PeproTech Inc.
Originally published online as doi:10.1189/jlb.0107065 on December 27, 2007

Published online before print December 27, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0107065v1
83/4/853    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Berg, M.
Right arrow Articles by Zavazava, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Berg, M.
Right arrow Articles by Zavazava, N.
(Journal of Leukocyte Biology. 2008;83:853-863.)
© 2008 by Society for Leukocyte Biology

Regulation of CD28 expression on CD8+ T cells by CTLA-4

Martina Berg* and Nicholas Zavazava*,{dagger},1

* Department of Internal Medicine, University of Iowa Hospitals and Clinics and VA Medical Center,
{dagger} Immunology Graduate Program, Iowa City, Iowa, USA

1 Correspondence: University of Iowa Hospitals and Clinics and VA Medical Center Iowa City, Department of Internal Medicine, C51-F, 200 Hawkins Drive, Iowa City, IA 52242, USA. E-mail: nicholas-zavazava{at}uiowa.edu


arrow
ABSTRACT
 
CD28 and CTLA-4 are the critical costimulatory receptors that predominantly determine the outcome of T cell stimulation, with CD28 promoting positive costimulation and CTLA-4 inducing inhibitory signals. Blockage of the B7-CD28/CTLA-4 pathway leads to transplantation tolerance. However, the exact mechanism of the inhibitory function of CTLA-4 remains elusive. Here, we investigated the influence of CTLA-4 expression on CD28 using CTLA-4-transfected Jurkat T cells as well as primary T cells. Up-regulation of CTLA-4 induced abrogation of IL-2 production, indicating an anergic phenotype of CTLA-4high T cells. Besides the negative signaling function of CTLA-4, we show for the first time that CTLA-4 expression promotes the down-regulation of CD28 on the T cell surface as a result of enhanced internalization and degradation of CD28. These data suggest that apart from the established competition for B7.1 and B7.2 by CTLA-4, inhibition of T cells by CTLA-4 might be additionally explained by reduction of CD28 on the cell surface, which might impede T cell response to stimulation. Our data provide a previously unrecognized mechanism for T cell regulation.

Key Words: endocytosis • proteolysis • CD28


arrow
INTRODUCTION
 
Optimal stimulation of T cells is thought to involve at least two signaling events. Signal 1 is induced via TcR recognition of peptide-MHC complexes, and signal 2 is elicited by CD28 molecules on T cells interacting with B7.1 and B7.2 on APCs. T cells receiving a signal through the TcR in the absence of CD28 costimulation become unresponsive to antigen rechallenge and are rendered anergic [1 ].

However, the outcome of T cell stimulation is also dependent on the expression of CTLA-4, an activation-induced coreceptor with high sequence and structural homology to CD28, which binds the same ligands on APCs, B7.1 and B7.2 [2 ]. Although costimulatory molecules CD28 and CTLA-4 share the same ligands, they have opposing effects on the outcome of a T cell response [3 ]. CTLA-4 mediates down-regulation of the T cell response through interference with TcR signals and favors the onset of antigen-specific tolerance [4 5 6 ], whereas ligation of CD28 leads to IL-2 up-regulation, progression through the cell cycle, prevention of anergy, and inhibition of TcR-induced apoptosis [7 , 8 ]. The dramatic inhibitory function of CTLA-4 became evident in CTLA-4–/– mice, which exhibit severe lymphoproliferative disease [9 ], in contrast to CD28-deficient mice that exhibit impaired T cell responses and reduced responses to infectious antigens as well as alloantigens [10 11 12 ]. Thus, these data indicate important roles in immune regulation by CTLA-4 and CD28.

Thus far, it is known that CTLA-4 can inhibit T cell responses by two different mechanisms. One is the antagonism of B7-CD28-mediated costimulatory signals by CTLA-4 [13 ], as a result of high affinity of CTLA-4 for B7 [6 , 14 ]. A second mechanism, by which CTLA-4 can inactivate T cells in the absence of CD28, involves the delivery of a negative signal by interfering with TcR-derived signals [15 16 17 18 ]. One possibility for its negative signaling is that CTLA-4 induces the dephosphorylation of the TcR signaling machinery by recruiting tyrosine phosphatase Src homology-containing tyrosine phosphatase 2 to its cytoplasmic tail, thereby blocking T cell activation and expansion [18 ]. Besides the studies where phosphorylated tyrosine residues in the cytoplasmic tail of CTLA-4 are required for recruitment of signaling molecules [17 , 19 ], there is some evidence that tyrosine phosphorylation of CTLA-4 is not essential for its function [20 ]. Thus, the precise mechanism of CTLA-4-mediated, negative signaling remains controversial. Here, we identified a so-far unknown inhibitory effect of CTLA-4, namely, its negative impact on CD28 expression in T cells.

CD28 is constitutively expressed on almost all human CD4+ (hCD4+) T cells and on ~50% of CD8 T cells, whereas CTLA-4 expression is tightly controlled and occurs only after T cell activation [21 ]. It has been reported that CD28 surface expression is also not steady and is influenced by several mechanisms, i.e., TcR-mediated activation [22 ], in vitro replicative senescence [23 ], and CD28 down-regulation by B7.1 and B7.2 engagement [24 ]. It has been shown by Cefai et al. [25] that CD28 undergoes clathrin-dependent endocytosis; however, whether CD28 is endocytosed in a clathrin-dependent or independent manner is controversially discussed [26 , 27 ].

Here, we provide evidence that CD28 internalization and proteolysis are promoted by CTLA-4, leading to reduced surface expression of CD28. Thus, we provide an additional mechanism by which CTLA-4 impedes the activation of T cells.


arrow
MATERIALS AND METHODS
 
Cell culture
Jurkat CD8{alpha}{alpha}, which will be referred to hereafter as wild-type (WT; kindly provided by Dr. Thorsten Witte, Division of Clinical Immunology, University of Hannover, Germany), Jurkat CD8{alpha}{alpha}-CTLA-4 (referred to as JM8A-4), and Jurkat CD8{alpha}{alpha}-mB7 cells (JM8-B7) were maintained at 37°C in a 5% CO2 incubator in RPMI plus HEPES (Gibco-BRL Life Technologies, Gaithersburg, MD, USA), supplemented with 10% FBS, 100 U/ml streptomycin/penicillin, and 0.2 mg/ml hygromycin B (Gibco-BRL Life Technologies). JM8A-4 and JM8-B7 cultures were additionally supplemented with 0.5 mg/ml G418 (Gibco-BRL Life Technologies).

Generation of CTLA-4 and mB7 transfectants
The cDNA of human CTLA-4 was obtained by RT-PCR of RNA, derived from human PHA blasts. The primers were purchased from Gibco-BRL Life Technologies, and their sequences were as follows: 5' primer, 5' CTAAGCTTGGTACCGAGATGGCTTGCCTTGGATTTCAGC 3'; 3' primer, 5' CCTCTAGACTCGAGTCAATTGATGGGAATAAAATAAGGC 3'. PCR was performed according to standard procedures, and the product was purified using the QIAquick PCR purification kit (Qiagen, Valencia, CA, USA) and confirmed by DNA sequencing. Human CTLA-4 cDNA was ligated into the pcDNA3.1+ expression vector (Invitrogen Life Technologies, Carlsbad, CA, USA) using standard recombinant DNA techniques. Jurkat CD8{alpha}{alpha} cells were transfected using LipofectAMINETM 2000 (Gibco-BRL Life Technologies), following the manufacturer’s protocol. Briefly, 5 x 105 Jurkat CD8{alpha}{alpha} cells were plated in a 24-well plate and incubated with 1 µg pcDNA3.1 and LipofectAMINETM 2000 for 24 h, resuspended in 0.5 ml RPMI-1640 medium. CTLA-4 expression in transfectants was monitored after 24 h stimulation on anti-CD3-coated plates by flow cytometry. Positive clones harboring the neomycin-resistance gene were selected in the presence of 1.5 mg/ml G418. Stable transfectants were maintained in a medium containing 0.5 mg/ml G418.

As control for unspecific transfection effects, Jurkat CD8{alpha}{alpha} cells were also transfected with HLA-B7. The cDNA of the HLA-B7 was kindly provided by Dr. Hridaybhiranjan Shukla (Department of Genetics, Yale University, New Haven, CT, USA) and ligated into the pcDNA3 expression vector (Invitrogen Life Technologies). Cells were transfected as described above and cultured in the G418-selection medium. Three weeks after transfection, cells were stained with mAb ME.1-FITC (anti-HLA-B7) and sorted for HLA-B7high using a FACSDiVa (Becton Dickinson, San Jose, CA, USA). Sorted cells were subsequently cultured in RPMI medium containing 0.5 mg/ml G418.

Antibodies
The following antibodies were used for stimulation of WT cells and CTLA-4 transfectants: The anti-CD3 mAb was purified from the supernatant of hybridoma cell line OKT3 (ATCC CRL 8001) by affinity chromatography, whereas the anti-CD28 mAb (CD28.2, BD PharMingen, San Diego, CA, USA) and anti-mouse IgG (mIgG; Santa Cruz Biotechnology, Santa Cruz, CA, USA) were purchased. Anti-CTLA-4-PE and anti-CD28-FITC/PE, purchased from BD PharMingen, were used for flow cytometric analysis, internalization assays, and confocal microscopy. Monoclonal mouse anti-CD28 from Becton Dickinson (CD28.2) was also used for immunoprecipitation of CD28. Staining of Western blots was performed with rabbit anti-CD28 (H-93), rabbit anti-cbl (C-15), and the appropriate anti-mIgG or anti-rabbit IgG HRP-conjugated antibodies obtained from Santa Cruz Biotechnology. Mouse anti-Ubiquitin mAb (P4D1) was purchased from Covance Inc. (Princeton, NJ, USA). ME.1 mAb (anti-HLA-B7, anti-HLA-B27) was purified from the supernatant of hybridoma cell line ME1 (ATCC HB-119). The mIgG isotype control for the immunoprecipitation of CD28 was purchased from Becton Dickinson (BD #555746).

IL-2 ELISA
WT cells and CTLA-4 transfectants were stimulated for 24 h on an anti-CD3 (OKT-3)-coated plate, and plates were coated with 10 µg/ml OKT-3 in PBS. Subsequently, cells were cultured for restimulation on anti-CD3-coated 96-well plates in a density of 2 x 105 cells per well in 200 µl full RPMI. Supernatants were harvested after 48 h and analyzed using a commercially available hIL-2 ELISA kit (Biosource, Camarillo, CA, USA). OD of the samples was determined on a Benchmark microplate reader (Bio-Rad Life Technologies, Hercules, CA, USA).

Western blotting
WT cells and CTLA-4 transfectants were stimulated for 24 h on an anti-CD3-coated plate (10 µg/ml OKT-3) or left untreated as indicated. Cells were washed subsequently in ice-cold PBS and lysed in 1% Nonidet P-40/0.15 M NaCl/1M Tris, pH 7.4/1 mM sodium monovanadate/10 mM sodium fluoride/1 mM sodium pyrophosphate/1 mM PMSF/5 µg/ml aprotinin/5 µg/ml leupeptin. Protein concentration was measured using a colometric standard protein assay [dendritic cell (DC) protein assay, Bio-Rad Life Technologies]. Equal protein amounts of each lysate were denatured in reducing sample buffer, electrophoresed on 10% SDS-polyacrylamide gels, and transferred to nitrocellulose for 4 h at 0.8 Amp.

The transfer membrane was blocked with 5% (w/v) BSA (Sigma-Aldrich, St. Louis, MO, USA) in PBS and incubated with the appropriate antibody. The membranes were incubated with an appropriate peroxidase-conjugated, secondary antibody (Amersham, Piscataway, NJ, USA) and developed by using ECL Western blot detection reagents (Amersham). For restaining of the same membrane, bound antibodies were removed for 30 min at 56°C in 2% SDS/1 M Tris, pH 6.8/100 mM ME, and the staining procedure was repeated with the antibody of choice.

Immunoprecipitation
WT cells and CTLA-4 transfectants (5x106) or 1 x 107 primary PBL were stimulated overnight with anti-CD3 and lysed as described above. For proteasome inhibition assays, cells were treated for 16 h or 12 h during stimulation with 2 µM lactacystin (Calbiochem, San Diego, CA, USA) or 10 µM MG-132 (Calbiochem), respectively. Both reagents are proteasome inhibitors. Lysates, containing 0.5 mg protein (analyzed using DC protein assay from Bio-Rad Life Technologies), were subjected to preclearing with protein G-Sepharose (Amersham), followed by incubation with anti-CD28 mAb (28.2) for 2 h at 4°C. The immunocomplex was subsequently precipitated with Protein G Sepharose beads for 2 h. The precipitate was washed four times in lysis buffer, and proteins were detached and denatured in reducing sample buffer. Electrophoresis and Western blotting were performed as above. The membranes were incubated with antibodies against CD28 (H-93) or cbl (C-15), respectively, and subsequently visualized with anti-rabbit-HRP secondary antibody.

CD28 RT-PCR
Stimulated or resting Jurkat WT and JM8A-4 cells (5x106) were lysed and RNA-extracted using the Qiagen RNA extraction kit (Qiagen). The primers for the PCR reaction were purchased from Integrated DNA Technologies, Inc. (Coralville, IA, USA), and their sequences were as follows: hCD28 5' primer, 5' TCAAGTAACAGGAAACAAGATT 3', hCD28 3' primer, 5' ACTCCTCACCCAGAAAATAATA 3'; GAPDH 5' primer, 5' TGAAGGTCGGAGTCAACGGATTTGGT 3', GAPDH 3' primer, 5' CATGTGGGCCATGAGGTCCACCAC 3'. RT-PCR was performed according to standard procedures using the following conditions: 0.3 µM GAPDH primer, 0.6 µM hCD28 primer, 500 ng RNA, and annealing temperature, 55°C. Samples were run on 2% agarose gels.

Internalization assay and confocal microscopy
WT cells and CTL-4 transfectants were stimulated with the anti-CD3 antibody for 24 h or left untreated. The cells were subsequently incubated with 2 µg/ml FITC-conjugated anti-CD28 mAb or 1 µg/ml PE-conjugated anti-CTLA-4 mAb at 37°C for 2 h. After incubation, cells were washed once with ice-cold PBS and divided into two aliquots. One aliquot was left untreated on ice, and the other was incubated on ice for 1 min in 0.2 M acetic acid solution (0.5 M NaCl solution adjusted to pH 2.5, supplemented with 10% FCS). This procedure removes cell surface-bound antibodies and therefore, allows for monitoring of the internalized antibody. Some samples were additionally treated during the staining procedure with 0.45 M sucrose medium to block clathrin-dependent endocytosis, as indicated. Samples were then washed in a large excess of RPMI-1640 medium, supplemented with 10% FCS and 100 mM HEPES buffer and analyzed by flow cytometry.

Confocal microscopy was performed after cytospin preparation of WT or CTLA-4 mutants that were stained with anti-CD28-FITC for 30 min at 4°C or for 2 h with anti-CD28-PE at 37°C, respectively. Cells were left untreated or acid-stripped as described above. After staining, cells were washed two times with PBS, and 100 µl cell suspension-containing 105 cells were cytospun. Samples were examined under a Bio-Rad 1024 confocal microscope using a x60 objective lens.

For the kinetic study of CD28 and CTLA-4 expression, receptor expression was measured at 37°C during anti-CD3 stimulation, beginning with 30 min after stimulation. The left y-axis shows total CTLA-4 expression, and the right y-axis displays the surface expression of CD28 (% total CD28–% CD28 internalized) in CTLA-4 transfectants.

Flow cytometry
For flow cytometry, 5 x 105 WT and CTLA-4 transfectants or 1 x 106 PBL were incubated for 30 min at 4°C with PE-labeled anti-CTLA-4 or FITC-labeled anti-CD28, respectively. Stained cells were detected with a FACScan (Becton Dickinson) and analyzed with the WinMDI software (Joseph Trotter, URL: http://facs.scripps.edu).

In vitro anergy induction
PBMC were obtained from healthy volunteers and separated by density gradient centrifugation over Ficoll-Histopaque (Sigma-Aldrich). Anergy was induced by multiple superantigen stimulation as described before [28 ]. Briefly, PBMC were stimulated with 5 µg/ml staphylococcal enterotoxin B (SEB) for 3 days. Cells were harvested, resuspended in fresh medium, and three times restimulated with irradiated PBMC from the same donor as APCs and 5 µg/ml SEB for 3 days each. Cells were harvested, rechallenged with SEB alone, or left untreated (resting) for 3 days, and expression of CD28 and CTLA-4 was assessed by flow cytometry. Anergized and naïve PBMC were also tested for ubiquitination of CD28 as described above.


arrow
RESULTS
 
CTLA-4 expression on T cells impairs IL-2 production upon CD3 stimulation
To establish a model for studying the effects of CTLA-4 in human T cells, we used the Jurkat T cell line; Jurkat T cells do not express CTLA-4 in resting conditions or after activation (Fig. 1A ). Mock controls remained negative, showing no difference to the WT cells. Following transfection of Jurkat CD8{alpha}{alpha} T cells (WT) with human CTLA-4 cDNA (JM8A-4), low levels of surface CTLA-4 could be detected in resting cells, which are highly elevated after 24 h of activation via CD3 ligation (Fig. 1A) . This result provides a model to study the effects of CTLA-4 expression in T cells.


Figure 1
View larger version (12K):
[in this window]
[in a new window]

 
Figure 1. (A) Activated CTLA-4 transfectants highly express CTLA-4. WT Jurkat CD8{alpha}{alpha} cells were transfected with human CTLA-4 cDNA (JM8A-4). CTLA-4 surface expression on transfectants was induced after 24 h stimulation with an immobilized anti-CD3 antibody and analyzed by flow cytometry. Stimulated CTLA-4 transfectants highly express CTLA-4 (right panel), and CTLA-4 expression was not inducible in WT cells (left panel). The solid line represents resting and the broken line, stimulated cells. Mock transfectants were negative. (B) CTLA-4 abrogates IL-2 production in T cells. WT and CTLA-4-transfected cells were stimulated with an anti-CD3 antibody for 24 h. After restimulation for an additional 48 h with 10 µg/ml-immobilized anti-CD3 in 96-well plates, supernatants of triplicates were assessed for hIL-2 by ELISA. Each experiment was performed at least three times. CTLA-4 transfectants showed impaired IL-2 production compared with the WT.

An important hallmark of anergic T cells is their inability to secrete IL-2 [29 ]. Here, we determined the IL-2 production by WT cells and CTLA-4 transfectants after CD3 stimulation, thus, after up-regulation of CTLA-4. The IL-2 released by stimulated and that by unstimulated WT cells was 200 ± 7.3 versus 59.1 ± 2.8 U/ml; P < 0.0001, respectively. For the JM8A-4 transfectants, the stimulated cells secreted 57.2 ± 3.5 U/ml IL-2 compared with 29.7 U/ml in unstimulated cells; P < 0.0001. Each experiment was repeated at least three times in triplicates. Thus, as expected, the ability of CTLA-4 transfectants to secrete IL-2 was significantly impaired (Fig. 1B) .

Ligating CTLA-4 with an anti-CTLA-4 antibody did not significantly further decrease the IL-2 production compared with nonligated CTLA-4 transfectants, suggesting negative regulation by the high CTLA-4 expression.

CTLA-4 promotes down-regulation of CD28 surface expression
The effect of CTLA-4 on T cell activation has been related to negative signaling through its cytoplasmic tail [16 , 17 ] and B7 sequestration [13 ]. In addition, CTLA-4 negatively influences T cell activation by competing for B7.1 and B7.2, because of its 20- to 50-fold higher affinity for both molecules compared with CD28 [5 , 14 ]. We hypothesized that in addition to its negative effect on the T cell signaling machinery, CTLA-4 could negatively influence the expression of CD28, which may impede T cell responses to stimulation. It is established that CD28 is up-regulated upon TcR-induced stimulation [22 ]. Thus, as expected, CD28 surface expression was enhanced upon CD3 stimulation in WT cells compared with untreated cells (Fig. 2A ). This result was further confirmed by CD28 immunoprecipitation and Western blotting, where activated WT cells showed elevated CD28 protein levels (Fig. 2A , right panel). Surprisingly, CD28 cell-surface expression as well as total protein levels of CD28 were significantly reduced in CTLA-4 transfectants after activation (Fig. 2B) . This unexpected observation implies that CTLA-4 directly or indirectly, negatively influenced the expression of CD28.


Figure 2
View larger version (22K):
[in this window]
[in a new window]

 
Figure 2. (A) CD28 is up-regulated in activated WT cells. Cell surface expression of CD28 in WT cells was assessed by flow cytometry in resting and after 24 h stimulation with immobilized anti-CD3 antibody (10 µg/ml), respectively. CD28 was immunoprecipitated with an anti-CD28 mAb (CD28.2) from 0.5 mg cell lysate of resting and CD3-stimulated WT cells. The Western blot was stained with an anti-CD28 rabbit polyclonal antibody. CD28 cell surface expression as well as protein concentration are enhanced after stimulation in WT T cells. (B) CD28 is down-regulated in CTLA-4 transfectants. Surface expression and CD28 protein concentration of CD28 were analyzed in stimulated and resting CTLA-4 transfectants as described in A. CD28 cell surface expression and protein concentration are down-regulated upon stimulation in CTLA-4 transfectants. (C) WT and CTLA-4 transfectants express equal amounts of CD28 mRNA. Resting and stimulated JM8A-4 cells (Lanes 1 and 2) and WT cells (Lanes 3 and 4, respectively) were analyzed by semiquantitative RT-PCR. There is no significant difference between the CD28 mRNA expression of WT and JM8A-4 cells. This result implies that the differences in CD28 surface and protein expression between WT and CTLA-4 transfectants are a result of post-translational processes. (D) CD28 expression is enhanced upon CD3 stimulation in HLA-B7 transfectants. Jurkat WT cells were transfected with cDNA encoding for membrane-bound HLA-B7 (JM8-B7) as control for unspecific vector effects on the expression of CD28. Surface expression of HLA-B7 was detected by flow cytometry after staining with FITC-conjugated ME.1 mAb (anti-HLA-B7/B27). HLA-B7 transfectants constitutively express HLA-B7 but do not express CTLA-4 in resting condition or after stimulation (upper panels). CD28 expression was assessed by flow cytometry and immunoprecipitation in resting and 24 h anti-CD3-stimulated JM8-B7 cells, revealing up-regulation of CD28 surface expression as well as protein concentration upon CD3 stimulation (lower panels).

To rule out the possibility that the observed down-regulation of CD28 was a result of interruption of gene transcription, a semiquantitative RT-PCR for CD28 was performed. WT and CTLA-4 mutants were stimulated for 24 h or left untreated. RNA was subsequently isolated and analyzed for CD28 expression by RT-PCR. There was no detectable difference in CD28 RNA levels between the WT and CTLA-4 transfectants in resting or activated conditions (Fig. 2C) . This result implies that the differences in CD28 surface and protein expression between WT and CTLA-4 transfectants are a result of post-translational processes, which are influenced by the expression of CTLA-4.

To rule out that the down-regulation of CD28 in CTLA-4 transfectants was a result of the transfection process, we transfected WT cells using the same plasmid as for CTLA-4 transfections but encoding for a "non-CTLA-4 molecule." The plasmid for the new cell line contained cDNA encoding for HLA-B7 (JM8-B7), as HLA-B7 is a surface molecule and therefore, easily detectable. Surface expression of HLA-B7 was detected by flow cytometry after staining with the ME.1 mAb (anti-HLA-B7 and -B27) [30 ], as shown in Figure 2D . JM8-B7 cells, as WT cells, do not express CTLA-4 in resting condition or after stimulation (Fig. 2D) .

To analyze whether JM8-B7 cells have the same characteristics as CTLA-4 transfectants regarding CD28 expression, we stimulated JM8-B7 cells with anti-CD3 for 24 h and analyzed CD28 expression by flow cytometry and immunoprecipitation. Stimulation did not lead to down-regulation of CD28, as observed in CTLA-4 transfectants. CD28 surface expression as well as its protein level were enhanced upon CD3 stimulation (Fig. 2D , lower panels). The same effect on CD28 expression was observed for WT cells (Fig. 2A) , suggesting that CD28 down-regulation is indeed promoted by CTLA-4 and not a result of unspecific effects of the vector used.

CD28 diminishes with increasing levels of CTLA-4
To substantiate the observation of CD28 down-regulation in CTLA-4high T cells, we monitored CTLA-4 and CD28 expression during TcR stimulation in CTLA-4 transfectants and WT over time. CTLA-4 transfectants were stimulated via anti-CD3 and CD28 as well as CTLA-4 expression measured from 30 min up to 24 h of activation. Comparing the total expression of CTLA-4 (left y-axis) with surface expression of CD28 (right y-axis) revealed that the decrease of CD28 surface expression correlated with increasing expression of CTLA-4 (Fig. 3A ) over a 24-h time period.


Figure 3
View larger version (22K):
[in this window]
[in a new window]

 
Figure 3. (A) CD28 down-regulation correlates with increased CTLA-4 expression. The left y-axis shows total CTLA-4 expression, and the right y-axis displays the surface expression of CD28 in CTLA-4 transfectants. The decrease of CD28 surface expression correlates with increasing expression of CTLA-4. Receptor expression was measured during anti-CD3 stimulation, beginning with 30 min after stimulation. The highest total expression of CTLA-4 was reached after 24 h of stimulation, whereas CD28 surface expression diminished over time. (B) CD28 colocalizes with CTLA-4. CD28 and CTLA-4 expression was analyzed in CD3-stimulated WT and CTLA-4 transfectants by confocal microscopy (x60 objective). Samples were immunostained with anti-CD28-FITC (green) and CTLA-4-PE (red) at 37°C for 2 h. Yellow indicates an overlay of red and green signals. CD28 appeared to costain with CTLA-4 in JM8A-4 cells.

Confocal microscopy was used to further study the expression and location of CD28 and CTLA-4 in CTLA-4 transfectants. Stimulated WT and CTLA-4 transfectants were stained with anti-CD28-FITC and anti-CTLA-4-PE at 37°C for 2 h, leading to surface staining of the receptors as well as internalization of the receptor-antibody complex. Although no CTLA-4 was detected in WT cells, CTLA-4 transfectants expressed high levels of CTLA-4 overlapping with the CD28 staining (Fig. 3B) . Each experiment was repeated at least three times.

Furthermore, to exclude the possibility that CTLA-4 has a general negative influence on T cell surface molecules that are known to be elevated upon activation, we compared the cell surface expression of CD69, CD25 (IL-2R {alpha}-chain), and CD45 on resting and CD3-stimulated WT cells and CTLA-4 transfectants. These surface markers were equally up-regulated in stimulated WT cells and in CTLA-4 transfectants (data not shown), indicating that CTLA-4 specifically influenced the expression of its competitor CD28. These data suggest that upon T cell activation, CTLA-4 specifically induces a reduction in cell-surface expression and total protein levels of CD28.

CTLA-4 promotes internalization of CD28
Cell surface receptors can be divided into two groups based on their modes of action. One group functions by internalizing bound ligands through receptor-mediated endocytosis, and the other group, which includes CD28, functions by transmitting signals across the membrane upon ligand binding [31 ]. However, many receptors of the second group also undergo internalization. Even if this internalization does not play a role in signal transduction, it may alter the biology of the receptor system by removing the receptor from the cell surface, thereby diminishing the responsiveness of the cell to the receptor ligand. Therefore, to investigate whether CD28 receptor internalization is involved in CD28 down-regulation in CTLA-4 transfectants, we studied the internalization of CD28 in WT cells and CTLA-4 transfectants by flow cytometry. Surface receptor internalization can be measured by staining the receptor with a fluorescein-conjugated antibody, which is internalized at 37°C. An internalized receptor-antibody complex can be quantified by measuring fluorescence intensity by flow cytometry. To distinguish between internalized and surface-bound antibody, surface-bound antibody can be stripped off by acetic acid. The internalized antibody/receptor complex remains unaffected after acid treatment [25 ]. This method was used to analyze internalization of CD28 and CTLA-4 in resting and stimulated WT and CTLA-4 transfectants.

Resting WT cells were stained with a FITC-conjugated anti-CD28 antibody at 4°C and subsequently stripped with acetic acid or left untreated. Acid-stripped cells were completely FITC-negative, confirming the complete removal of surface-bound antibody after acid treatment and the lack of internalization of the receptor/antibody complex at 4°C (Fig. 4A ). This result was further confirmed by confocal microscopy (Fig. 4B , upper panel), showing only surface staining of CD28 on WT cells and the removal of surface-bound antibody after acid-stripping. However, after staining of CTLA-4 transfectants with anti-CD28-PE at 37°C for 2 h and subsequent acid-stripping, the internalized antibody (red fluorescence) could not be removed (Fig. 4B , lower panel).


Figure 4
View larger version (26K):
[in this window]
[in a new window]

 
Figure 4. CTLA-4 promotes internalization of CD28. (A) Acid treatment completely removes surface-bound anti-CD28 antibody. WT cells were stained with an anti-CD28-FITC mAb at 4°C and subsequently treated with 0.2 M acetic acid solution to remove surface-bound antibody. The left panel shows anti-CD28-stained cells before acid treatment, whereas the right panel shows anti-CD28-stained cells after removal of surface antibody with acetic acid. Surface-bound antibody was removed completely by acetic acid. (B) Internalized antibody is not affected by acid treatment. WT cells were stained with an anti-CD28-FITC mAb at 4°C, acid-stripped, or left untreated as indicated, and analyzed by confocal microsopy using a x60 objective (upper panel). The surface-bound antibody was removed after acid treatment, as observed in A. To test whether internalized antibody is removed after acid treatment, CTLA-4 transfectants were stained with an anti-CD28-PE mAb at 37°C for 2 h and were left untreated or acid-stripped. The internalized antibody (red fluorescence) could not be removed by acid treatment (lower panel). (C) CD28 internalization is enhanced in CTLA-4 transfectants. The left panel shows WT cells and the right panel CTLA-4 transfectants (resting and 24 h anti-CD3-stimulated) that were stained with anti-CD28-FITC at 37°C for 2 h and subsequently acid-stripped. An acid-resistant, internalized CD28 antibody/receptor complex is shown by flow cytometry. Internalization of CD28, upon stimulation, was enhanced in CTLA-4 transfectants [mean fluorescence intensity (MFI) 18] compared with the WT (MFI 10). Both cell types display increased CD28 internalization after T cell activation compared with the resting cells (lower panel compared with upper panel). Finally, we compared the level of internalized CD28 in stimulated WT cells with that in the transfectants JM8A-4 as an overlay (D). The results show that the transfectants had a greater amount of internalized CD28 molecules. (E) CD28 internalization is partially clathrin-dependent. CTLA-4 transfectants were stimulated with anti-CD3 for 24 h. Cells were subsequently stained with anti-CD28-PE or CTLA-4-PE but additionally incubated with 0.45 M sucrose (as indicated) during the staining procedure to inhibit clathrin-dependent endocytosis. Samples were acid-stripped (accounting for internal fluorescence) or left untreated (total fluorescence). The y-axis shows the percentage of internal fluorescence, calculated as a ratio of internal to total fluorescence. CTLA-4 internalization is entirely clathrin-dependent, whereas CD28 internalization is only partly dependent on the clathrin-pathway.

To quantitate CD28 internalization, resting and CD3-stimulated WT and CTLA-4 transfectants were stained with anti-CD28-FITC at 37°C for 2 h, subsequently treated with acetic acid to remove surface-bound antibody, and analyzed by flow cytometry. Internalization of CD28, upon stimulation, was enhanced in CTLA-4 transfectants (MFI 18) compared with the WT (MFI 10), as seen in Figure 4C . This difference is further shown as an overlay in Figure 4C , showing that the transfectants had a higher level of internalized CD28.

To determine whether the observed CD28 endocytosis in CTLA-4 transfectants is clathrin-dependent, a hypertonic sucrose medium was used that perturbs the association of clathrin with AP-2 proteins and therefore, inhibits the coated pit-mediated endocytosis [32 ]. Although CD28 internalization has been described as clathrin-dependent [25 ], others have observed that CD28 does not interact with clathrin-adaptor complexes AP-1 and AP-2 [26 , 27 ]. Our data indicate that CD28 is endocytosed partially in a clathrin-dependent manner, as its internalization was reduced (lower levels of internal fluorescence) after treatment with hypertonic sucrose medium (Fig. 4E) . In contrast, CTLA-4 internalization, which is known to occur by binding of CTLA-4 to clathrin adaptor molecules AP-1 and AP-2 [33 ], was completely abrogated with hypertonic sucrose medium (Fig. 4E) . These data indicate that overexpression and internalization of CTLA-4 coincide with an increased, partially clathrin-dependent internalization of CD28.

CTLA-4 promotes ubiquitination and degradation of CD28 by the 26S proteasome
Next, we determined whether the observed reduction of CD28 protein expression in CTLA-4 transfectants is a result of ubiquitination and subsequent degradation in the 26S proteasome complex, a multisubunit protease. To address this question, we treated WT and CTLA-4 transfectants for 16 h with lactacystin, an inhibitor of the proteolytically active 20S core complex of the 26S proteasome. If CTLA-4 promotes proteasome-dependent CD28 proteolysis, the down-regulation of CD28 seen in CTLA-4 transfectants should be abrogated by blocking proteasomal degradation with lactacystin.

Figure 5A shows an immunoprecipitation of CD28 in lactacystin-treated (right four lanes) and untreated (left four lanes) WT and JM8A-4 cells. As observed above (Fig. 2B) , CD28 is down-regulated after stimulation in CTLA-4 transfectants. This effect is only seen in cells that were not treated with lactacystin (Fig. 5A , left four lanes).


Figure 5
View larger version (34K):
[in this window]
[in a new window]

 
Figure 5. CTLA-4 promotes the degradation of CD28 by the 26S proteasome. (A) Lactacystin inhibits degradation of CD28 in CTLA-4 transfectants. CD28 was immunoprecipitated (IP) from 0.5 mg cell lysate of 24 h anti-CD3-stimulated or resting WT and CTLA-4 transfectants, which were left untreated (Lanes 1–4) or were treated for 16 h (during stimulation or resting) with 2 µM lactacystin, a proteasome inhibitor (Lanes 5–8). The Western blot (WB) was stained with an anti-CD28 polyclonal antibody. CD28 is down-regulated after stimulation in CTLA-4 transfectants if not treated with lactacystin. The degradation of CD28 in CD3-stimulated CTLA-4 transfectants was entirely abrogated in cells, which were treated with lactacystin (right panel), leading to accumulation of CD28 in the cytosol. (B) CD28 is ubiquitinated in CTLA-4 transfectants. CD28 was immunoprecipitated from resting and CD3-stimulated WT cells and CTLA-4 transfectants, which were treated with 10 µM MG-132, a proteasome inhibitor, during the last 12 h of stimulation to accumulate ubiquitinated proteins. The Western blot was stained with an anti-ubiquitin mAb (upper panel) and the same membrane reprobed with polyclonal CD28 antibody (lower panel). Ubiquitination of CD28 is most significant in stimulated CTLA-4 transfectants. (C) CD28 associates with E3 ubiquitin ligase cbl. CD28 was immunoprecipitated from both resting and stimulated WT cells and CTLA-4 mutants. The Western blot was stained with anti-CD28 polyclonal antibody (bottom two panels) and the same membrane reprobed with polyclonal anti-cbl antibody (top panel), showing that cbl co-precipitated with CD28. The middle panel shows IgG heavy chain control.

Interestingly, the degradation of CD28 in CD3-stimulated CTLA-4 transfectants was entirely abrogated in cells that were treated with lactacystin. CD28 expression is not decreased but elevated after anti-CD3 stimulation in CTLA-4 transfectants (Fig. 5A , right four lanes). Thus, lactacystin treatment not only inhibited the degradation of CD28 but even led to increased protein expression of CD28 after stimulation. The enhanced expression of CD28 in CTLA-4 transfectants might be explained by accumulation of CD28 over time in the cytosol, as a result of the inhibition of proteasomal degradation during CD3 stimulation.

In addition, significant effects of lactacystin treatment were only seen in CTLA-4 mutants and not in WT cells. Therefore, this experiment indicates that the impact of proteasomal degradation is more notable in the regulation of CD28 expression in CTLA-4 transfectants than in WT cells.

To substantiate the hypothesis of enhanced CD28 degradation in CTLA-4 transfectants, we asked whether CD28 is indeed ubiquitinated after TcR stimulation. Cells were stimulated with anti-CD3 or left untreated and additionally treated with 10 µM proteasome inhibitor MG-132 during the last 12 h of stimulation to increase the level of ubiquitinated proteins. CD28 was immunoprecipitated from the cell lysate and analyzed by Western blotting. After SDS-PAGE and protein transfer, the membrane was first probed with an anti-ubiquitin antibody (Fig. 5B , upper panel) and reprobed with an anti-CD28 antibody (Fig. 5B , lower panel). The anti-CD28 staining did not indicate any degradation of CD28 in CTLA-4 transfectants, even after TcR stimulation, as a result of the inhibition of degradation by the proteasome inhibitor MG-132.

However, the ubiquitin staining clearly reveals CD28 ubiquitination in stimulated CTLA-4 transfectants (Fig. 5B , upper panel). The ubiquitin conjugation system comprises, besides the 26S proteasome, ubiquitin, ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzyme (E2), and ubiquitin ligase (E3). The E3 ubiquitin ligases are responsible for specific substrate recognition and for promoting ubiquitin ligation to the target protein, followed by degradation of the targeted protein by the 26S proteasome. Therefore, to target CD28 for proteolysis CD28 has to associate with an E3 ubiquitin ligase, and E3 ubiquitin ligase cbl has been described to play an important role in the regulation of T cell activation by ubiquitination of TcR{zeta} [34 ]. We therefore analyzed whether this E3 ligase associates with CD28 by coimmunoprecipitation of cbl with CD28 in WT and CTLA-4 transfectants before and after stimulation. Figure 5C shows that CD28 indeed associates with cbl. However, after stimulation of CTLA-4 transfectants, cbl could not be coprecipitated, probably as a result of the described degradation of CD28. These data suggest that CD28 is ubiquitinated and subsequently degraded by the 26S proteasome, presumably induced by association with E3 ubiquitin ligase cbl.

CD28 surface expression is down-regulated after stimulation of primary anergized T cells
The Jurkat cells provide an unlimited source of T cells that can be used to study molecular nechanisms of immunological reactions. However, as these cells are cell lines used in many different labs, cellular changes are possible that may differ from that in primary cells. Thus, to validate the data obtained so far in Jurkat cell lines, we evaluated CD28 and CTLA-4 surface expression in stimulated and resting anergized T cells as well as in nonanergized primary peripheral blood T cells from healthy blood donors. Multiple superantigen stimulations have been described to induce a state of unresponsiveness in superantigen-reactive T cells [28 ]. Here, primary T cells were anergized by multiple stimulations with 5 µg/ml SEB, using irradiated PBMC of the same donor as APC.

After three restimulations of PBMC with APC and SEB, cells were left untreated or were rechallenged with SEB alone and CTLA-4 as well as CD28 surface expression analyzed. CTLA-4 is already expressed in resting, anergized T cells, but its expression is enhanced even further after SEB rechallenge (Fig. 6A ). This represents a comparable phenotype with that of CTLA-4 transfectants that already express CTLA-4 in resting conditions, which is enhanced further after CD3 stimulation (Fig. 1A) . In addition, as in CTLA-4 transfectants, CD28 expression is decreased in anergized T cells upon restimulation with SEB (Fig. 6A , right panel). In contrast, naïve, primary T cells showed only weak up-regulation of CTLA-4 upon PHA stimulation, whereas CD28 was highly up-regulated (Fig. 6B) .


Figure 6
View larger version (12K):
[in this window]
[in a new window]

 
Figure 6. CD28 surface expression is reduced after stimulation of primary, anergized T cells. CD28 and CTL-4 surface expression was analyzed in stimulated and anergized T cells (A), as well as in PHA-stimulated, primary T cells (B). Multiple SEB stimulations were used to anergize PBMC. After anergization, cells were left untreated (resting) or were rechallenged (restimulated) with 5 µg/ml SEB. CTLA-4 was already highly expressed in resting, anergized T cells, but its expression was enhanced even further after SEB rechallenge, whereas CD28 expression was decreased upon restimulation (A). In contrast, PHA-stimulated T cells showed only weak up-regulation of CTLA-4 but significant up-regulation of CD28 (B).

These results indicate that CTLA-4 plays an important role in anergic T cells, and its effect on CD28 seems to depend on the expression level of CTLA-4, as slight up-regulation of CTLA-4 in activated, naïve T cells did not result in down-regulation of CD28. The results obtained with primary anergic T cells validated the observations made in the Jurkat model system, suggesting that a high expression level of CTLA-4 results in a decrease of CD28 surface expression. For these experiments, nonseparated CD4 and CD8 T cells were used. Prior experiments by Ayukawa et al. [35 ] had previously noted no differences between CTLA-4 expression in CD4+ and CD8+ T cells in a cohort of children. Finally, greater ubiquitination of CD28 was demonstrated in anergic T cells but at a lower extent in nonanergic T cells, confirming our finding that CD28 was degraded at a greater level in anergic T cells than in nonanergic cells (data not shown). Thus, we show that CTLA-4 is up-regulated in anergic T cells and correlates with lower CD28 expression, a mechanism by which T cell function could be down-regulated.


arrow
DISCUSSION
 
Besides the involvement of CTLA-4 in the induction of anergy, many studies have been initiated to analyze the possible role of CTLA-4 in the signaling pathway of T cell regulation. Thus far, three different levels of interference with an ongoing immune response have been described: competition with CD28 for the same ligands on APCs [36 ]; interference with proximal and distal TcR signals [17 , 37 ]; and most recently, the so-called "reverse signaling" to DC [38 ]. In the reverse signaling pathway model, CTLA-4 acts as a ligand for B7 on DC, resulting in signal transduction and onset of suppressive activity of DC via interference with tryptophan catabolism [39 ]. This type of reverse signaling has most recently been shown for CD28 [40 ], complicating the interactions of CD28, CTLA-4, B7-1, and B7-2 in T cell costimulation.

In the present study, we have demonstrated that high CTLA-4 expression in T cells leads to abrogation of IL-2 production, previously shown by our group as a characteristic of anergic CD8+ Jurkat T cells [29 ]. The anergic phenotype was achieved without the ligation of CTLA-4, and no significant difference was observed in tyrosine kinase phosphorylation as well as IL-2 production of activated CTLA-4 transfectants that were ligated with an anti-CTLA-4 antibody (data not shown). The high expression of CTLA-4 molecules on the cell surface of activated CTLA-4 transfectants most likely results in a close proximity of CTLA-4 receptors, therefore creating a state similar to that achieved by CTLA-4 ligation. This might explain the insignificant difference in this model between CTLA-4-expressing cells before and after CTLA-4 ligation and is consistent with the recently described CTLA-4 dimer-based lattice formation [41 ].

In this study, we describe a new characteristic of CTLA-4, its negative effect on the expression of its opponent CD28. We demonstrate that CD28 down-regulation correlates with increased expression of CTLA-4, in CTLA-4 transfectants as well as in primary, anergized T cells. The data obtained from primary anergic T cells confirm the observations by Xu et al. [28 ], which show up-regulation of CTLA-4 upon rechallenge of anergized primary T cells using soluble egg antigen as superantigen. They also report that CD28 surface expression of activated T cells is slightly up-regulated upon antigen rechallenge, whereas the surface expression of CTLA-4 in activated T cells did not change. In contrast, anergized T cells showed highly increased CTLA-4 surface expression after 60 h of rechallenge. Thus, our data and the data of Xu et al. [28] confirm the phenomenon of increasing surface expression of CTLA-4 (as observed in CTLA-4 transfectants) in a primary T cell model.

In addition, our data show that CTLA-4 promotes the internalization of CD28, possibly explaining its reduced cell surface expression. CTLA-4 might facilitate the internalization of CD28 by heterodimerization of CD28 and CTLA-4. It is known that CD28 and CTLA-4 exist as disulfide-linked, homodimeric glycoproteins [42 43 44 ]; however, it has also been suggested that both molecules can exist as monomeric proteins [45 , 46 ]. Walunas et al. [5] have shown that CTLA-4 exists on murine-activated T cells as a disulfide-linked dimer and as a nonsulfide-linked monomer. An unpaired cysteine residue that is present in the transmembrane domain of CD28 and CTLA-4 is being discussed as a possible dimerization site for CD28 and CTLA-4 monomers [47 ]. This site could also be involved in the formation of heterodimers between CTLA-4 and CD28 glycoproteins. As CTLA-4 is rapidly internalized after expression on the cell surface, this mechanism might provide an explanation about how CTLA-4 facilitates CD28 internalization.

There is published data regarding the endocytosis of CD28; however, the mechanism has not been resolved entirely. Cefai et al. [25] have shown that CD28 undergoes clathrin-dependent endocytosis, which is mediated by clathrin and its adaptor proteins AP-1 and AP-2 [48 ]. Whether CD28 is endocytosed in a clathrin-dependent manner is controversially discussed [26 , 27 ]. Our data indicate that CTLA-4-mediated CD28 endocytosis is partially clathrin-dependent, undermining the hypothesis of heterodimerization and subsequent cointernalization, which for CTLA-4, is known to be clathrin-dependent.

Ubiquitination of proteins is another way of regulating endocytosis of membrane-bound proteins. In addition to targeting them for degradation, this pathway can exercise control of protein surface expression by degradation-independent mechanisms, for example, recompartmentalization [49 ] of cellular proteins as well as endocytosis of membrane proteins [50 ]. Therefore, the clathrin-independent, ubiquitin-mediated internalization might also be involved in CD28 trafficking, as CD28 endocytosis is not entirely dependent on the clathrin pathway.

The present results suggest that CTLA-4 induction, besides leading to an anergic phenotype in T cells, appears to be involved in the regulation of CD28 expression by augmenting CD28 internalization and degradation, a previously unknown paradigm. Our data suggest that after its internalization, CD28 is ubiquitinated and subsequently degraded in the cytosol (Fig. 5) . The degradation of CD28 might occur through the lysosomal or the proteasomal pathway. The data presented above suggest that proteasome inhibitors, such as lactacystin and MG-132, can inhibit the degradation of CD28, thus favoring the proteasomal pathway. However, it has been shown previously that proteasome inhibitors can also inhibit a step in lysosomal transport [51 ]. In addition, CD28 appears to be primarily mono-ubiquitinated in primary anergic T cells, as there was no high molecular weight anti-ubiquitin staining in the CD28 immunoprecipitation of primary PBL (data not shown). Thus, the lysosomal pathway for the degradation of CD28 cannot be excluded. These findings suggest a new paradigm for negative regulation of T cells by CTLA-4—the internalization and degradation of CD28.

CTLA-4 might promote the internalization of CD28, which subsequently can associate with an E3 ubiquitin ligase, and E3 ubiquitin ligases are responsible for specific substrate recognition and for promoting ubiquitin ligation to the target protein in the cytosol, followed by degradation of the targeted protein by the 26S proteasome. CTLA-4 might function as an adaptor protein between an E3 ligase and CD28, as CD28 and CTLA-4 are selectively recruited by B7-1 and B7-2 to the immunological synapse and have been described to colocalize in lipid rafts [52 , 53 ]. This hypothesis is in agreement with the previously described, important role that E3 ubiquitin ligases play in T cell function and the development of anergy [54 55 56 ]. Therefore, to target CD28 for proteolysis, CD28 would most likely associate with an E3 ubiquitin ligase cbl, which has been described to play an important role in the regulation of T cell activation by ubiquitination of TcR{zeta} [34 ]. Therefore, we aimed to investigate whether cbl associates with CD28 by coimmunoprecipitation of both proteins. We observed that CD28 indeed associated with cbl, although weakly, by performing coimmunoprecipitations of cbl with CD28 (Fig. 5) . The interference of CTLA-4 with the ubiquitin system might play an important role in the regulation of T cell activation and T cell anergy.

The pleiotropic activities of CD28 support the potential clinical usefulness of CD28/B7 blockade in immune intervention. For example, CTLA-4-Ig, a soluble fusion protein that binds B7 molecules with greater affinity than CD28, and several CTLA-4 analogs have been shown to exert immunosuppressive effects and further proceeded to enter clinical trials, e.g., in kidney transplantation, psoriasis, and rheumatoid arthritis (reviewed by Salomon and Bluestone [12 ]). Thus, our findings could prove helpful for targeting CTLA-4 further or for the development of CTLA-4 homologues as molecules for the induction of tolerance and immunosuppression by down-regulating CD28 expression.


arrow
ACKNOWLEDGEMENTS
 
We thank Dr. Mehrdad Pedram for technical assistance with setting up the PcR. This study was supported by grants from NIH/NHLBI (RO1 HL073015), VA Merit Review, and ROTRF.

Received January 25, 2007; revised November 19, 2007; accepted December 1, 2007.


arrow
REFERENCES
 
    1
  1. Appleman, L. J., Boussiotis, V. A. (2003) T cell anergy and costimulation Immunol. Rev. 192,161-180[CrossRef][Medline]
  2. 2
  3. Linsley, P. S., Ledbetter, J., Peach, R., Bajorath, J. (1995) CD28/CTLA-4 receptor structure, binding stoichiometry and aggregation during T-cell activation Res. Immunol. 146,130-140[CrossRef][Medline]
  4. 3
  5. Krummel, M. F., Allison, J. P. (1995) CD28 and CTLA-4 have opposing effects on the response of T-cells to stimulation J. Exp. Med. 182,459-465[Abstract/Free Full Text]
  6. 4
  7. June, C. H., Bluestone, J. A., Nadler, L. M., Thompson, C. B. (1994) The B7 and CD28 receptor families Immunol. Today 15,321-331[CrossRef][Medline]
  8. 5
  9. Walunas, T. L., Lenschow, D. J., Bakker, C. Y., Linsley, P. S., Freeman, G. J., Green, J. M., Thompson, C. B., Bluestone, J. A. (1994) CTLA-4 can function as a negative regulator of T cell activation Immunity 1,405-413[CrossRef][Medline]
  10. 6
  11. Thompson, C. B., Allison, J. P. (1997) The emerging role of CTLA-4 as an immune attenuator Immunity 7,445-450[Medline]
  12. 7
  13. Bluestone, J. A. (1995) New perspectives of CD28–B7-mediated T-cell costimulation Immunity 2,555-559[CrossRef][Medline]
  14. 8
  15. Radvanyi, L. G., Shi, Y. F., Vaziri, H., Sharma, A., Dhala, R., Mills, G. B., Miller, R. G. (1996) CD28 costimulation inhibits TCR-induced apoptosis during a primary T cell response J. Immunol. 156,1788-1798[Abstract]
  16. 9
  17. Waterhouse, P., Penninger, J. M., Timms, E., Wakeham, A., Shahinian, A., Lee, K. P., Thompson, C. B., Griesser, H., Mak, T. W. (1995) Lymphoproliferative disorders with early lethality in mice deficient in CTLA-4 Science 270,985-988[Abstract/Free Full Text]
  18. 10
  19. Green, J. M., Noel, P. J., Sperling, A. I., Walunas, T. L., Gray, G. S., Bluestone, J. A., Thompson, C. B. (1994) Absence of B7-dependent responses in CD28-deficient mice Immunity 1,501-508[CrossRef][Medline]
  20. 11
  21. Shahinian, A., Pfeffer, K., Lee, K. P., Kundig, T. M., Kishihara, K., Wakeham, A., Kawai, K., Ohashi, P. S., Thompson, C. B., Mak, T. W. (1993) Differential T-cell costimulatory requirements in CD28-deficient mice Science 261,609-612[Abstract/Free Full Text]
  22. 12
  23. Salomon, B., Bluestone, J. A. (2001) Complexities of CD28/B7: CTLA-4 costimulatory pathways in autoimmunity and transplantation Annu. Rev. Immunol. 19,225-252[CrossRef][Medline]
  24. 13
  25. Carreno, B. M., Bennett, F., Chau, T. A., Ling, V., Luxenberg, D., Jussif, J., Baroja, M. L., Madrenas, J. (2000) CTLA-4 (CD152) can inhibit T cell activation by two different mechanisms depending on its level of cell surface expression J. Immunol. 165,1352-1365[Abstract/Free Full Text]
  26. 14
  27. Van der Merwe, P. A., Bodian, D. L., Daenke, S., Linsley, P., Davis, S. J. (1997) CD80 (B7–1) binds both CD28 and CTLA-4 with a low affinity and very fast kinetics J. Exp. Med. 185,393-403[Abstract/Free Full Text]
  28. 15
  29. Fallarino, F., Fields, P. E., Gajewski, T. F. (1998) B7–1 engagement of cytotoxic T lymphocyte antigen 4 inhibits T cell activation in the absence of CD28 J. Exp. Med. 188,205-210[Abstract/Free Full Text]
  30. 16
  31. Lee, K. M., Chuang, E., Griffin, M., Khattri, R., Hong, D. K., Zhang, W., Straus, D., Samelson, L. E., Thompson, C. B., Bluestone, J. A. (1998) Molecular basis of T cell inactivation by CTLA-4 Science 282,2263-2266[Abstract/Free Full Text]
  32. 17
  33. Marengere, L. E., Waterhouse, P., Duncan, G. S., Mittrucker, H. W., Feng, G. S., Mak, T. W. (1996) Regulation of T cell receptor signaling by tyrosine phosphatase SYP association with CTLA-4 Science 272,1170-1173[Abstract]
  34. 18
  35. Nakaseko, C., Miyatake, S., Iida, T., Hara, S., Abe, R., Ohno, H., Saito, Y., Saito, T. (1999) Cytotoxic T lymphocyte antigen 4 (CTLA-4) engagement delivers an inhibitory signal through the membrane-proximal region in the absence of the tyrosine motif in the cytoplasmic tail J. Exp. Med. 190,765-774[Abstract/Free Full Text]
  36. 19
  37. Schneider, H., Prasad, K. V., Shoelson, S. E., Rudd, C. E. (1995) CTLA-4 binding to the lipid kinase phosphatidylinositol 3-kinase in T cells J. Exp. Med. 181,351-355[Abstract/Free Full Text]
  38. 20
  39. Baroja, M. L., Luxenberg, D., Chau, T., Ling, V., Strathdee, C. A., Carreno, B. M., Madrenas, J. (2000) The inhibitory function of CTLA-4 does not require its tyrosine phosphorylation J. Immunol. 164,49-55[Abstract/Free Full Text]
  40. 21
  41. Alegre, M. L., Noel, P. J., Eisfelder, B. J., Chuang, E., Clark, M. R., Reiner, S. L., Thompson, C. B. (1996) Regulation of surface and intracellular expression of CTLA4 on mouse T cells J. Immunol. 157,4762-4770[Abstract]
  42. 22
  43. Lenschow, D. J., Walunas, T. L., Bluestone, J. A. (1996) CD28/B7 system of T cell costimulation Annu. Rev. Immunol. 14,233-258[CrossRef][Medline]
  44. 23
  45. Effros, R. B., Boucher, N., Porter, V., Zhu, X. M., Spaulding, C., Walford, R. L., Kronenberg, M., Cohen, D., Schachter, F. (1994) Decline in CD28(+) T-cells in centenarians and in long-term T-cell cultures—a possible cause for both in-vivo and in-vitro immunosenescence Exp. Gerontol. 29,601-609[CrossRef][Medline]
  46. 24
  47. Eck, S. C., Chang, D., Wells, A. D., Turka, L. A. (1997) Differential down-regulation of CD28 by B7–1 and B7–2 engagement Transplantation 64,1497-1499[CrossRef][Medline]
  48. 25
  49. Cefai, D., Schneider, H., Matangkasombut, O., Kang, H., Brody, J., Rudd, C. E. (1998) CD28 receptor endocytosis is targeted by mutations that disrupt phosphatidylinositol 3-kinase binding and costimulation J. Immunol. 160,2223-2230[Abstract/Free Full Text]
  50. 26
  51. Swigut, T., Shohdy, N., Skowronski, J. (2001) Mechanism for down-regulation of CD28 by Nef EMBO J. 20,1593-1604[CrossRef][Medline]
  52. 27
  53. Schneider, H., Martin, M., Agarraberes, F. A., Yin, L., Rapoport, I., Kirchhausen, T., Rudd, C. E. (1999) Cytolytic T lymphocyte-associated antigen-4 and the TCR{{zeta}}/CD3 complex, but not CD28, interact with clathrin adaptor complexes AP-1 and AP-2 J. Immunol. 163,1868-1879[Abstract/Free Full Text]
  54. 28
  55. Xu, G. L., Zhu, X. H., Guo, B., Wu, Y. Z. (2004) Involvement of CTLA-4 in T-cell anergy induced by staphylococcal enterotoxin A in vitro Mol. Immunol. 41,1-8[CrossRef][Medline]
  56. 29
  57. Welke, J., Zavazava, N. (2002) P59fyn is upregulated in anergic CD8+ T cells Hum. Immunol. 63,834-843[CrossRef][Medline]
  58. 30
  59. Ellis, S. A., Taylor, C., McMichael, A. (1982) Recognition of HLA-B27 and related antigen by a monoclonal antibody Hum. Immunol. 5,49-59[CrossRef][Medline]
  60. 31
  61. Pastan, I., Willingham, M. C. (1983) Receptor-mediated endocytosis—coated pits, receptosomes and the golgi Trends Biochem. Sci. 8,250-254[CrossRef]
  62. 32
  63. Sorkin, A., Carpenter, G. (1993) Interaction of activated EGF receptors with coated pit adaptins Science 261,612-615[Abstract/Free Full Text]
  64. 33
  65. Shiratori, T., Miyatake, S., Ohno, H., Nakaseko, C., Isono, K., Bonifacino, J. S., Saito, T. (1997) Tyrosine phosphorylation controls internalization of CTLA-4 by regulating its interaction with clathrin-associated adaptor complex AP-2 Immunity 6,583-589[CrossRef][Medline]
  66. 34
  67. Wang, H. Y., Altman, Y., Fang, D., Elly, C., Dai, Y., Shao, Y., Liu, Y. C. (2001) Cbl promotes ubiquitination of the T cell receptor {zeta} through an adaptor function of Zap-70 J. Biol. Chem. 276,26004-26011[Abstract/Free Full Text]
  68. 35
  69. Ayukawa, H., Matsubara, T., Kaneko, M., Hasegawa, M., Ichiyama, T., Furukawa, S. (2004) Expression of CTLA-4 (CD152) in peripheral blood T cells of children with influenza virus infection including encephalopathy in comparison with respiratory syncytial virus infection Clin. Exp. Immunol. 137,151-155[CrossRef][Medline]
  70. 36
  71. Sansom, D. M. (2000) CD28, CTLA-4 and their ligands: who does what and to whom? Immunology 101,169-177[CrossRef][Medline]
  72. 37
  73. Calvo, C. R., Amsen, D., Kruisbeek, A. M. (1997) Cytotoxic T lymphocyte antigen 4 (CTLA-4) interferes with extracellular signal-regulated kinase (ERK) and Jun NH2-terminal kinase (JNK) activation, but does not affect phosphorylation of T cell receptor {zeta} and ZAP70 J. Exp. Med. 186,1645-1653[Abstract/Free Full Text]
  74. 38
  75. Finger, E. B., Bluestone, J. A. (2002) When ligand becomes receptor—tolerance via B7 signaling on DCs Nat. Immunol. 3,1056-1057[CrossRef][Medline]
  76. 39
  77. Grohmann, U., Orabona, C., Fallarino, F., Vacca, C., Calcinaro, F., Falorni, A., Candeloro, P., Belladonna, M. L., Bianchi, R., Fioretti, M. C., Puccetti, P. (2002) CTLA-4-Ig regulates tryptophan catabolism in vivo Nat. Immunol. 3,1097-1101[CrossRef][Medline]
  78. 40
  79. Orabona, C., Grohmann, U., Belladonna, M. L., Fallarino, F., Vacca, C., Bianchi, R., Bozza, S., Volpi, C., Salomon, B. L., Fioretti, M. C., Romani, L., Puccetti, P. (2004) CD28 induces immunostimulatory signals in dendritic cells via CD80 and CD86 Nat. Immunol. 5,1134-1142[CrossRef][Medline]
  80. 41
  81. Darlington, P. J., Kirchhof, M. G., Criado, G., Sondhi, J., Madrenas, J. (2005) Hierarchical regulation of CTLA-4 dimer-based lattice formation and its biological relevance for T cell inactivation J. Immunol. 175,996-1004[Abstract/Free Full Text]
  82. 42
  83. June, C. H., Vandenberghe, P., Thompson, C. B. (1994) The CD28 and CTLA-4 receptor family Chem. Immunol. 59,62-90[Medline]
  84. 43
  85. Linsley, P. S., Ledbetter, J. A. (1993) The role of the CD28 receptor during T-cell responses to antigen Annu. Rev. Immunol. 11,191-212[Medline]
  86. 44
  87. Linsley, P. S., Greene, J. L., Tan, P., Bradshaw, J., Ledbetter, J. A., Anasetti, C., Damle, N. K. (1992) Coexpression and functional cooperation of CTLA-4 and CD28 on activated T lymphocytes J. Exp. Med. 176,1595-1604[Abstract/Free Full Text]
  88. 45
  89. Lindsten, T., Lee, K. P., Harris, E. S., Petryniak, B., Craighead, N., Reynolds, P. J., Lombard, D. B., Freeman, G. J., Nadler, L. M., Gray, G. S. (1993) Characterization of CTLA-4 structure and expression on human T cells J. Immunol. 151,3489-3499[Abstract]
  90. 46
  91. Lesslauer, W., Gmunder, H. (1986) Biochemical characterization of the 9.3 antigens of human T-cells—simultaneous expression of disulfide-bonded 90-kilodalton dimers and free subunits at the cell-surface Mol. Immunol. 23,271-278[CrossRef][Medline]
  92. 47
  93. Harper, K., Balzano, C., Rouvier, E., Mattei, M. G., Luciani, M. F., Golstein, P. (1991) CTLA-4 and CD28 activated lymphocyte molecules are closely related in both mouse and human as to sequence, message expression, gene structure, and chromosomal location J. Immunol. 147,1037-1044[Abstract]
  94. 48
  95. Bonifacino, J. S., Traub, L. M. (2003) Signals for sorting of transmembrane proteins to endosomes and lysosomes Annu. Rev. Biochem. 72,395-447[CrossRef][Medline]
  96. 49
  97. Fang, D., Liu, Y. C. (2001) Proteolysis-independent regulation of P13K by Cbl-b-mediated ubiquitination in T cells Nat. Immunol. 2,870-875[CrossRef][Medline]
  98. 50
  99. Govers, R., ten Broeke, T., van Kerkhof, P., Schwartz, A. L., Strous, G. J. (1999) Identification of a novel ubiquitin conjugation motif, required for ligand-induced internalization of the growth hormone receptor EMBO J. 18,28-36[Medline]
  100. 51
  101. Van Kerkhof, P., Alves dos Santos, C. M., Sachse, M., Klumpermann, J., Bu, G., Strous, G. J. (2001) Proteasome inhibitors block a late step in lysosomal transport of selected membrane but not soluble proteins Mol. Biol. Cell 12,2556-2566[Abstract/Free Full Text]
  102. 52
  103. Pentcheva-Hoang, T., Egen, J. G., Wojnoonski, K., Allison, J. P. (2004) B7–1 and B7–2 selectively recruit CTLA-4 and CD28 to the immunological synapse Immunity 21,401-413[CrossRef][Medline]
  104. 53
  105. Darlington, P. J., Baroja, M. L., Chau, T. A., Siu, E., Ling, V., Carreno, B. M., Madrenas, J. (2002) Surface cytotoxic T lymphocyte-associated antigen 4 partitions within lipid rafts and relocates to the immunological synapse under conditions of inhibition of T cell activation J. Exp. Med. 195,1337-1347[Abstract/Free Full Text]
  106. 54
  107. Anandasabapathy, N., Ford, G. S., Bloom, D., Holness, C., Paragas, V., Seroogy, C., Skrenta, H., Hollenhorst, M., Fathman, C. G., Soares, L. (2003) GRAIL: an E3 ubiquitin ligase that inhibits cytokine gene transcription is expressed in anergic CD4(+) T cells Immunity 18,535-547[CrossRef][Medline]
  108. 55
  109. Bachmaier, K., Krawczyk, C., Kozieradzki, I., Kong, Y. Y., Sasaki, T., Oliveira-dos-Santos, A., Mariathasan, S., Bouchard, D., Wakeham, A., Itie, A., Le, J., Ohashi, P. S., Sarosi, I., Nishina, H., Lipkowitz, S., Penninger, J. M. (2000) Negative regulation of lymphocyte activation and autoimmunity by the molecular adaptor Cbl-b Nature 403,211-216[CrossRef][Medline]
  110. 56
  111. Chiang, Y. J., Kole, H. K., Brown, K., Naramura, M., Fukuhara, S., Hu, R. J., Jang, I. K., Gutkind, J. S., Shevach, E., Gu, H. (2000) Cbl-b regulates the CD28 dependence of T-cell activation Nature 403,216-220[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
N. Perez, S. Karumuthil-Melethil, R. Li, B. S. Prabhakar, M. J. Holterman, and C. Vasu
Preferential Costimulation by CD80 Results in IL-10-Dependent TGF-{beta}1+-Adaptive Regulatory T Cell Generation
J. Immunol., May 15, 2008; 180(10): 6566 - 6576.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0107065v1
83/4/853    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Berg, M.
Right arrow Articles by Zavazava, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Berg, M.
Right arrow Articles by Zavazava, N.