45 in red). The outline of the fetal spleen is indicated in white. A major vein (A and C, arrowheads) and artery (A and B, double arrowheads) can be distinguished at this time-point in development. (D) Schematic drawing of fetal spleen showing outline and position of vein and artery. (E) High magnification image of blood vessel endothelial cells expressing MAdCAM-1 (in green) and VE-cadherin (in red). VE-cadherin+ blood vessels with the highest MAdCAM-1 expression (yellow) are marked by arrows. Vein (arrowhead) and artery (double arrowhead) are MAdCAM-1+VE-cadherin+ (orange). (F) Expression of ICAM-1 (in red) and VCAM-1 (in green) by endothelial cells and splenic stromal cells. ICAM-1+VCAM-1+ arterial endothelial cells (orange) are immediately surrounded by VCAM-1+ stromal cells (double arrowhead, green). The outline of these cells is indicated in white. Arrowhead indicates a vein. (G) LTi cells expressing IL-7R{alpha} (in green) and CD4 (in red) positioned distal to the artery and VCAM-1+ stromal cells, forming a ring-like structure (double arrowhead) that is not found around the vein (arrowhead). (H) Schematic drawing of the outlines of arterial endothelial cells (i), VCAM-1 + ICAM-1- stromal cells (ii), and LTi cells forming a ring-like structure (iii). Outward from this structure, blood vessels with the highest MAdCAM-1 expression are found. Overview image of fetal spleens is shown at 20x original magnification in A. Detailed images of fetal spleens are shown at 40x original magnification, Zoom 2, in B, C, and E–G. Data are representative of four individual mice.

To see whether a distinct pattern of LTi cells in the proximity of vessels could also be observed at earlier stages of spleen development, serial sections of E14.5 and E16.5 spleens were analyzed. Therefore, we investigated the vasculature of the fetal spleen in more depth by staining sections of E16.5 and E14.5 fetal spleens for VE-cadherin combined with 4',6-diamidino-2-phenylindole (DAPI) and MECA-32 staining. The latter antibody has been described as an endothelial marker [33 ]. The combination of both endothelial markers allowed us to focus on the artery, which can be distinguished by expression of VE-cadherin and lack of MECA32 (VE-cadherin+MECA-32–). At E16.5 in development, we could identify LTi cells around this VE-cadherin+MECA-32– artery, again organized in a ring-like pattern. In addition, we found single LTi cells and small, poorly organized clusters in other areas of the fetal spleen (Fig. 2A 2B 2C 2D ). At E16.5, most of the vessels were MAdCAM-1+ (Supplementary Fig. 1I–K), similar to E18.5 splenic vessels. In addition, VCAM-1+ stromal cells could be distinguished that were organized around the large VE-cadherin+MECA-32– artery (Fig. 2B and 2C) . Stromal cells and LTi cells appeared to be intermingled, instead of strictly separated, as seen in E18.5 fetal spleens. Although at E14.5, LTi cells could be detected in the fetal spleen in the vicinity of blood vessels, they were not yet organized in a ring-like structure, as observed at E16.5 and E18.5 (Fig. 2E 2F 2G 2H) . Strikingly, we could only identify one major blood vessel in the center of the spleen at E14.5. The lumen of this vessel was large, and apart from the expression of VE-cadherin, it was weakly stained for MECA-32 (Fig. 2F) . In addition, at this time-point in development, numerous smaller vessels expressed MAdCAM-1 and ICAM-1, but VCAM-1 expression in the fetal spleen was limited at this developmental time-point (Fig. 2G and Supplementary Fig. 1L–O). VCAM-1 expression could be observed in deeper layers of the stomach wall, indicating that it was not a result of a detection failure (Supplementary Fig. 1, L and M). To see whether LTi cells indeed preferentially distribute to certain splenic areas, whole-mount E15.5 spleens were stained for CD4. These stainings showed that CD4 cells were clustered and that these clusters were distributed linearly along the length of the entire spleen (Fig. 2I) , indicating that the early compartmentalization of the fetal spleen may attract LTi cells to periarteriolar domains. In addition, a limited number of single CD4+ cells were found in the spleen at other areas.


Figure 2
View larger version (53K):
[in this window]
[in a new window]

  		Figure 2. Murine fetal spleens at stages E14.5, E15.5, and E16.5 of development. Immunofluorescence staining of serial sections from E16.5 (A–D) and E14.5 (E–H) spleens. (A) Double staining for MECA-32 (in green) and VE-cadherin (in red) counterstained with DAPI (in blue) to visualize nuclei. Most of the smaller vascular blood vessels appeared to express MECA-32 and VE-cadherin. (B) Higher magnification image showing a MECA-32+ vein that is VE-cadherinlo (arrowhead) and a VE-cadherin+ artery that lacks expression of MECA-32 (double arrowhead). (C) ICAM-1+VCAM-1+ artery (double arrowhead) surrounded by VCAM-1+ stromal cells (ICAM-1 in red; VCAM-1 in green). (D) IL-7R{alpha}+CD4+CD45lo LTi cells are organized around arterial endothelial cells (double arrowhead) (CD45 in green; IL-7R{alpha} in red; CD4 in blue). (E) E14.5 spleen (arrow) and stomach (arrowhead) containing MECA-32+VE-cadherin+ blood vessels (MECA-32 in green; VE-cadherin in red) counterstained with DAPI (in blue). (F) At E14.5, all blood vessels (orange) are double-positive for MECA-32 and VE-cadherin including a larger blood vessel. The outline of the larger vessel is indicated in white. (G) At this time-point, most endothelial cells express MAdCAM-1 (in blue) and ICAM-1 (in red), and VCAM-1 expression is virtually absent in the fetal spleen (in green). (H) In the near vicinity of the larger vessel, CD45+ hematopoietic cells are localized, including IL-7R{alpha}+CD4+CD45lo LTi cells (CD45 in green; IL-7R{alpha} in red; CD4 in blue). Images showing sagital-sectioned fetal spleen (E16.5) or transverse-sectioned fetal spleen and stomach (E14.5) at 20x original magnification. Higher magnification images of fetal spleens are shown at 40x original magnificaiton and Zoom 2 in B–D and F–H. The outline of major blood vessels is marked in white. (I) On E15.5 fetal spleen, whole-mount immunofluorescent staining was performed to locate CD4+ cells. Data are representative of four (E14.5) or five (E15.5, E16.5) individual mice.

Distinct stromal subsets are present in the fetal spleen
As LTi cells are localized within special areas of the spleen, we assumed that these cells are colocalizing with a specific stromal cell subset and that various stromal cell populations could be expected to exist in fetal spleens. We therefore analyzed stromal cells present in E15.5 fetal spleen by FACS (Fig. 3 A ). After elimination of leukocytes (CD45+) and erythrocytes (Ter119+), the E15.5 fetal spleen stroma could be separated into two populations, based on the expression of VE-cadherin. As can be inferred from immunofluorescent stainings (Figs. 1 and 2) , splenic stromal cells that surround arterial vessels lack endothelial markers such as VE-cadherin. In addition, endothelial cells express VE-cadherin and are CD45–, determined by FACS analysis (Fig. 3A and 3B) . To confirm that VE-cadherin+ cells indeed represent endothelial cells, expression of other endothelial markers was analyzed. Although 17% of the CD45–Ter119–cells could be distinguished as a population of CD34+ICAM1+VEGFR2+VE-cadherin+Tie-2+ endothelial cells, the remaining 82% of fetal spleen CD45–Ter119– cells was characterized as CD34–ICAM1–/loVEGFR2–VE-cadherin–Tie-2– stromal cells (Fig. 3A and 3B) . By semiquantitative RT-PCR, we found VCAM-1 transcripts in both subsets with a probable lowest quantity in the CD34– stromal subset (Fig. 3C) . As LTi cells were found to be associated with endothelial cells in the spleen, we addressed whether splenic CD45– cells could produce the chemokines that are known to attract LTi cells. Quantities of CXCL12, CXCL13, CCL19, and CCL21b transcripts were determined in CD34– stromal and CD34+ endothelial subsets of CD45–Ter119– cells (Fig. 3D) . The expression levels of CXCL12 and CXCL13 were relatively similar in both CD45–Ter119– subsets. In contrast, levels of CCL19 and CCL21b transcript expression were 100- and 1000-fold higher in the CD34+ endothelial fraction than in the CD34– stromal fraction, respectively.


Figure 3
View larger version (45K):
[in this window]
[in a new window]

  		Figure 3. The stromal compartment of E15.5 fetal spleen. (A) At E15.5, the fetal spleen (FS) stroma were isolated as CD45–propidium iodide (PI)–Ter119– cells, and two subsets were distinguished based on CD34 and ICAM-1 expression. Most cells were CD34– ICAM1–/lo, and a small subset was formed by CD34+ICAM1+ cells. FSC, Forward-scatter; SSC, side-scatter. (B) These subsets of stromal cells were analyzed for the surface expression of VEGFR2, VE-cadherin, and Tie-2. (C) Semiquantitative RT-PCR analysis of the Vcam1 gene in the E15.5 fetal spleen populations (dilution with a factor 10). Intensity was quantified to measure the difference of Vcam1 expression normalized by β-actin levels. (D) Quantitative real-time PCR was performed to study the relative expression of Cxcl12, Cxcl13, Ccl19, and Ccl21b chemokines from the CD34–ICAM1– (blue histograms) and CD34+ICAM1+ (orange histograms) stromal populations. The average of Gadph and hypoxanthine guanine phosphoribosyl transferase housekeeping gene levels was used for the normalization. Results are obtained from two independent cell sorting, and each sorted population is represented by a specific histogram.

White pulp anlagen is already primed in fetal spleen
The expression of homeostatic chemokines by CD45–Ter119– cells and the preferential localization of LTi cells to VE-cadherin+ endothelial cells at the periphery of the MAdCAM-1+ stromal areas raised the question of whether these periarteriolar areas constituted the anlagen of the white pulp. To address whether these designated areas could mature into splenic white pulp areas, spleens from E15.5 C57BL6 embryos were grafted under the kidney capsule of adult Ly5.1 Rag2/{gamma}c–/– immunodeficient mice (Fig. 4 A ). The use of Rag2/{gamma}c–/– alymphoid mice was essential to avoid substantial contamination by host-derived lymphocytes. B cell precursors are present in fetal spleen at the time of transplantation, and they are able to differentiate into mature CD19+B220+ B cells in situ. When the grafts were analyzed at 3 weeks after transplantation, they showed good vascularization and had increased in size, showing that the hematopoietic progenitors present in E15.5 fetal spleens were able to proliferate and differentiate in situ. Grafts performed with E14.5 spleen also showed proliferation and differentiation of CD45+ progenitors within the grafted spleens (data not shown).


Figure 4
View larger version (60K):
[in this window]
[in a new window]

  		Figure 4. Early priming of the fetal spleen stroma. LTi cells maintain in fetal spleen graft and colocalize with B cells. (A) Three weeks after engraftment of CD45.2+ fetal spleens under the kidney capsule of CD45.1+ Rag2/{gamma}c–/– mice, grafts were analyzed by immunohistology for LTi cells (CD4 in green), B cells (B220 in white), and erythrocytes (Ter119 in red; FS Graft). The first quadrant represents LTi cells forming ring-like structures (white ovals) with a vein (arrowhead) devoid of LTi cells. The second quadrant displays LTi cells and B cells in close contact to each other. The same experiment, supplemented with injection of CD45.2+ fetal liver cells (FL), was used as a positive control for splenic architecture, and most CD4+ cells (green) are T cells (FS Graft+FL Injection). Original blue bar, 200 µm. (B) Grafts were analyzed for their composition. Cells were separated between graft-derived (CD45.2+) and host-derived (CD45.1+) and analyzed by flow cytometry for the presence of LTi (CD4+CD3{epsilon}–IL7R{alpha}+), B (CD19+B220+ and B220+CD21+), NK (NK1.1+CD3{epsilon}–), and T (CD3{epsilon}+) cells and DC (CD11c+). Data are representative of analysis of three individual grafted mice.

Analysis by immunofluorescence showed that B cells and LTi cells colocalized in an area that did not contain Ter119+ erythrocytes, indicative of a B/LTi-containing white pulp area and a Ter-119-containing red pulp area (Fig. 4A) . In Figure 4A , only LTi cells are stained to clearly observe the structure of the spleen (LTi clusters and vein). Development of these areas within the grafted spleens indicated that the stroma had been instructed to retain LTi cells to restricted areas that are common to B cells. It appeared that the designation of the white pulp anlagen, containing LTi cells, had already taken place at E15.5, independently of mature, circulating lymphocytes.

In parallel, splenic grafts were analyzed by FACS to assess the presence of donor-derived LTi, B, NK, and T cells (Fig. 4B) . Depending on the graft, the proportion of hematopoietic donor cells (CD45.2+) varied, whereas the percent of host (CD45.1+) hematopoietic cells, containing myeloid and CD11c+ DC, was constant (approximately 10%; Fig. 4B ). Within the pool of donor-derived hematopoietic cells, clear populations of LTi (CD4hiCD3–IL7R{alpha}+) and B (CD19+B220+) cells were seen, whereas some of these B cells expressed high levels of CD21, potentially representing marginal Zone B cells (Fig. 4B) . Few graft-derived NK cells could be observed (Fig. 4B) .

Injection of E15.5 total fetal liver cells from C57BL/6 embryos during splenic transplant permits full reconstitution of the hematopoietic compartment of the alymphoid recipients. In these cases, the B and T cells and erythrocytes were clearly distributed into organized white and red pulp areas. The white pulp areas showed normal B/T segregation, indicating that T and B cells could normally enter the white pulp areas (Fig. 4A) .

LT{alpha}1β2 expression during spleen development
LTi cells in developing LN are instrumental for the induction of homeostatic chemokines in developing LN through their expression of LT{alpha}1β2 [34 ]. According to the literature, the development of the spleen requires LT{alpha}1β2-expressing cells postnatally [14 35 36 ], whereas we showed here that homeostatic chemokines could already be observed before birth. Therefore, we addressed at what time-point the earliest LT{alpha}1β2-expressing cells could be observed using FACS analysis of postnatal spleens. Mesenteric LN (MLN) from the same animals were included as positive controls. Analysis of Days 0, 2, and 4 and adult wild-type spleens revealed a gradual increase of LT{alpha}1β2 on splenic B cells (Fig. 5 A ). At Days 0 and 2, only 1% of all B cells expressed LT{alpha}1β2, and this increased to 2.7% at Day 4. In adult spleens, 12.5% of total B cells expressed LT{alpha}1β2 (Fig. 5B) .


Figure 5
View larger version (35K):
[in this window]
[in a new window]

  		Figure 5. LTβR-binding cells in neonatal spleen and MLN. LTβR-human IgG (huIgG) binding to B cells (A and B) or LTi cells (C and D) was analyzed by flow cytometry at indicated days after birth, and four mice per group were analyzed.

In contrast, few LT{alpha}1β2-expressing LTi cells could be detected in neonatal spleens, and LTi cells from MLN expressed high levels of LT{alpha}1β2, in accordance with our earlier report (Fig. 5C) [26 ]. When compensated for a specific binding (Supplementary Fig. 3), the percentage of LT{alpha}1β2+ LTi cells in the spleen varies between 1.5% and 2.2% of all LTi cells, implicating that LT{alpha}1β2+ LTi cells are rare (Fig. 5D) .

LT{alpha}1β2 -dependent white pulp development
As we observed few LT{alpha}1β2-expressing cells at Day 2 after birth, we reasoned that before Day 2, splenic development, including the formation of the white pulp anlagen, occurred independently of LT{alpha}1β2-mediated LTβR triggering. To confirm this, spleens from LT{alpha}–/– mice taken at Days 2, 4, and 6 after birth were analyzed. In wild-type and LT{alpha}–/– mice, small accumulations of B220+ B cells could be found at 2 days after birth around arterioles in the spleen, indicative of undisturbed formation of white pulp areas. In addition, few CD3+ T cells were seen at this time-point in or near B cell areas in wild-type and LT{alpha}–/– animals (Fig. 6 A ). The effect of the absence of LT{alpha}1β2-expressing cells could be observed around Day 4, when B cell areas were still small in LT{alpha}–/–, and they had clearly increased in size in wild-type mice from Days 2 to 4. In addition, T cell areas were completely absent in LT{alpha}–/– spleens at all stages analyzed, and these were clearly present in wild-type spleen at Day 4 and had further enlarged at Day 6 (Fig. 6A) . Despite the dramatic differences for the B and T cell populations, we could not find a clear difference with respect to MOMA-2+ macrophages. In fact, the amount of MOMA-2+ cells that were found in close proximity to central arterioles appeared even higher in LT{alpha}–/– spleens when compared with wild-type spleens at Day 4 (Fig. 6A , and data not shown).


Figure 6
View larger version (108K):
[in this window]
[in a new window]

  		Figure 6. Early stages of white pulp development occur in the absence of LT{alpha}. Immunofluorescence staining of 2-, 4-, and 6-day-old spleens from C57BL/6 (B6) and LT{alpha}–/– mice was done using (A) anti-B220, anti-CD3, and anti-MOMA-2 antibodies to detect, respectively, B cells, T cells, and macrophages and (B) anti-VE-cadherin, anti-ICAM-1, and anti-VCAM-1 antibodies to detect stromal and endothelial cell subsets. Data are representative of three individual mice per group.

An additional difference was observed when splenic white pulp stromal cell populations of wild-type mice were compared with LT{alpha}–/– mice. When staining for VE-cadherin, VCAM-1, and ICAM-1, VE-cadherin-negative stromal cell populations could be analyzed. VCAM-1+ICAM-1lo cells were located directly around the central arteriole. At the periphery of this white pulp area, VCAM-1+ICAM-1+ cells could be seen (Supplemental Fig. 4). When wild-type and LT{alpha}–/– spleens were compared, these cellular subsets could be distinguished at Day 2, but the increase in VCAM-1+ICAM-1+ at the periphery of the white pulp area seen at Days 4 and 6 in wild-type was not observed in LT{alpha}–/– mice (Fig. 6B) . These results indicate a LT{alpha}1β2+-mediated increase of VCAM-1+ICAM-1+ at the location where the marginal zone will develop and is in agreement with earlier observations that LT{alpha}1β2/LTβR interactions are mandatory for homeostasis and proper functioning of marginal zones in adult spleens [16 36 37 38 39 ].


arrow
DISCUSSION
 
The potential role of LTi cells in white pulp ontogeny has been a matter of debate, as these cells express the ligand for the LTβR in developing LN, and signaling through this receptor is indispensable for normal white pulp development [37 40 ]. Although it has been shown that triggering of the LTβR by LT{alpha}1β2-expressing B cells is crucial for white pulp development, the possibility remained that triggering of the LTβR by other cells, such as activated T cells or LTi cells, further facilitated this process. Here, we show for the first time that the majority of splenic LTi cells lacks cell surface expression of the LTβR ligand. It has been shown that fetal and neonatal splenic LTi cells express the LT{alpha} and LTβ transcripts [9 41 ]. The adult spleen environment, but not the fetal, has also been proposed to regulate the LTβ transcript expression in LTi cells by TL1A [41 ]. Our results suggest that the neonatal, splenic environment does not lead to cell surface expression of LTβR ligands on LTi cells. An in vitro, dose-dependent IL-7 stimulation is required for an effective LTβR ligand expression by intestinal LTi cells [10 ]. We previously detected Il-7 transcript expression by fetal spleen nonhematopoietic cells [42 ]. At Day 4 after birth, the time-point that T cell areas start to emerge, a ligand for the LTβR, most likely LT{alpha}1β2, is only expressed by B cells. Thus, for white pulp development, B cells will give the LT{alpha}1β2-dependent, inductive signal, similar as LTi cells do during LN and PP formation, and this is in accordance with earlier observations [14 ]. This signal is required to attract more B and T cells to the developing white pulp. In contrast to the white pulp development into functional T and B cell areas, the separation of white and red pulp areas occurs before birth and is independent of LT{alpha}-expressing cells

In E15.5 fetal spleen, patches of LTi cells are found throughout the spleen with a distribution reminiscent of white pulp areas of adult spleen. Although our results indicate that LTi cells do not directly contribute to white pulp development, the localization of these cells, their close association with blood vessels, and their probable interaction with VCAM-1+ICAM-1–/lo stromal cells at E18.5 are intriguing but might just be a reflection of the chemokines and adhesion molecules that are locally expressed.

The Cxcl12 and Cxcl13 transcripts were similarly expressed within the "stromal" and "endothelial" stromal cell subset. On the contrary, the CD34+ICAM+ endothelial stromal cell subset expressed higher levels of Ccl19 and Ccl21b transcripts than the stromal subset. Assuming that these relative transcript expressions are revealing the protein expression levels, we propose that the perivascular distribution of LTi cells could be mediated by the high expression of CCL19 and CCL21 chemokines from the endothelial cells. Indeed, the lower expression of CCL19 and CCL21 by the stromal cells would establish CCL19 and CCL21 concentration gradients, decreasing from the vascular endothelial cells to the inner part of the fetal spleen. The CXCL12 and CXCL13 chemokine expressions by the splenic stroma probably also participate in the attraction and retention of LTi cells into the fetal spleen. Early expression of CXCL13, before the entry of B cells, has been observed around arterioles in developing human spleen [27 ]. Thus, expression of these homeostatic chemokines most likely contributes to the periarteriolar localization of LTi cells in the fetal spleen.

Our graft experiments show LTi and B cells colocalizing into well-defined areas within fetal spleen, illustrating the early specific capacities of the spleen stromal cells. In the grafts, all B and LTi cells are donor-derived and have differentiated in situ. Both spleen stromal populations expressed the transcripts for CXCL13 and CXCL12, important for LTi cell interaction and B cell attraction and differentiation [11 43 44 ]. Moreover, we observed a small host-derived CD11c+ DC population in these grafts. It was shown that CD11c+ cells can be found in a neonatal spleen, only a few days after birth [45 46 ]. Hence, DC have migrated into the grafted spleen in response to the chemokines produced.

In our grafts, a typical adult spleen organization was observed when total fetal liver cells were injected previously. The B/T lymphocytes that differentiated from these fetal liver cells were attracted by the fetal spleen graft into their specific domains, reinforcing the capacity of the white pulp anlagen to express chemokines essential for the development of its architecture. It was shown that CCL21 could be expressed by two different genes after an activation of a LT{alpha}1β2-dependent or -independent pathway, whereas the two chemokines conserve the same chemotactic activity [47 ]. Most of CCL21 expression depends on LT{alpha}1β2 in the adult spleen but not in nonlymphoid tissue [47 ]. It is possible that the first chemokine expression found in the fetal spleen at E15.5 is triggered in a similar LTβR-independent manner.

Finally, our data show that the fetal spleen stroma are instructed at an early time-point to segregate lymphoid and nonlymphoid zones, which correlate with red and white pulp areas of the adult organ. The graft experiments and the low numbers of B or LTi cells in the fetal spleen that express the LTβR suggest that these first driving events are LTβR-independent.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by fellowships from Ministère Français de la Recherche et de l’Enseignement Supérieur, from Association pour la recherche sur le cancer (ARC), from ANR, and from the European Stem Cell Research Program to G. E. D., a Vici grant from the Netherlands Organization for Scientific Research (918.56.612) to R. E. M., and a genomics grant from the Netherlands Organization for Scientific Research (050-10-120) to M. F. R. V. The authors declare that there is no conflict of financial interest. We acknowledge A. Louise for cell sorting and the Flow Cytometry Core Facility (Institut Pasteur, France) as well as E. Perret for her advice and the Dynamic Imagery Core Facility (Institut Pasteur).


arrow
FOOTNOTES
 
1 These authors contributed equally to this work. Back

Received September 28, 2007; revised March 13, 2008; accepted March 13, 2008.


arrow
REFERENCES
 
    1
  1. Veerman, A. J., van Ewijk, W. (1975) White pulp compartments in the spleen of rats and mice. A light and electron microscopic study of lymphoid and non-lymphoid cell types in T- and B-areas Cell Tissue Res. 156,417-441[Medline]
    2. 2
  2. Sasou, S., Satodate, R., Katsura, S. (1976) The marginal sinus in the perifollicular region of the rat spleen Cell Tissue Res. 172,195-203[Medline]
    3. 3
  3. Kupiec-Weglinski, J. W., Austyn, J. M., Morris, P. J. (1988) Migration patterns of dendritic cells in the mouse. Traffic from the blood, and T cell-dependent and -independent entry to lymphoid tissues J. Exp. Med. 167,632-645[Abstract/Free Full Text]
    4. 4
  4. Schmidt, E. E., MacDonald, I. C., Groom, A. C. (1993) Comparative aspects of splenic microcirculatory pathways in mammals: the region bordering the white pulp Scanning Microsc. 7,613-628[Medline]
    5. 5
  5. Mebius, R. E., Kraal, G. (2005) Structure and function of the spleen Nat. Rev. Immunol. 5,606-616[CrossRef][Medline]
    6. 6
  6. De Togni, P., Goellner, J., Ruddle, N. H., Streeter, P. R., Fick, A., Mariathasan, S., Smith, S. C., Carlson, R., Shornick, L. P., Strauss-Schoenberger, J., et al (1994) Abnormal development of peripheral lymphoid organs in mice deficient in lymphotoxin Science 264,703-707[Abstract/Free Full Text]
    7. 7
  7. Korner, H., Cook, M., Riminton, D. S., Lemckert, F. A., Hoek, R. M., Ledermann, B., Kontgen, F., Fazekas de St Groth, B., Sedgwick, J. D. (1997) Distinct roles for lymphotoxin-{alpha} and tumor necrosis factor in organogenesis and spatial organization of lymphoid tissue Eur. J. Immunol. 27,2600-2609[Medline]
    8. 8
  8. Mebius, R. E., Rennert, P., Weissman, I. L. (1997) Developing lymph nodes collect CD4+CD3- LTb+ cells that can differentiate to APC, NK cells, and follicular cells but not T or B cells Immunity 7,493-504[CrossRef][Medline]
    9. 9
  9. Yoshida, H., Honda, K., Shinkura, R., Adachi, S., Nishikawa, S., Maki, K., Ikuta, K., Nishikawa, S. I. (1999) IL-7 receptor {alpha}+ CD3(–) cells in the embryonic intestine induces the organizing center of Peyer’s patches Int. Immunol. 11,643-655[Abstract/Free Full Text]
    10. 10
  10. Honda, K., Nakano, H., Yoshida, H., Nishikawa, S., Rennert, P., Ikuta, K., Tamechika, M., Yamaguchi, K., Fukumoto, T., Chiba, T., Nishikawa, S. I. (2001) Molecular basis for hematopoietic/mesenchymal interaction during initiation of Peyer’s patch organogenesis J. Exp. Med. 193,621-630[Abstract/Free Full Text]
    11. 11
  11. Finke, D., Acha-Orbea, H., Mattis, A., Lipp, M., Kraehenbuhl, J. (2002) CD4+CD3– cells induce Peyer’s patch development: role of {alpha}4β1 integrin activation by CXCR5 Immunity 17,363-373[CrossRef][Medline]
    12. 12
  12. Luther, S. A., Ansel, K. M., Cyster, J. G. (2003) Overlapping roles of CXCL13, interleukin 7 receptor {alpha}, and CCR7 ligands in lymph node development J. Exp. Med. 197,1191-1198[Abstract/Free Full Text]
    13. 13
  13. Mebius, R. E. (2003) Organogenesis of lymphoid tissues Nat. Rev. Immunol. 3,292-303[CrossRef][Medline]
    14. 14
  14. Ngo, V. N., Cornall, R. J., Cyster, J. G. (2001) Splenic T zone development is B cell dependent J. Exp. Med. 194,1649-1660[Abstract/Free Full Text]
    15. 15
  15. Desanti, G. E., Bertrand, J. Y., Golub, R. (2007) Fetal spleen development, the ride toward multiple functions Functional Development and Embryology 1,78-90
    16. 16
  16. Kim, M. Y., McConnell, F. M., Gaspal, F. M., White, A., Glanville, S. H., Bekiaris, V., Walker, L. S., Caamano, J., Jenkinson, E., Anderson, G., Lane, P. J. (2007) Function of CD4+CD3– cells in relation to B- and T-zone stroma in spleen Blood 109,1602-1610[Abstract/Free Full Text]
    17. 17
  17. Colucci, F., Turner, M., Schweighoffer, E., Guy-Grand, D., Di Bartolo, V., Salcedo, M., Tybulewicz, V. L., Di Santo, J. P. (1999) Redundant role of the Syk protein tyrosine kinase in mouse NK cell differentiation J. Immunol. 163,1769-1774[Abstract/Free Full Text]
    18. 18
  18. Wilde, D. B., Marrack, P., Kappler, J., Dialynas, D. P., Fitch, F. W. (1983) Evidence implicating L3T4 in class II MHC antigen reactivity; monoclonal antibody GK1.5 (anti-L3T4a) blocks class II MHC antigen-specific proliferation, release of lymphokines, and binding by cloned murine helper T lymphocyte lines J. Immunol. 131,2178-2183[Abstract]
    19. 19
  19. Dialynas, D. P., Wilde, D. B., Marrack, P., Pierres, A., Wall, K. A., Havran, W., Otten, G., Loken, M. R., Pierres, M., Kappler, J., et al (1983) Characterization of the murine antigenic determinant, designated L3T4a, recognized by monoclonal antibody GK1.5: expression of L3T4a by functional T cell clones appears to correlate primarily with class II MHC antigen-reactivity Immunol. Rev. 74,29-56[CrossRef][Medline]
    20. 20
  20. Streeter, P. R., Berg, E. L., Rouse, B. T., Bargatze, R. F., Butcher, E. C. (1988) A tissue-specific endothelial cell molecule involved in lymphocyte homing Nature 331,41-46[CrossRef][Medline]
    21. 21
  21. Coffman, R. L., Weissman, I. L. (1981) B220: a B cell-specific member of the T200 glycoprotein family Nature 289,681-683[CrossRef][Medline]
    22. 22
  22. Coffman, R. L., Weissman, I. L. (1981) A monoclonal antibody that recognizes B cells and B cell precursors in mice J. Exp. Med. 153,269-279[Abstract/Free Full Text]
    23. 23
  23. Takei, F. (1985) Inhibition of mixed lymphocyte response by a rat monoclonal antibody to a novel murine lymphocyte activation antigen (MALA-2) J. Immunol. 134,1403-1407[Abstract]
    24. 24
  24. Prieto, J., Takei, F., Gendelman, R., Christenson, B., Biberfeld, P., Patarroyo, M. (1989) MALA-2, mouse homologue of human adhesion molecule ICAM-1 (CD54) Eur. J. Immunol. 19,1551-1557[Medline]
    25. 25
  25. Kraal, G., Rep, M., Janse, M. (1987) Macrophages in T and B cell compartments and other tissue macrophages recognized by monoclonal antibody MOMA-2. An immunohistochemical study Scand. J. Immunol. 26,653-661[CrossRef][Medline]
    26. 26
  26. Cupedo, T., Lund, F. E., Ngo, V. N., Randall, T. D., Jansen, W., Greuter, M. J., de Waal-Malefyt, R., Kraal, G., Cyster, J. G., Mebius, R. E. (2004) Initiation of cellular organization in lymph nodes is regulated by non-B cell-derived signals and is not dependent on CXC chemokine ligand 13 J. Immunol. 173,4889-4896[Abstract/Free Full Text]
    27. 27
  27. Steiniger, B., Ulfig, N., Risse, M., Barth, P. J. (2007) Fetal and early post-natal development of the human spleen: from primordial arterial B cell lobules to a non-segmented organ Histochem. Cell Biol. 128,205-215[CrossRef][Medline]
    28. 28
  28. Dumont, D. J., Yamaguchi, T. P., Conlon, R. A., Rossant, J., Breitman, M. L. (1992) tek, a novel tyrosine kinase gene located on mouse chromosome 4, is expressed in endothelial cells and their presumptive precursors Oncogene 7,1471-1480[Medline]
    29. 29
  29. Cupedo, T., Vondenhoff, M. F., Heeregrave, E. J., De Weerd, A. E., Jansen, W., Jackson, D. G., Kraal, G., Mebius, R. E. (2004) Presumptive lymph node organizers are differentially represented in developing mesenteric and peripheral nodes J. Immunol. 173,2968-2975[Abstract/Free Full Text]
    30. 30
  30. Mebius, R. E., Schadee-Eestermans, I. L., Weissman, I. L. (1998) MAdCAM-1 dependent colonization of developing lymph nodes involves a unique subset of CD4+CD3– hematolymphoid cells Cell Adhes. Commun. 6,97-103[Medline]
    31. 31
  31. Breier, G., Breviario, F., Caveda, L., Berthier, R., Schnurch, H., Gotsch, U., Vestweber, D., Risau, W., Dejana, E. (1996) Molecular cloning and expression of murine vascular endothelial-cadherin in early stage development of cardiovascular system Blood 87,630-641[Abstract/Free Full Text]
    32. 32
  32. Eberl, G., Marmon, S., Sunshine, M. J., Rennert, P. D., Choi, Y., Littman, D. R. (2004) An essential function for the nuclear receptor ROR{gamma}(t) in the generation of fetal lymphoid tissue inducer cells Nat. Immunol. 5,64-73[CrossRef][Medline]
    33. 33
  33. Hallmann, R., Mayer, D. N., Berg, E. L., Broermann, R., Butcher, E. C. (1995) Novel mouse endothelial cell surface marker is suppressed during differentiation of the blood brain barrier Dev. Dyn. 202,325-332[Medline]
    34. 34
  34. Fu, Y. X., Chaplin, D. D. (1999) Development and maturation of secondary lymphoid tissues Annu. Rev. Immunol. 17,399-433[CrossRef][Medline]
    35. 35
  35. Yu, P., Wang, Y., Chin, R. K., Martinez-Pomares, L., Gordon, S., Kosco-Vibois, M. H., Cyster, J., Fu, Y. X. (2002) B cells control the migration of a subset of dendritic cells into B cell follicles via CXC chemokine ligand 13 in a lymphotoxin-dependent fashion J. Immunol. 168,5117-5123[Abstract/Free Full Text]
    36. 36
  36. Tumanov, A., Kuprash, D., Lagarkova, M., Grivennikov, S., Abe, K., Shakhov, A., Drutskaya, L., Stewart, C., Chervonsky, A., Nedospasov, S. (2002) Distinct role of surface lymphotoxin expressed by B cells in the organization of secondary lymphoid tissues Immunity 17,239-250[CrossRef][Medline]
    37. 37
  37. Futterer, A., Mink, K., Luz, A., Kosco-Vilbois, M. H., Pfeffer, K. (1998) The lymphotoxin β receptor controls organogenesis and affinity maturation in peripheral lymphoid tissues Immunity 9,59-70[CrossRef][Medline]
    38. 38
  38. Ettinger, R., Browning, J. L., Michie, S. A., van Ewijk, W., McDevitt, H. O. (1996) Disrupted splenic architecture, but normal lymph node development in mice expressing a soluble lymphotoxin-β receptor-IgG1 fusion protein Proc. Natl. Acad. Sci. USA 93,13102-13107[Abstract/Free Full Text]
    39. 39
  39. Mackay, F., Majeau, G. R., Lawton, P., Hochman, P. S., Browning, J. L. (1997) Lymphotoxin but not tumor necrosis factor functions to maintain splenic architecture and humoral responsiveness in adult mice Eur. J. Immunol. 27,2033-2042[Medline]
    40. 40
  40. Kuprash, D. V., Alimzhanov, M. B., Tumanov, A. V., Grivennikov, S. I., Shakhov, A. N., Drutskaya, L. N., Marino, M. W., Turetskaya, R. L., Anderson, A. O., Rajewsky, K., Pfeffer, K., Nedospasov, S. A. (2002) Redundancy in tumor necrosis factor (TNF) and lymphotoxin (LT) signaling in vivo: mice with inactivation of the entire TNF/LT locus versus single-knockout mice Mol. Cell. Biol. 22,8626-8634[Abstract/Free Full Text]
    41. 41
  41. Kim, M. Y., Toellner, K. M., White, A., McConnell, F. M., Gaspal, F. M., Parnell, S. M., Jenkinson, E., Anderson, G., Lane, P. J. (2006) Neonatal and adult CD4+ CD3– cells share similar gene expression profile, and neonatal cells up-regulate OX40 ligand in response to TL1A (TNFSF15) J. Immunol. 177,3074-3081[Abstract/Free Full Text]
    42. 42
  42. Bertrand, J. Y., Desanti, G. E., Lo-Man, R., Leclerc, C., Cumano, A., Golub, R. (2006) Fetal spleen stroma drives macrophage commitment Development 133,3619-3628[Abstract/Free Full Text]
    43. 43
  43. Gunn, M. D., Ngo, V. N., Ansel, K. M., Ekland, E. H., Cyster, J. G., Williams, L. T. (1998) A B-cell-homing chemokine made in lymphoid follicles activates Burkitt’s lymphoma receptor-1 Nature 391,799-803[CrossRef][Medline]
    44. 44
  44. Tokoyoda, K., Egawa, T., Sugiyama, T., Choi, B. I., Nagasawa, T. (2004) Cellular niches controlling B lymphocyte behavior within bone marrow during development Immunity 20,707-718[CrossRef][Medline]
    45. 45
  45. Sun, C. M., Fiette, L., Tanguy, M., Leclerc, C., Lo-Man, R. (2003) Ontogeny and innate properties of neonatal dendritic cells Blood 102,585-591[Abstract/Free Full Text]
    46. 46
  46. Dakic, A., Shao, Q. X., D'Amico, A., O'Keeffe, M., Chen, W. F., Shortman, K., Wu, L. (2004) Development of the dendritic cell system during mouse ontogeny J. Immunol. 172,1018-1027[Abstract/Free Full Text]
    47. 47
  47. Lo, J. C., Chin, R. K., Lee, Y., Kang, H. S., Wang, Y., Weinstock, J. V., Banks, T., Ware, C. F., Franzoso, G., Fu, Y. X. (2003) Differential regulation of CCL21 in lymphoid/nonlymphoid tissues for effectively attracting T cells to peripheral tissues J. Clin. Invest. 112,1495-1505[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow HTML Page - index.htslp
Right arrow All Versions of this Article:
jlb.0907659v1
84/1/152    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vondenhoff, M. F. R.
Right arrow Articles by Golub, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vondenhoff, M. F. R.
Right arrow Articles by Golub, R.