Published online before print February 8, 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
–/– mice stimulated with interleukin-12 are deficient in production of interferon-
,1
* Department of Pharmacology and Experimental Therapeutics, Boston University School of Medicine, Boston, Massachusetts; USA; and
Department of Inflammation, Wyeth Research, Cambridge, Massachusetts, USA
1Correspondence: Wyeth Research, 200 Cambridge Park Dr., Cambridge, MA 02140, USA. E-mail: mkasaian{at}wyeth.com
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
(PKC) is expressed in NK cells, but its functional role has not been defined. Here, we demonstrate involvement of PKC in IL-12-induced NK cell IFN-
production. NK cells from PKC–/– mice produced less IFN- in response to IL-12 than those from wild-type (WT) mice. IL-12-induced NK cell cytotoxicity was unaffected, and NK cells from PKC–/– mice did not display reduced IFN- production in response to IL-18, indicating a specific role for PKC in IL-12-induced IFN- production. Under the conditions tested, T cells did not produce IFN- in response to IL-12 or affect the ability of NK cells to produce the cytokine. PKC deficiency did not affect NK cell numbers, granularity, viability, or cytotoxic activity in response to polyinosinic:polycytydylic acid. NK cells from PKC–/– mice exhibited normal expression of IL-12Rβ1 and STAT4 proteins and normal induction of STAT4 phosphorylation in response to IL-12. Phosphorylation of threonine 538 within the catalytic domain of PKC was detectable in NK cells from WT mice but was not enhanced by IL-12. Transcription of IFN- increased similarly in NK cells from WT and PKC–/– mice in response to IL-12, and there was no difference in IFN- mRNA stability. Taken together, these findings indicate a role for PKC in the post-transcriptional regulation of IL-12-induced IFN- production.
Key Words: cytokines • kinases
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
is a novel class PKC, similar to PKC
, -
, and -
. PKC was first described in T cells, where it forms an essential component of the TCR signaling complex. PKC-deficient mice have helped to define the requirement for this enzyme in T cell activation through the TCR [3
]. Upon activation, PKC is recruited to the immunological synapse and ultimately contributes to the expression of immediate-early genes through activation of transcription factors such as AP-1 [3
] and NFAT [4
]. In animal models, PKC is critical for development of Th2-driven immune responses, such as pulmonary inflammation and airway hyper-responsiveness, triggered by immunization and lung challenge with OVA [2
, 5
]. PKC has also been shown to be important for the control of Th1 cells in experimental autoimmune encephalomyelitis [2
, 6
] and has been shown to regulate a mouse model of collagen-induced arthritis [7
].
In addition to T cells, PKC can be important in other cell types. For example, PKC-deficient mice are protected from fat-induced insulin resistance [8
], supporting observations that transcription of PKC is increased in the skeletal muscle of patients with Type 2 diabetes mellitus and may be inversely correlated with insulin sensitivity [9
]. The role of PKC in skeletal muscle remains controvertial, however, as a more chronic mouse model suggests that PKC-deficient mice expend less energy and accumulate more body weight and fat content over time, leading to increased insulin resistance [10
, 11
]. A role for PKC has also been found in mouse bone marrow-derived mast cells and the rat basophilic leukemia line RBL-2H3, where PKC is phosphorylated and translocates to the nucleus upon activation through the high-affinity IgE receptor, FcRI [12
]. More recently, phosphorylation of the PKC activation loop threonine 538 (T538) was shown to be induced by IL-1 in human mast cells [13
]. NK cells also express PKC [14
, 15
], but its role in these cells has not yet been identified.
NK cells represent an important component of the innate immune response [16
]. In addition to cytolytic activity, they are critical producers of IFN- in response to cytokines, including IL-12, IL-18, and Type I IFNs (IFN-
/β), produced by activated dendritic cells. IFN- is a key mediator of innate immune function [17
], and mice deficient in IFN- or its receptor have an increased susceptibility to a number of inflammatory pathogens [18
, 19
]. NK cell IFN- production plays a key role in immune responses to viruses [20
, 21
], bacteria [22
, 23
], and parasites [24
, 25
]. In addition, NK cell-derived, early IFN- may be essential to drive a Th1-specific, adaptive immune response [26
]. Uncovering the signaling pathways that contribute to NK cell activation is of key importance for understanding the innate immune function of NK cells.
Using NK cells from PKC–/– mice, we investigated the contribution of PKC to NK cell effector responses. Our experiments provide evidence for a novel, functional role for PKC in NK cell cytokine production.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
–/– mice, generated as described [3
], were bred at Taconic (Germantown, NY, USA). Mice were backcrossed to C57BL/6 for 10 generations. Male mice were used in all experiments. Age- and sex-matched C57BL/6 mice (Taconic) were used as wild-type (WT) controls. The Institutional Animal Care and Use Committee at Wyeth Research (Cambridge, MA, USA) approved animal protocols.
NK cell enrichment
Spleens were harvested and pooled from two or more animals for each experiment. RBCs were lysed with 0.84% ammonium chloride, and the remaining cells were plated at 5 x 106/ml in complete RPMI media that included 10% FBS, 55 µM 2-ME, 100 U/ml penicillin, 0.1 mg/ml streptomycin, and 2 mM L-glutamine. To promote NK cell survival and expansion, 10 ng/ml recombinant human (rh)IL-15 (R&D Systems, Minneapolis, MN, USA) or 50 ng/ml recombinant mouse (rm)IL-2 (R&D Systems) was added to cultures on Days 0 and 5. Cells were maintained in culture for 7–10 days. The percentages of NK and T cells were measured by flow cytometry (FACScan, BD Biosciences, San Jose, CA, USA) at the beginning and end of each culture period. NK and T cells were identified as NK1.1+/CD3– and NK1.1–/CD3+, respectively. PE-labeled, anti-mouse NK1.1 and FITC-labeled, anti-mouse CD3 were obtained from BD Biosciences. NK cell morphology following cytokine enrichment was assessed by light microscopy of Giemsa-stained cytospins.
Negative selection of NK and T cell populations
NK cells or T cells were further enriched by negative selection using the MACS NK cell isolation kit (Miltenyi Biotec, Auburn, CA, USA) or the EasySep mouse T cell isolation kit (StemCell Technologies, Vancouver, BC, Canada), according to the manufacturers’ instructions. For enrichment of NK cells from freshly isolated splenocytes, two rounds of negative selection were performed. Following enrichment, flow cytometry was performed to estimate percentages of NK cells or T cells.
Detection of cytokine-induced IFN- protein
Following enrichment, NK cells were resuspended in complete media plus 10 ng/ml rhIL-15 or 50 ng/ml IL-2, plated in 96-well plates at 5 x 104 cells per well and treated for 24 h with various doses of rmIL-12 (BioSource International, Camarillo, CA, USA) or rmIL-18 (MBL Medical and Biological Laboratories, Nagoya, Japan). Supernatants were collected after 24 h, and mouse IFN- was detected using a Quantikine (R&D Systems) or Cytoset (BioSource International) ELISA kit. The minimum detectable dose for each assay was 
50 pg/ml.
For intracellular cytokine staining, cells were incubated with brefeldin A (Golgi Plug reagent, BD Biosciences) for 4 h, stained with FITC-labeled anti-NK1.1 or biotin-labeled anti-CD3 plus CyChrome-labeled streptavidin (BD Biosciences) to distinguish NK and T cells, permeabilized in Cytofix/Cytoperm reagent (BD Biosciences), and stained with PE-labeled antibody to mouse IFN- (BD Biosciences). Intracellular IFN- was analyzed in gated NK1.1+/CD3– or NK1.1–/CD3+ cells using three-color flow cytometry.
Cell viability and apoptosis assays
A colorimetric assay for the quantitation of live cells was performed, according to the manufacturer’s instructions, using the WST-1 cell proliferation reagent (Roche Molecular Biochemicals, Mannheim, Germany). Apoptosis was measured using the flow cytometry-based Vybrant Apoptosis Assay Kit #2 (Molecular Probes, Eugene, OR, USA). Briefly, apoptotic cells were identified by the ability of Annexin V to bind exposed phosphatidylserine on their surface. Dead cells were differentiated by staining with propidium iodide (PI).
51Chromium (51Cr) release assay
Splenocytes cultured in vitro with 10 ng/ml rmIL-12 for 24 h or with 10 ng/ml rhIL-15 for 1 week were used as effector cells in a 51Cr release assay. Alternatively, 200 µl 1 mg/ml polyinosinic:polycytydylic acid [poly(I:C); Sigma Chemical Co., St. Louis, MO, USA] in PBS or PBS control was injected into mice i.p. to activate NK cells in vivo. Spleens were collected 48 h later, and isolated splenocytes were used as a source of effector cells. YAC-1 cell targets (American Type Culture Collections, Manassas, VA, USA) were labeled by incubating for 1 h at 37°C with 0.1 mCi 51Cr (NEN-Perkin Elmer, Waltham, MA, USA). Target cells were plated in a round-bottom, 96-well plate at 1 x 104 cells per well and incubated with various amounts of effector cells at 37°C, 5% CO2, for 5 h. 51Cr released by lysed cells into supernatants was harvested using a Skatron harvester (Molecular Devices, Sunnyvale, CA, USA) and measured using a Wallac Wizard 3/1480 automatic -counter (NEN-Perkin Elmer). Spontaneous lysis was determined from target cells alone and total lysis from target cells lysed with 0.1% Triton X-100. Percent specific lysis was calculated as [(experimental–spontaneous)/(total–spontaneous)] x 100.
SDS-PAGE and Western analysis
Lysates were generated by adding 100 µl per 4 x 106 cells ice cold, modified radioimmunoprecipitation assay, plus protease inhibitors (Complete/EDTA-free, Roche Applied Science, Indianapolis, IN, USA) and phosphatase inhibitors (Cocktails I and II, EMD Biosciences/Calbiochem, San Diego, CA, USA) to cells. Lysates were boiled, reduced with β-ME, and separated by SDS-PAGE using 4–20% Tris-glycine gels (Invitrogen, Carlsbad, CA, USA). Proteins were blotted to nitrocellulose membranes. Blots were blocked with 3% BSA and washed with PBS/0.1% Tween. In successive rounds of staining, proteins were detected using the following antibodies in 3% BSA: rat anti-mouse phospho-PKC-T538 (Cell Signaling Technology, Beverly, MA, USA), rat anti-mouse phospho-STAT4 (Zymed Laboratories, South San Francisco, CA, USA), rat anti-mouse PKC (C18, Santa Cruz Biotechnologies, Santa Cruz, CA, USA), rat anti-mouse STAT4 (Zymed Laboratories), and goat anti-mouse actin (Santa Cruz Biotechnologies). Primary antibodies were detected with HRP-labeled donkey anti-rat or donkey anti-goat secondary antibodies (Jackson ImmunoResearch, West Grove, PA, USA) in 5% milk. After incubation with the ECL Western blotting detection reagent (Amersham Biosciences, Piscataway, NJ, USA), blots were exposed to film and analyzed for the presence of appropriate-sized bands.
Quantitative RT-PCR (qRT-PCR)
Following a 4 h treatment of purified NK cells with rmIL-12 or PBS control in the presence of serum, RNA was prepared using the RNeasy mini kit with QiaShredder columns (Qiagen, Valencia, CA, USA). Genomic DNA was removed by treatment with DNase (Qiagen). The concentration of total RNA in each sample was determined by absorbance at 260 nm.
Oligonucleotides were designed to mouse β-actin and IFN- using Primer Express software (Applied Biosystems Division of Perkin Elmer Corp., Foster City, CA, USA) and synthesized by Eurogentec (San Diego, CA, USA). Forward and reverse primer sequences used were as follows: β-actin 5' ACGGCCAGTCATCACTATTG and 5' CAAGAAGGAAGGCTGGAAAAGA; IFN- 5' ACAATGAACGCTACACACTGCAT and 5' TGGCAGTAACAGCCAGAAACA. Overlapping probes labeled on the 5' end with the reporter dye 6-carboxyfluorescein and on the 3' end with the quencher dye 6-carboxy-tetramethylrhodamine were also designed for each gene as follows: β-actin 5' CAACGAGCGGTTCCGATGCCC; IFN- 5' TTGGCTTTGCAGCTCTTCCTCATGG. Reactions were set up using a qRT-PCR MasterMix (Eurogentec) and 50 ng template RNA per reaction. Samples were run in duplicate on the Prism 7000 sequence detection system (Applied Biosystems Division of Perkin Elmer Corp.) using the following RT-PCR program: 30 min at 48°C, followed by 10 min at 95°C, followed by 50 cycles of 95°C for 15 s and 1 min at 60°C. Data were analyzed using Prism 7000 software. Each result was fit to a standard curve generated from a positive control source of RNA, and expression values were normalized to β-actin.
Measurement of mRNA stability
To halt transcription, 5 µg/ml actinomycin D (Sigma Chemical Co.) was added to cell cultures. Cell lysates were made and processed for total RNA at 0, 30, and 90 min following actinomycin D treatment. The amount of IFN- RNA remaining in each sample was quantified by qRT-PCR analysis.
Statistical analysis
All observations were reproduced in at least three separate experiments. Data between treatment groups were compared using Student’s t-test. P values of <0.05 were considered significant. For comparison of data across multiple experiments, values were converted to percent of the WT response.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
–/– animals exhibit normal NK cell development-deficient animals by examining the number and percentage of NK cells within the spleen, the ability of the NK cells to expand in culture, and their characteristic cell morphology. Spleens isolated from WT and PKC–/– animals contained comparable total cell numbers (data not shown). The percentages of NK and T cells from spleens of WT and PKC–/– mice were similar (Fig. 1A
and 1B
). After 7 days in culture with IL-15, splenocytes from WT and PKC–/– mice showed a comparable degree of NK cell expansion (Fig. 1A
and 1B)
and blastogenesis, assayed as an increase in forward angle light-scatter (Fig. 1C
, upper). Mature NK cell morphology includes the presence of cytoplasmic granules. Side-angle (90°) light-scatter is related to the granularity of the cells and thus, increases with activation. The increase in side-scatter as a result of activation by IL-15 was the same for NK cells from WT and PKC–/– mice (Fig. 1C
, lower). Lastly, comparable cellular morphology typical of activated NK cells, including large size, blue-tinged cytoplasm and numerous cytoplasmic granules, was present in NK cells from WT and PKC–/– mice (Fig. 1D)
.
 View larger version (44K): [in a new window] |
Figure 1. NK cells from PKC–/– mice exhibit normal frequency and phenotype. (A) Analysis of NK cell (NK1.1+/CD3–; boxed insets) and T cell (NK1.1–/CD3+) frequencies among splenocytes from WT and PKC–/– mice on Days 0 and 7 of in vitro expansion with IL-15. KO, Knockout. (B) Percentages of NK1.1+/CD3– cells (upper) and NK1.1–/CD3+ cells (lower) in individual cultures. Each culture was generated from cells pooled from two to three. (C) Forward- or side light-scatter was measured by flow cytometry for splenocytes from WT and PKC–/– mice before (open histograms) and after (filled histograms) 7-day culture with IL-15. Data are representative of multiple experiments. (D) Cytospins were made from IL-15-enriched splenocytes and stained with Wright-Giemsa to visualize cell boundaries, nuclei, and granules.
|
–/– mice produce less IFN- in response to IL-12 in NK cell IFN- production, spleen cells from WT and PKC–/– mice were cultured for 1 week in IL-15, resulting in NK cell expansion from 3% of the population on Day 0 to >60% on Day 7 (Fig. 1A
and 1B)
. The cultures were then stimulated 24 h with IL-12 and supernatants assayed for production of IFN-. NK cells from PKC–/– mice were deficient in production of IFN- in response to IL-12 over the entire IL-12 dose range (Fig. 2A
). At each concentration of IL-12 tested, NK cells from PKC–/– mice produced 40% less IFN- than NK cells from WT mice, as measured by ELISA. To produce the equivalent of a half-maximal amount of IFN- from WT cells, PKC–/– cells required 100-fold higher concentration of IL-12.
 View larger version (23K): [in a new window] |
Figure 2. NK cells from PKC–/– mice have reduced IFN- production in response to IL-12 but not in response to IL-18. (A) Splenocytes pooled from WT (•) or PKC–/– ( ) mice were cultured for 1 week in IL-15 and then stimulated overnight with IL-12. IFN- production was assayed by ELISA. (B) Splenocytes pooled from WT (•) or PKC–/– () mice were cultured for 1 week in IL-2 and then stimulated overnight with IL-12. (C) Relative IFN- production responses at the 10 ng/ml dose of IL-12 are compared for cells from WT and PKC–/– mice, expanded with IL-15 or IL-2. **, P < 0.001, for responses over the entire IL-12 dose range, determined by paired Student’s t-test; *, P < 0.05, for responses over the entire IL-12 dose range, determined by paired Student’s t-test. (D) Intracellular IFN- was measured by staining permeabilized cells with PE-labeled antibody to IFN-, following 4 h incubation with 10 ng/ml IL-12 in the presence of brefeldin. WT or PKC–/– NK cells were gated as FITC anti-NK1.1+/CyChrome anti-CD3–, and T cells were gated as FITC anti-NK1.1–/CyChrome anti-CD3+. Data were compared with isotype control. (E) Intracellular cytokine staining for IFN- [mean fluorescence intensity (MFI)] was compared across three experiments. *, P < 0.05, by Student’s t-test. (F) Splenocytes pooled from WT (•) or PKC–/– () mice were cultured for 1 week in IL-15 and then stimulated overnight with IL-18. IFN- production was assayed by ELISA.
|
downstream of IL-12 or IL-15. To help differentiate between these two possibilities, IL-2 was substituted for IL-15 in the expansion protocol. After 1 week of exposure to IL-2, the percentage of NK cells ranged from 43% to 53% in splenocyte cultures from WT and PKC–/– mice (data not shown). A reduction in IL-12-induced IFN- production was still observed in IL-2-expanded cells from PKC–/– mice (Fig. 2B)
. In response to 10 ng/ml IL-12, IFN- production was 39% lower in NK cell cultures from PKC–/– mice in comparison with the NK cells from WT mice, following expansion with IL-15 or IL-2 (Fig. 2C)
.
To confirm these results, cells were permeabilized, treated with brefeldin A, stained with a PE-labeled antibody to mIFN-, and analyzed for intracellular cytokine production by flow cytometry. Although the NK-enriched spleen cell cultures included 20–30% T cells (NK1.1–/CD3+) on Day 7 of IL-15 treatment (Fig. 1A)
, the staining indicated that only the NK cells (NK1.1+/CD3–) contained intracellular IFN- after overnight treatment with IL-12 (Fig. 2D)
. The MFIs taken from multiple experiments confirmed that NK cells from PKC–/– mice had on average 43% less IFN- staining intensity than those from WT mice (Fig. 2E)
, in agreement with the findings of decreased IFN- secretion by NK cells deficient in PKC (Fig. 2C)
.
To determine if PKC might be involved in other pathways stimulating IFN- production, IL-15-enriched NK cells from WT and PKC–/– spleens were stimulated overnight with IL-18. The amount of IFN- produced by IL-18-treated WT cells (Fig. 2F)
was similar to the response generated with IL-12 (Fig. 2A)
. In contrast to IL-12 stimulation, however, there was no difference in IFN- production in response to IL-18 between cells from WT or PKC–/– mice (Fig. 2F)
. These results suggest a specific role for PKC in IFN- production downstream of IL-12 but not IL-18.
PKC is not involved in the regulation of NK cell killing
Killing of specific YAC-1 target cells was measured using a standard 51Cr release assay, using NK effector cells from WT and PKC–/– mice. NK cells were activated through in vitro exposure to IL-15 for 7 days (Fig. 3A
), in vitro exposure to IL-12 for 24 h (Fig. 3B)
, or in vivo i.p. administration of poly(I:C) (Fig. 3C)
. Regardless of the method of NK cell activation, the absence of PKC had no effect on the cytotoxic response to YAC-1 targets, thus indicating that PKC is not required for NK cytotoxic activity. Furthermore, the demonstration that IL-12-induced cytotoxicity was not affected by the absence of PKC (Fig. 3B)
indicates that PKC is not required for all NK cell responses to IL-12.
 View larger version (12K): [in a new window] |
Figure 3. NK cytotoxicity is not impaired in PKC–/– mice. NK cells from spleens of WT (filled symbols) or PKC–/– (open symbols) mice were activated with: (A) IL-15 (10 ng/ml) for 7 days in vitro; (B) IL-12 (10 ng/ml; •, ) or media control ( ,  ) for 24 h in vitro; (C) poly(I:C) (•, ) or PBS (, ), administered i.p., in vivo. NK cell lysis of specific YAC-1 target cells was measured by 51Cr release assay.
|
in NK cells, but not T cells, in the IFN- response to IL-12 is functionally important in T cells [3
, 4
] and as the splenocyte cultures contained NK1.1–/CD3+ cells at the time of IL-12 treatment (Fig. 1A
and 1B)
, it was important to rule out a T cell contribution to IL-12-induced IFN- production in this model. No TCR-activating agent was present in these cultures, and TCR stimulation is required for T cells to respond to cytokines such as IL-12 [27
]. Futhermore, intracellular cytokine staining did not detect IFN- in CD3+/NK1.1– cells (Fig. 2D)
, making it unlikely that T cells were contributing to the total IFN- production. To further support this conclusion, IL-15-expanded NK cells were enriched by negative selection to a purity of greater than 98% (Fig. 4A
, right), before treating them overnight with IL-12. Compared with those from WT mice, purified NK cells from PKC–/– mice generated 40% less IFN- in response to IL-12 (Fig. 4B)
, similar in magnitude to the 38% difference seen in the unfractionated cultures (Fig. 4C)
. Thus, we conclude that the reduction in IL-12-induced IFN- production seen with NK cells from PKC–/– mice in this model was independent of T cell activation.
 View larger version (29K): [in a new window] |
Figure 4. Reduced IL-12-induced IFN- production is a property of NK cells and not T cells from PKC–/– mice. (A) Percentages of NK cells (NK1.1+/CD3–) and T cells (NK1.1–/CD3+) in cultures enriched by 7-day expansion in IL-15 (left) or further purified by negative selection (right). (B) NK cells purified by negative selection were treated for 24 h with IL-12, and secreted IFN- was measured by ELISA. (C) Relative IFN- production responses at the 10 ng/ml dose of IL-12 for NK cell cultures enriched by 7-day expansion in IL-15 or further purified by negative selection. **, P < 0.001, over the entire IL-12 dose range, as determined by paired Student’s t-test. (D) Percentages of NK (NK1.1+/CD3–) and T (NK1.1–/CD3+) cells in cultures of freshly isolated splenocytes (left), NK cells enriched by negative selection (middle), and T cells enriched by negative selection (right). (E) NK cells from WT or PKC–/– mice were mixed with T cells from WT mice, or (F) NK cells from WT or PKC–/– mice were mixed with T cells from PKC–/– mice, cultured for 7 days in IL-15, and then treated with IL-12 for 24 h. IFN- production was measured by ELISA.
|
production during the IL-12 stimulation period, the possibility remains that the splenic T cells affected the development of the NK cells during the 7-day expansion with IL-15 in a manner that was influenced by PKC. To test this hypothesis, NK cells and T cells derived from WT and PKC–/– mice were mixed reciprocally in culture. NK cells and T cells were enriched by negative selection directly from spleens (Fig. 4D)
. NK cells initially represent 3% of the total splenocyte population, and the negative selection strategy produced a population enriched to 60% NK1.1+/CD3– cells (Fig. 4D)
. The remaining cells consisted of 5% NK1.1–/CD3+ T cells and 35% NK1.1–/CD3– cells. Negative selection to enrich T cells from splenocytes resulted in a population that was greater than 96% NK1.1–/CD3+ (Fig. 4D)
.
We reasoned that if T cell PKC were contributing to NK cell activation during the 7-day culture with IL-15, then adding WT T cells to PKC–/– NK cells should augment their IFN- production. Conversely, PKC–/– T cells should reduce IFN- production by WT NK cells. Enriched NK and T cell populations from WT and PKC–/– mice were mixed at a ratio of 1:10 to reproduce the approximate proportions found in the spleen and cultured for 7 days in the presence of IL-15. Although these cultures did not expand as well as unfractionated splenocyte cultures, the percentage of NK cells present at the end of the culture period consistently averaged 50% (data not shown). These mixed cell cultures were then treated overnight with IL-12 and assessed for their ability to produce IFN-. The results show that IFN- levels were not restored when WT T cells were added to PKC–/– NK cells (Fig. 4E)
. Moreover, IFN- production was not reduced when WT NK cells were cultured with PKC–/– T cells (Fig. 4F)
. These findings confirm that PKC signaling in T cells does not contribute to the relatively lower IL-12-induced IFN- response by PKC–/– NK cells.
NK cells from PKC–/– mice do not show increased apoptosis in response to IL-12
One possible explanation for the reduced IFN- production in cultures of NK cells from PKC–/– mice is increased apoptosis in these cultures during the overnight treatment with IL-12. Using fluorophore-labeled Annexin V in combination with PI, the percentages of live, apoptotic, and dead cells were distinguished by flow cytometry in cultures of IL-15-enriched splenocytes treated with IL-12. No differences were apparent in cultures from WT and PKC–/– mice (data not shown). Comparable viability in response to IL-12 was also confirmed (data not shown). Thus, the low IFN- levels in cultures of PKC–/– NK cells treated with IL-12 were not a consequence of decreased cell viability or increased apoptosis.
PKC is not required for IL-12-induced STAT4 signaling
To investigate potential signaling mechanisms by which PKC could affect NK cell IFN- production, we examined IL-12 signaling in NK cells. Surface expression of the IL-12Rβ1 subunit was comparable for NK1.1+ cells from PKC–/– and WT mice (Fig. 5A
, upper) and increased similarly upon treatment with IL-12 (Fig. 5A
, lower). Equivalent amounts of STAT4 protein (Fig. 5B
, middle) and phosphorylated STAT4 protein (Fig. 5B
, top) were also detected by Western blots of protein lysates made from purified NK cells from WT and PKC–/– mice treated with IL-12. These results suggest that the IL-12 signaling pathway to STAT4 phosphorylation is intact in NK cells from PKC–/– mice.
 View larger version (36K): [in a new window] |
Figure 5. Signaling responses to IL-12 are not affected in cultures from PKC–/– mice. (A) IL-12Rβ1 expression was analyzed in gated NK1.1+/CD3– cells from WT and PKC–/– mice before (upper) and after (lower) 24 h treatment with IL-12 (10 ng/ml). Data are representative of three independent experiments. (B) NK cells from WT or PKC–/– mice were enriched with IL-15, purified by negative selection, and treated with IL-12 for 5 min or 2 h. Blots were stained with antibodies to phospho (p)-STAT4 (top), STAT4 (middle panel), or actin (bottom). Relative densitometry ratios for phosphorylated and total STAT6 are shown below top and middle panels. (C) Separate blots were stained with antibodies to phospho-PKC (T538; top), PKC (middle), or actin (bottom). Relative densitometry ratios for phosphorylated and total PKC are shown below top and middle panels.
|
is activated in mouse NK cells in response to IL-12. We used specific antibodies that recognized native PKC or the phosphorylated T538 residue in the activation loop of the catalytic site of PKC [28
]. Strong expression of PKC was detected in purified NK cells from WT but not PKC–/– mice (Fig. 5C
, middle). Phosphorylation of PKC at T538 was detected in purified NK cells independent of IL-12 treatment (Fig. 5C
, top). These results show that PKC is expressed in mouse NK cells but suggest that the active site T538 of PKC is not directly phosphorylated as a consequence of IL-12 signaling.
Upon antigen receptor stimulation in T cells [2
] or mast cells [12
], PKC undergoes translocation from the cytosol to particulate membrane fractions. In NK cells, PKC has been shown to polarize to the site of contact with a cytolytic target cell [15
]. Nevertheless, membrane translocation of PKC in response to cytokine stimulation has not been described in any cell type. To address whether PKC translocates to the cell membrane upon IL-12 stimulation of NK cells, we performed subcellular fractionation and immunoblotting using NK cells purified from IL-15-activated splenocytes of WT mice. PKC immunoreactivity was primarily associated with the cytosolic fraction but could also be detected in membrane, nuclear, and cytoskeletal fractions. No apparent change in PKC distribution among these fractions was evident upon IL-12 treatment (data not shown).
PKC is not required for IFN- transcription or mRNA stability
To determine if NK cells from PKC–/– mice exhibit reduced IFN- mRNA transcription upon exposure to IL-12, total RNA was made from NK cells purified by negative selection from WT or PKC–/– mice and treated with IL-12 for 4 h. The relative amount of IFN- transcript in each sample was compared using qRT-PCR (Taqman) analysis. IFN- transcript levels increased upon treatment with IL-12 similarly in cells from WT and PKC–/– mice (Fig. 6A
). Interestingly, across the IL-12 dose range examined, IFN- transcript levels were constant (Fig. 6A)
, whereas protein induction showed a clear dose-response relationship (Fig. 2A)
. This suggests the involvement of post-transcriptional regulation in controlling levels of IFN- produced in response to IL-12.
 View larger version (16K): [in a new window] |
Figure 6. PKC is not required for optimal IFN- transcription or message stability. NK cells were purified by negative selection from IL-15-enriched splenocytes from WT or PKC–/– mice and treated with IL-12 (10 ng/ml) for 4 h. (A) Transcription of IFN- was analyzed by real-time PCR (*, P<0.05). (B) To measure mRNA stability, actinomycin D was added after exposure to IL-12, and RNA was isolated 30 or 90 min later. Transcript levels were analyzed by real-time PCR. Data were pooled for three individual experiments. R2 values for WT and PKC–/– cultures were calculated as 0.966 and 0.92, respectively.
|
, we compared mRNA levels for other genes known to be regulated by IL-12, such as TNF-, lymphotoxin- (LT), IL-12Rβ1, IL-12Rβ2, IL-18R, t-Bet, IFN-responsive factor 1 (IRF1), IRF4, and IRF8 [29
]. For each of these genes, the expression level increased following IL-12 treatment, but these trends did not reach statistical significance and were the same in NK cells from WT and PKC–/– mice (data not shown).
Given the presence of adenosine-uridine (AU)-rich elements within the 3'-untranslated region (UTR) of the mouse IFN- gene, we considered whether PKC could influence the stability of IFN- message after it has been transcribed. To address this, actinomycin D chase experiments were performed using NK cells enriched by negative selection and treated with IL-12 for 4 h. Total RNA was harvested at 0, 30, and 90 min after actinomycin D treatment, and the level of IFN- mRNA in each sample was quantitated by Taqman analysis. No statistically significant change in mRNA stability was noted in IL-12-treated NK cells from PKC–/– mice at the 10 ng/ml dose of IL-12 tested when compared with cells from WT mice (Fig. 6B)
. These data collectively suggest that IFN- mRNA transcription and stability were not regulated by a PKC-dependent signal.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
production is an essential component of the innate immune response. NK cells express PKC, but this kinase has not previously been linked to a specific functional response in these cells. We show here that PKC may be a key regulator of NK cell IFN- production, as NK cells from PKC–/– mice showed a clear and consistent deficiency in IFN- production in response to IL-12. Comparison of cells from WT and PKC–/– mice demonstrated that PKC is not required for NK cell development, viability, or expansion. Splenocytes from PKC–/– mice, activated in vitro by exposure to IL-15 or IL-12 or in vivo by poly(I:C), had full cytolytic activity against YAC-1 targets, as compared with cells from WT mice. Their cytolytic response to IL-12 demonstrated that PKC is not directly involved in mediating all IL-12 responses in NK cells. In contrast to its effect on the IL-12 response, PKC did not appear to affect IL-18-induced IFN- production by NK cells, indicating that PKC is not involved in all pathways leading to IFN- production.
As PKC is essential for T cell activation, and IFN- can be a T cell product, it was important to establish the cellular source of IFN- in these experiments. We demonstrated that as for unfractionated splenocytes, purified NK cells from PKC–/– mice had defective IFN- production following IL-12 treatment. Furthermore, intracellular cytokine staining showed that the IL-12-induced IFN- was generated in NK cells and not T cells. Together, these observations suggest that the effect of PKC on IFN- production is specific to the NK cells within this system.
In several experiments, NK cells were expanded in splenocyte cultures following a 7-day treatment with IL-15. To address whether T cells present in the cultures influenced the activation state of NK cells, we separately enriched T cells and NK cells from WT or PKC–/– mice and recombined them prior to treatment with IL-15. When NK cells from PKC–/– mice were combined with T cells from WT mice prior to the 7-day enrichment with IL-15, the defect in IFN- production was retained. Conversely, cultures consisting of NK cells from WT mice and T cells from PKC–/– mice showed no defect in IFN- production. These results suggest that the presence of PKC-deficient T cells did not affect the ability of the NK cells to produce IFN-, confirming that the defect in IL-12-induced IFN- production was a property of the NK cells themselves.
Phosphorylation of PKC at T538 within the catalytic domain is key to its activation [28
] and commonly occurs through the activity of 3-phosphoinositide-dependent protein kinase-1 [28
] or through autophosphorylation events [30
]. We found phosphorylation of PKC at T538 in purified NK cells from WT mice, but the level of phosphorylation was not enhanced by IL-12, suggesting that T538 was phosphorylated prior to addition of IL-12. In T cells, constitutive phosphorylation of PKC at T538 has been reported [31
], with activation and membrane translocation resulting in inducible phosphorylation of the hydrophobic motif serine 695 [32
]. Sheppard et al. [33
] first reported inducible T538 phosphorylation of the activation loop of PKC using PHA-activated human T cells from PBMCs that were restimulated with bead-bound anti-CD3 and soluble anti-CD28. Others have confirmed inducible autophosphorylation at T538 [30
, 33
, 34
]. Further work will be needed to address the regulation of PKC activation loop phosphorylation under various conditions of activation.
The IL-12 heterodimer (p35 and p40 subunits) binds to IL-12Rβ1 and recruits the IL-12Rβ2 chain to form an active signaling complex [35
]. IL-12R engagement stimulates tyrosine phosphorylation of IL-12Rβ2 and of associated kinases, tyrosine kinase 2, and JAK2, which phosphorylates STAT4, leading to its dimerization and nuclear translocation, where it promotes transcription of the IFN- gene as well as a number of other target genes [29
]. Reduced expression of IL-12R or STAT4 in PKC-deficient NK cells could account for their decreased IL-12 responsiveness leading to IFN- production. We found that NK cells from PKC–/– mice exhibited normal expression of IL-12Rβ1 and STAT4 proteins and normal induction of STAT4 phosphorylation in response to IL-12. These findings, along with the observation that IL-12-induced cytotoxicity against YAC-1 targets was intact in NK cells from PKC–/– mice, confirm that overall IL-12 responsiveness was not dependent on PKC. This conclusion was further supported by the observation that IL-12-induced transcription of IL-12Rβ1, IL12Rβ2, IL-18R, TNF-, and LT was unimpaired in NK cells from PKC–/– mice (data not shown). Transcription factors induced by IL-12 and known to regulate IFN- were also analyzed. The levels of t-Bet, IRF1, IRF4, and IRF8 were similar between NK cells from WT and PKC–/– mice (data not shown).
PKC did not appear to be required for NK cell IFN- transcription, as IL-12 induced similar mRNA levels in NK cells from WT and PKC–/– mice. Several cytokines and growth factors are regulated post-transcriptionally through destabilizing AU-rich regions within their 3'-UTR [36
]. The 3'-UTR of mouse IFN- has several AU-rich tracts, making it a candidate for regulation in this manner. Actinomycin D chase experiments, however, showed that IFN- mRNA stability was unaffected by the absence of PKC. Additional observations suggested IFN- transcript levels did not increase proportionally with IFN- protein produced in response to IL-12, suggesting possible effects of IL-12 on IFN- translational efficiency. Taken together, these observations suggest a role for PKC in the post-transcriptional regulation of IFN-. One potential post-transcriptional regulatory mechanism is the release of cytokine from intracellular stores. This was addressed by intracellular cytokine staining. Consistent with their lower levels of secreted IFN-, NK cells from PKC–/– mice displayed lower levels of intracellular IFN- following IL-12 stimulation, as compared with cells from WT mice. Thus, PKC does not appear to regulate secretion of IFN- from the cell.
A recent report suggested that phosphorylation and activation of PKC occur downstream of Types I (,β) and II () IFNs in T cells [37
]. In our model, PKC may be playing a comparable secondary role. IFN- may act back on NK cells through its own receptor, thus forming a positive-feedback cycle aimed at enhancing the innate immune response [38
]. If so, it would raise the possibility that PKC signals downstream of the IFN- receptor as opposed to the IL-12R. Another potential, indirect mechanism would involve PKC regulation of NK cell IL-12 responsiveness through TGF-β1. Human NK cells constitutively produce TGF-β1, which acts as a negative regulator of NK cell functions, including IFN- production [39
, 40
]. Recently, IL-12, IL-15, and IL-18 were shown to down-regulate levels of the TGF-β Type II receptor and signaling proteins SMAD2 and SMAD3 in human NK cells [41
]. Further studies will be required to address these potential mechanisms.
Although PKC deficiency resulted in only a partial decrease in IFN- production, the in vivo consequences for a NK cell-dependent response may be profound. Upon infection with murine CMV (MCMV), which provokes a NK cell-dependent response [42
], TLR9-deficient mice exhibit a 25–30% reduction in NK cell IFN- production, along with a mild reduction in cytotoxic activity [43
]. Despite the partial reduction in NK cell activation, the ability of TLR9-deficient mice to clear MCMV was significantly impaired in comparison with WT animals [43
]. In viral infection models, PKC is not required for IFN- production from CD8+ cells [44
] or for Th1-dependent, CTL-mediated clearance of lymphocytic choriomeningitis virus [44
], influenza virus [44
], or Leishmania major [5
]. PKC was also not required for development of Coxsackie virus-induced myocarditis in mice [45
]. In contrast, PKC–/– mice were unable to mount an effective Th2 immune response to Nippostrongylus brasiliensis infection [5
]. Following infection with murine -herpesvirus 68, PKC–/– mice were deficient in the generation of Th2 cytokine and antibody responses to the virus but were not impaired in CD8+ CTL activation or viral clearance [46
]. The requirement for PKC in a NK cell-dependent model viral infection remains to be determined.
In summary, these data have outlined a specific, functional role for PKC in NK cells, leading to the IL-12-dependent release of IFN-, most likely at a post-transcriptional level. PKC is not required for all NK cell responses to IL-12 or for IFN- production in response to all stimuli. The involvement of a distinct, PKC-dependent regulatory mechanism to control this specific functional response emphasizes the critical role of IL-12-induced NK cell IFN- production in innate immunity.
Received November 12, 2007; revised December 18, 2007; accepted January 9, 2008.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
: a potential therapeutic target for T-cell-mediated diseases Curr. Opin. Investig. Drugs 7,432-437[Medline]: signaling from the center of the T-cell synapse Curr. Opin. Immunol. 14,323-330[CrossRef][Medline] affects Ca2+ mobilization and NFAT cell activation in primary mouse T cells J. Exp. Med. 197,1525-1535 is critical for the development of in vivo T helper (Th)2 cell but not Th1 cell responses J. Exp. Med. 200,181-189 controls Th1 cells in experimental autoimmune encephalomyelitis J. Immunol. 175,7635-7641-deficient mice are protected from Th1-dependent antigen-induced arthritis J. Immunol. 177,1886-1893 knockout mice are protected from fat-induced insulin resistance J. Clin. Invest. 114,823-827[CrossRef][Medline] but not PKC- mRNA in type 2 diabetes: inverse relationship with in-vivo insulin sensitivity Eur. J. Clin. Invest. 33,983-987[CrossRef][Medline]} leads to increased susceptibility to obesity and dietary insulin resistance in mice Am. J. Physiol. Endocrinol. Metab. 292,E84-E91[CrossRef][Medline] in skeletal muscle: a new model of insulin resistance and obesity J. Cell. Physiol. 196,89-97[CrossRef][Medline] is expressed in mast cells and is functionally involved in Fc receptor I signaling J. Leukoc. Biol. 69,831-840: biology and role in pathogenesis Adv. Immunol. 62,61-130[Medline] Annu. Rev. Immunol. 15,749-795[CrossRef][Medline]: an overview of signals, mechanisms and functions J. Leukoc. Biol. 75,163-189 by NK cells in response to influenza A virus J. Clin. Invest. 114,1812-1819[CrossRef][Medline] interferon production Infect. Immun. 73,1482-1490 for T(H)1 priming Nat. Immunol. 5,1260-1265[CrossRef][Medline] activation loop autophosphorylation and the kinase domain catalytic mechanism Biochemistry 44,9563-9573[CrossRef][Medline]
B activation" Science 312,55[Medline] at the C-terminal hydrophobic-motif in human T lymphocytes Biochem. Biophys. Res. Commun. 334,619-630[CrossRef][Medline]
signalosome and downstream signaling to PKC FEBS Lett. 574,37-41[CrossRef][Medline]B activation Science 308,114-118 in interferon signaling in T-cells J. Biol. Chem. 279,29911-29920 interferon strongly upregulates its own gene expression in peripheral blood lymphocytes J. Exp. Med. 170,1021-1026 production by human natural killer cells Immunity 24,575-590[CrossRef][Medline]} during in vivo CD8(+) T cell effector and memory responses Proc. Natl. Acad. Sci. USA 102,14374-14379 signaling and promote autoimmune myocarditis J. Immunol. 178,3466-3473 is not essential for T-cell-mediated clearance of murine herpesvirus 68 J. Virol. 79,6808-6813This article has been cited by other articles:
 |
|
 |
|
  J. I. Aguilo, J. Garaude, J. Pardo, M. Villalba, and A. Anel Protein Kinase C-{theta} Is Required for NK Cell Activation and In Vivo Control of Tumor Progression J. Immunol., February 15, 2009; 182(4): 1972 - 1981. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Tassi, M. Cella, R. Presti, A. Colucci, S. Gilfillan, D. R. Littman, and M. Colonna NK cell-activating receptors require PKC-{theta} for sustained signaling, transcriptional activation, and IFN-{gamma} secretion Blood, November 15, 2008; 112(10): 4109 - 4116. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
