PeproTech Inc.
Originally published online as doi:10.1189/jlb.0707481 on November 30, 2007

Published online before print November 30, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0707481v1
83/3/774    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mian, M. F.
Right arrow Articles by Ashkar, A. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mian, M. F.
Right arrow Articles by Ashkar, A. A.
(Journal of Leukocyte Biology. 2008;83:774-784.)
© 2008 by Society for Leukocyte Biology

Impairment of human NK cell cytotoxic activity and cytokine release by cigarette smoke

M. Firoz Mian*, Nicole M. Lauzon*, Martin R. Stämpfli*,{dagger}, Karen L. Mossman*,{ddagger} and Ali A. Ashkar*,1

* Departments of Pathology and Molecular Medicine, Centre for Gene Therapeutics,
{dagger} Medicine, and
{ddagger} Biochemistry and Biomedical Sciences, McMaster University, Hamilton, Ontario, Canada

1Correspondence: Centre for Gene Therapeutics, Department of Pathology and Molecular Medicine, McMaster University Health Sciences Centre, 1200 Main Street West, Hamilton, Ontario, L8N 3Z5, Canada. E-mail: ashkara{at}mcmaster.ca

ABSTRACT

NK cells play essential roles in innate host defense against microbial infections and tumor surveillance. Although evidence suggests that smoking has adverse effects on the immune system, little is known about whether smoking compromises NK cell effector functions. In this study, we show that cigarette smoke-conditioned medium (SCM) dose-dependently inhibits in vitro IFN-{gamma} production by polyinosinic:polycytidylic acid (poly I:C)-activated PBMC and NK cells isolated from nonsmoking individuals. Similarly, SCM attenuated poly I:C-induced TNF-{alpha} production by PBMC and NK cells. The inhibitory effect of cigarette smoke on TNF-{alpha} production was reversible. PBMC and NK cells isolated from smokers displayed significant reduction of IFN-{gamma} and TNF-{alpha} secretions compared with nonsmokers in response to poly I:C activation. We further observed that SCM attenuated NK cell cytotoxic activity, which was associated with decreased up-regulation of perforin expression. Attenuated cytotoxic activity was also observed in PBMCs isolated from smokers. Finally, anti-IL-12 mAb-blocking data revealed that an attenuation of IFN-{gamma} production by PBMC was indirect, likely via attenuation of IL-12 production, and the effect on NK cells was IL-12-independent. Our data indicate that cigarette smoke compromises function of human NK cells. This may contribute to a higher incidence of viral infections and cancer among smokers.

Key Words: smoker • PBMCs • poly I:C • viral • innate immunity

INTRODUCTION

Cigarette smoking has long been known as a major health risk factor implicated in higher incidences of heart disease, cancer, and chronic obstructive pulmonary disease (COPD) [1 , 2 ]. It has been suggested as early as 1960 that the increased prevalence of smoking-related diseases may, in part, be a result of tobacco smoke-induced changes in immune and inflammatory processes [3 ]. Cigarette smoke suppresses alveolar macrophage and T cell function [4 , 5 ]. More recently, it was shown that nicotine has immunosuppressive effects on dendritic cell (DC) function and that mice exposed to mainstream smoke have reduced numbers of DCs within their lungs [6 ]. Although cigarette smoke suppresses NK cell function in mice [7 ], the clinical data are controversial. It has been reported that NK killing ability is reduced [8 , 9 ], enhanced (10), or remains unaffected by cigarette smoke [11 ] in human subjects.

NK cells are a vital part of the innate immune system and play an essential role against microbial infections and tumor surveillance through rapidly secreting an array of cytokines including IFN-{gamma} and TNF-{alpha} and by cytolysis of infected or transformed cells [8 9 10 ]. NK cells, by virtue of their ability to produce IFN-{gamma}, provide innate resistance to a variety of intracellular pathogens prior to the development of adaptive immune responses. NK cells sense invading pathogens through a family of TLRs, which are capable of recognizing distinct molecular components in microbes [11 , 12 ]. TLR-3 binds dsRNA [13 ], a product of viral replication, and its synthetic mimic polyinosinic:polycytidylic acid (poly I:C). In NK cells, stimulation of TLR-3 leads to the production of IFN-{gamma} and enhances cytotoxic activities [14 15 16 17 ]. It is widely accepted that IL-12 produced by APCs in response to infection or external stimuli regulates NK cell IFN-{gamma} release as well as cytotoxicity [18 , 19 ].

The present study was initiated to investigate the impact of cigarette smoke on NK cell function upon poly I:C activation. We show for the first time that cigarette smoke inhibits IFN-{gamma} production in poly I:C-activated human NK cells and significantly attenuates NK cell cytolytic activity. Given the importance of NK cells to innate antiviral host defense, attenuated NK cell function may contribute to the increased risk of respiratory infections in smokers.

MATERIALS AND METHODS

NK cell isolation
PBMCs were isolated from nonsmoking volunteers and asymptomatic smokers (>10 cigarettes/day) by Ficoll-PaqueTM Plus (Amersham-Pharmacia Biotech, Baie d’Urfe, Quebec, Canada) density gradient centrifugation. NK/NKT cells were then purified from PBMC using Stem Cell (Vancouver, BC, Canada) EasySep human CD56 positive-selection kit, according to the manufacturer’s protocol. Cells obtained from the flow-through of PBMC after purifying NK/NKT cells were used as NK/NKT-depleted PBMC. The purity of NK cells obtained was ~92% CD56+CD3, as verified by flow cytometry.

Preparation of smoke-conditioned medium (SCM)
Cigarette SCM was prepared according to a protocol that has previously been described in detail [20 ]. Specifically, cigarette smoke from two research-grade cigarettes (1R3, Tobacco and Health Research Institute, University of Kentucky, Lexington, KY, USA) was bubbled through 8 ml 10% complete RPMI-1640 medium at a rate of 35 ml in 2 s, with a pause in every 28 s. The SCM was then filtered through 0.2 µm pore filter and considered 100% SCM. Fresh SCM was prepared for every experiment.

Cell culture, treatments, and cytokine measurements by ELISA
To examine the in vitro effects of cigarette smoke on NK cell function, isolated PBMC and NK cells were treated with the indicated concentrations of SCM for the defined times. PBMC and NK cells were cultured in RPMI 1640 containing 10% FBS, 2 mM L-glutamine, 1 mM HEPES, 0.05 mM β-ME, penicillin and streptomycin, and 50 u/ml recombinant human (rh)IL-2 (Genzyme Diagnostics, Cambridge, MA, USA; for NK cells only) and unstimulated or activated with 10 ug/ml poly I:C (Sigma, Oakville, Ontario, Canada) at 37°C in 5% CO2 for the times indicated in the experiment. The human NK-92 cell line was obtained from American Type Culture Collection (Manassas, VA, USA) and was cultured in {alpha}-MEM containing 20% FBS, 2 mM L-glutamine, 100 U/ml penicillin, 100 ug/ml streptomycin, 1% nonessential amino acids, 5 x 10–5 β-ME, and 25 U/ml rhIL-2. For certain experiments, NK cells and PBMCs were treated with anti-human-IL-12 mAb (0.5–1 ug/ml, R&D Systems, Minneapolis, MN, USA), as mentioned in the figure legends. Culture supernatants were harvested at 24 h for TNF-{alpha}, IL-6, IL-8, and IL-12p40 and at 24, 48, and 72 h for IFN-{gamma} analyses and were stored at –80°C until further use. IFN-{gamma}, TNF-{alpha}, IL-6, IL-8, and IL-12p40 cytokines were measured by ELISA (R&D Systems) following the manufacturer’s instructions.

Cell viability assay
PBMCs were treated with different concentrations of SCM for the indicated times (see Fig. 2A 2B 2C ) and were cultured up to 72 h. Viability was assessed by the standard trypan blue dye exclusion method. To confirm if cigarette smoke has any effect on the metabolic activation status of cells, we performed a MTT (Sigma) assay according to the method described my Mosmann [21 ]. Briefly, cells were untreated or treated with SCM and seeded (105 cells/100 ul in each well) in 96-well plates and were incubated at 37°C for 24, 48, and 72 h and then reacted with 20 ul 5mg/ml MTT at 37°C for 4 h. Acid isopropanol (100 ul 0.04 N HCl in isopropanol) was then added to all wells and mixed thoroughly, and the plates were read in an ELISA reader at 570 nm wavelength with a reference wavelength of 630 nm. Cell survival was calculated as the following formula: Cell survival (%) = 100 – [1–(absorbance of treated cells/absorbance of control cells)x100].


Figure 2
View larger version (32K):
[in this window]
[in a new window]

 
Figure 2. Cigarette smoke does not affect cell viability. (A) PBMCs isolated from nonsmoking individuals were placed in varying concentrations of SCM (0.05–2%) for 2 h and then stimulated with poly I:C for 24, 48, and 72 h. Cell viability was assessed using trypan blue dye exclusion. Results are expressed as mean ± SEM of three independent experiments performed in triplicate. (B) SCM-treated or control PBMCs (1x106/ml) were cultured in 96-well plates for 24, 48, and 78 h, and a MTT assay was performed. Data represent the mean values and SD of triplicate samples. (C) PBMCs isolated from nonsmoking volunteers placed in 1% SCM as well as PBMCs from smokers were stimulated with poly I:C for 6 h. The extracted RNA was analyzed by RT-PCR for TLR-3, RIG-I, and 18S rRNA expression. These data are representative of one out of at least three independent experiments.

RNA isolation and RT-PCR
Total RNA was isolated from PBMCs (smokers, SCM-treated, and control), unstimulated or stimulated with poly I:C (10 µg/ml) for 6 h using the TRIzol reagent, according to the manufacturer (Invitrogen, Burlington, Canada). Isolated RNA was treated with RNase-free DNase (Ambion, Streetsville, Ontario, Canada) for 30 min at 37°C. RT was performed using the Mulroney murine leukemia virus RT following the manufacturer’s instruction (Invitrogen). PCR was performed with PCR supermix (Invitrogen)-contained Taq DNA polymerase. The primer pairs used for PCR analyses were as follows: TLR-3, forward CCCTTGCCTCACTCCCC and reverse CCTCTCCATTCCTGGCCT; retinoic acid-inducible gene I (RIG-I), forward GCATATTGACTGGACGTGGCA and reverse CAGTCATGGCTGCAGTTCTGTC; 18S rRNA, forward GCATTCGTATTGCGCCGCTA and reverse AGCTGCCCGGCGGGTC.

51Cr release cytotoxicity assay
PBMC and NK cells, SCM-treated or untreated, were cultured alone or in the presence of poly I:C (10 ug/ml) at 37°C in 5% CO2 for 48 h. Viable PBMC and NK cells were counted using the trypan blue dye exclusion method, and viable cells were used as effectors at different E:T ratios. K562 target cells were prelabeled with 51Cr (1 µCi/104 cells) and were incubated at 37°C in 5% CO2 for 1 h. The labeled target cells were then washed and cocultured with the effector cells in round-bottom plates in triplicate at indicated E:T cell ratios for 4 h. The supernatants were then obtained, and radioactivity was counted with a {gamma}-counter (Perkin Elmer, Wellesley, MA, USA). The percent-specific chromium release was calculated using the following equation: % Specific release = (experimental release-spontaneous release)/(maximum release-spontaneous release) x 100%.

Detection of IFN-{gamma} and perforin by intracellular staining
The following antibodies were obtained and used for flow cytometry: anti-human PE-CD56 (BD Biosciences, San Jose, CA, USA), anti-human FITC-CD3, anti-human IFN-{gamma}-APC-conjugated (BD PharMingen, San Diego, CA, USA), and anti-human perforin-FITC-conjugated (BD PharMingen). SCM-treated or control PBMC and NK cells were cultured with or without poly I:C stimulation at 37°C for 24 h and 48 h for IFN-{gamma} and perforin, respectively. For IFN-{gamma} intracellular staining, cells were treated with a Golgi plug (BD PharMingen; 1 µg/ml) at 16 h of poly I:C stimulations and placed at 37°C for 4–6 h. Cells were then harvested, washed, and surface-stained with CD56-PE or CD3-FITC for 30 min. After washing, cells were fixed in BD Biosciences Cytofix buffer for 20 min on ice in the dark. Cells were then permeabilized with BD Biosciences Cytoperm buffer and anti-IFN-{gamma}-APC, and anti-perforin-FITC mAb were added to the cells and incubated for an additional 30 min on ice. Cells were then washed twice with BD Biosciences Cytoperm buffer and resuspended in a total volume of 300 µl FACS buffer (1% paraformaldehyde in PBS supplemented with 0.2% BSA) for analysis. Forward-scatter, side-scatter, and fluorescence data were collected on a FACS LSR II flow cytometer (BD Biosciences) and analyzed with the FlowJo software Version 2.0 (Tree Star Inc., Ashland, OR, USA).

Statistical analysis
Data were analyzed using Graph Pad Prism software (San Diego, CA, USA). Statistical significance was determined using a Student’s t-test, and P < 0.05 was considered statistically significant.

RESULTS

Cigarette smoke inhibits IFN-{gamma} production by poly I:C-activated PBMC in a time- and dose-dependent manner
To determine the effects of cigarette smoke on human PBMC function, we isolated PBMCs from nonsmoking volunteers. Cells were placed in 2% SCM for 2 h, washed, and stimulated with poly I:C for 48 h. IFN-{gamma} production was assessed in cell culture supernatants by ELISA. As shown in Figure 1A , cigarette smoke abrogated poly I:C-induced IFN-{gamma} secretion compared with control PBMCs. The inhibition of IFN-{gamma} production by cigarette smoke was dose-dependent (Fig. 1B) ; IFN-{gamma} production was abrogated at a concentration of ≥0.5% SCM. Furthermore, even short exposures to cigarette smoke inhibited IFN-{gamma} production (Fig. 1C) . poly I:C-induced IFN-{gamma} production was almost completely inhibited in PBMC placed in 2% SCM for 5 min. Based on these findings, cells were placed in 1% SCM for 30 min for all subsequent experiments.


Figure 1
View larger version (17K):
[in this window]
[in a new window]

 
Figure 1. Cigarette smoke inhibits poly I:C-stimulated IFN-{gamma} production by human PBMC. (A) PBMCs from healthy, nonsmoking volunteers were cultured in 2% SCM for 2 h, washed, and stimulated with poly I:C. Data show IFN-{gamma} levels in cell supernatants; ***, P < 0.001. (B) PBMCs from healthy, nonsmoking volunteers were placed in 0.05–2% SCM for 2 h, washed, and stimulated with poly I:C. Supernatants were harvested at 48 h and assayed for IFN-{gamma} production. (C) PBMCs from nonsmoking volunteers were placed in 2% SCM for 5–120 min, washed, and stimulated with poly I:C. Cell supernatants were harvested at 48 h and analyzed for IFN-{gamma} production. Data are expressed as mean ± SEM of three experiments conducted in triplicate.

Cigarette smoke inhibits IFN-{gamma} production by PBMCs without any loss of cell viability
As cigarette smoke significantly inhibited IFN-{gamma} production, we next examined whether SCM affects the viability of PBMCs, which were isolated from nonsmoking volunteers and placed in SCM (0.05–2%) for 2 h. Subsequently, cells were washed and stimulated with poly I:C for 24, 48, or 72 h, respectively. The viability of PBMCs remained unaffected in culture at all doses of SCM tested (Fig. 2A ), suggesting that inhibition of IFN-{gamma} production by PBMCs is not a result of toxic effects that impact cell viability. To ascertain if cigarette smoke could have any effect on the metabolic activity of the cells, we performed a MTT assay, which detects only active mitochondria enzymes, and the reaction occurs only in living cells. Our MTT assay (Fig. 2B) clearly showed that cigarette smoke did not affect mitochondrial activity of PBMCs. We further examined the mRNA levels of TLR-3 and RIG-I in SCM-treated, smokers and control PBMCs to investigate if cigarette smoke has any effect on their expression. As shown in Figure 2C , mRNA expression of TLR-3 and RIG-I remained unaffected for SCM-treated and smokers’ PBMCs compared with control PBMCs upon poly I:C stimulation or an unstimulated condition.

Cigarette smoke inhibits IFN-{gamma} production in vitro and ex vivo by poly I:C-induced PBMCs and NK cells
To determine whether cigarette smoke suppresses the production of IFN-{gamma} by NK cells, these cells were purified from the peripheral blood of nonsmoking volunteers. Purified NK cells or total PBMCs were placed in 1% SCM for 30 min, washed, and stimulated with poly I:C for 24–72 h. Cultures of purified NK cells were supplemented by 50 U/ml rhIL-2. We observed that cigarette smoke blocked the production of IFN-{gamma} by PBMCs (Fig. 3A ) as well as purified NK cells (Fig. 3B) , whereas poly I:C-treated control cells showed elevated levels of IFN-{gamma} production. In a separate set of experiments, PBMCs and NK cells isolated from smokers and nonsmokers were placed in culture and stimulated with poly I:C. Purified NK cells were supplemented with 50 U/ml rhIL-2. We observed significantly decreased IFN-{gamma} production in poly I:C-stimulated PBMC (Fig. 3C) and NK cells (Fig. 3D) harvested from smokers compared with nonsmokers. To confirm that cigarette smoke can act directly on human NK cells, we used a human NK cell line (NK-92). Cigarette smoke significantly inhibited poly I:C-induced IFN-{gamma} production by human NK-92 cells (Fig. 3E) .


Figure 3
View larger version (23K):
[in this window]
[in a new window]

 
Figure 3. Cigarette smoke inhibits IFN-{gamma} production by human NK cells in vitro and ex vivo. (A) PBMCs were isolated from nonsmoking volunteers (n=6). Cells were placed in 1% SCM for 30 min and stimulated with poly I:C. IFN-{gamma} production was assessed in culture supernatants. (B) Purified NK cells were placed in 1% SCM, washed, and stimulated with poly I:C and rhIL-2 for 72 h, following which supernatants were harvested for IFN-{gamma} measurements. (C) PBMCs were isolated from asymptomatic smokers (n=6) and nonsmokers (n=6) and stimulated with poly I:C (10 ug/ml). IFN-{gamma} was assessed in cell supernatants. (D) NK cells were purified from PBMCs of healthy smokers and nonsmokers. Cells were cultured in medium containing rhIL-2 (50 U/ml) and stimulated with poly I:C. IFN-{gamma} production was assayed in cell supernatants. Data represent mean ± SEM of six experiments performed in triplicate. (E) NK-92 cells were similarly treated with SCM and stimulated with poly I:C for 24 h, and IFN-{gamma} was measured by ELISA. Data indicate mean and SEM of three independent experiments. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

NK cells are the predominant source of IFN-{gamma} when activated with poly I:C
To determine the cellular source of IFN-{gamma} following poly I:C activation of PBMCs, we purified NK cells from PBMCs using a CD56-positive selection kit that copurifies NK and NKT cells. PBMCs, purified NK/NKT cells, and NK/NKT-depleted PBMC populations were analyzed by flow cytometry. Figure 4A (middle panel) shows that the NK/NKT-depleted PBMCs had a low population of NK/NKT cells (~1.9%). To confirm that NK cells are the major producers of early IFN-{gamma}, we cultured the above three cell populations separately in the presence of poly I:C, and cell supernatants were tested for IFN-{gamma}. This revealed that NK/NKT-depleted PBMCs produced only negligible amounts of IFN-{gamma} compared with purified NK/NKT cells or whole PBMCs (Fig. 4B) . This observation demonstrates that NK cells are the main source of IFN-{gamma} in PBMC. We further performed intracellular cytokine staining of purified NK/NKT cells for IFN-{gamma}, which revealed that poly I:C stimulation significantly enhanced IFN-{gamma} levels (Fig. 4C , middle panel) compared with the unstimulated NK/NKT cells. IFN-{gamma}-producing, CD56-positive cells were then gated to distinguish NK (CD56+CD3–) and NKT (CD56+CD3+) population subsets. Interestingly, we observed that almost the entire amount of IFN-{gamma} (93%) was secreted by poly I:C-stimulated CD56+CD3– (NK) cells, and only trace amounts (~1.7%) were secreted from CD56+CD3+ (NKT) cells (Fig. 4C) .


Figure 4
View larger version (37K):
[in this window]
[in a new window]

 
Figure 4. NK cells are the main producers of IFN-{gamma}. (A) PBMCs, purified NK/NKT cells, and NK-depleted PBMCs were stained for CD56 and CD3 and analyzed by flow cytometry. Data show dot-plots of CD56+ and CD3+ cells. One of the three experiments is shown. (B) Purified NK/NKT cells, whole PBMCs, and NK-depleted PBMCs were cultured in medium alone or stimulated with poly I:C for 48 h. Cell supernatants were tested for IFN-{gamma} by ELISA. Data expressed are mean ± SEM, n = 3. (C) Purified NK/NKT cells were grown in medium alone or with poly I:C for 16 h. Production of IFN-{gamma} was assessed by intracellular flow staining. Positive lymphocytes were gated for CD56+CD3– and CD56+CD3+ populations to identify the cell types contributing to IFN-{gamma} secretion. One of three experiments performed is shown.

Cigarette smoke reduces TNF-{alpha} production in human PBMCs and NK cells
The TLR-3 ligand poly I:C has been known to induce significant production of TNF-{alpha} by human PBMCs and NK cells. We therefore sought to determine if cigarette smoke has an effect on poly I:C-induced TNF-{alpha} production by PBMCs and NK cells. PBMCs were isolated from nonsmoking individuals and were placed in 1% SCM for 30 min. Subsequently, cells were stimulated with 10 ug/ml poly I:C for 24 h. Figure 5A shows that cigarette smoke significantly attenuated TNF-{alpha} production by PBMCs. Similarly, we observed a reduction of TNF-{alpha} by purified NK cells (Fig. 5B) . We then assessed TNF-{alpha} production by PBMCs and NK cells isolated from smokers and nonsmokers to investigate the in vivo effects of cigarette smoke on TNF-{alpha} production. We observed significantly decreased TNF-{alpha} production in PMBCs (Fig. 5C) and NK cells (Fig. 5D) isolated from smokers compared with nonsmokers following stimulation with poly I:C.


Figure 5
View larger version (22K):
[in this window]
[in a new window]

 
Figure 5. Cigarette smoke reduces TNF-{alpha} production in human PBMC and NK cells. (A) PBMCs were isolated from nonsmoking individuals and placed in 1% SCM for 30 min. Cells were washed and stimulated with poly I:C. TNF-{alpha} production was assessed in cell supernatants (24 h). (B) Purified NK cells from nonsmoking volunteers were placed in 1% SCM for 30 min, washed, and stimulated with poly I:C. (C) PBMCs from smoking or nonsmoking volunteers were stimulated with poly I:C or left untreated for 24 h. Cell supernatants were assayed for TNF-{alpha}. (D) Purifed NK cells from smoking or nonsmoking volunteers were stimulated with poly I:C for 24 h, and supernatants were assayed for TNF-{alpha} production. Data represent mean ± SEM; n = 6; **, P < 0.01; ***, P < 0.001.

The effects of cigarette smoke on TNF-{alpha} secretion by PBMC and NK cells are reversible
There is no information currently available about whether the influence of cigarette smoke on cytokine secretion by PBMCs or NK cells is reversible or irreversible. To address this, we treated PBMCs and NK cells with SCM for 30 min. Following removal of SCM, cells were washed extensively, and poly I:C was added at the indicated time-points post-SCM treatment. As depicted in Figure 6A and 6B , although SCM decreased the level of poly I:C-mediated TNF-{alpha} secretion compared with untreated controls when poly I:C was added 0 h or 24 h post-SCM treatment, there was no significant difference in the level of poly I:C-induced TNF-{alpha} between SCM-treated and control cells when poly I:C was added 48 h post-SCM treatment (Fig. 6A and 6B) . These results reveal that the effect of cigarette smoke on TNF-{alpha} production is reversible.


Figure 6
View larger version (21K):
[in this window]
[in a new window]

 
Figure 6. The effect of cigarette smoke on TNF-{alpha} is reversible. (A) PBMCs from nonsmoking individuals were untreated or treated with 1% SCM for 30 min, washed, and treated with poly I:C at 0 h, 24 h, and 48 h post-SCM treatment. Cell supernatants were harvested after 24 h of poly I:C stimulation and analyzed for TNF-{alpha} production. (B) Purified NK cells from nonsmoking individuals were treated similarly as in Figure 4A , and culture supernatants were harvested at 24 h and assayed for TNF-{alpha}. Results expressed are mean ± SEM of three experiments done in triplicate. UD, undetectable.

Effects of cigarette smoke on IL-6 and IL-8 secretions by PBMC upon poly I:C induction
To examine if cigarette smoke has an effect on IL-6 and IL-8 production by poly I:C-stimulated PBMCs, we isolated PBMCs from nonsmoking volunteers and were placed in 1% SCM for 30 min and subsequently stimulated with poly I:C (10 ug/ml) for 24 h. As shown in Figure 7 , cigarette smoke had no obvious effect on IL-6 secretion (Fig. 7A) ; however, IL-8 production was markedly reduced (Fig. 7C) . We then examined the IL-6 and IL-8 production by PBMCs isolated from smokers and nonsmokers to assess the effects of cigarette smoke under in vivo condition. We observed no significant reduction of IL-6 (Fig. 7B) or IL-8 (Fig. 7D) secretions by PBMCs isolated from smokers compared with nonsmokers upon poly I:C induction.


Figure 7
View larger version (28K):
[in this window]
[in a new window]

 
Figure 7. Effects of cigarette smoke on IL-6 and IL-8 production. PBMCs isolated from nonsmoking individuals and treated with 1% SCM for 30 min as well as PBMCs isolated from smokers were stimulated with poly I:C (10 ug/ml) for 24 h. Cell-free supernatants were then harvested and analyzed for IL-6 (A and B) and IL-8 (C and D) production by ELISA. Results expressed are mean ± SEM of three experiments done in triplicate. ns, Not significant; *, P < 0.05.

Cigarette smoke attenuates poly I:C-induced NK cell cytotoxic activities and perforin expression
NK cells are cytotoxic effector cells that confer innate protection against viral infections [9 ]. Their cytolytic ability is up-regulated in freshly isolated human NK cells following stimulation with poly I:C [14 15 16 ]. Here, we investigated the impact of cigarette smoke on the cytotoxic ability of poly I:C-activated NK cells. Freshly isolated PBMCs from nonsmokers were placed in 1% SCM for 30 min and then stimulated with poly I:C (10 ug/ml) for 48 h. Cytolytic activity was assessed in a standard chromium release assay using K562 cells as targets at E:T cell ratios of 50:1, 25:1, and 12.5:1 for 4 h. As depicted in Figure 8A , cigarette smoke significantly decreased PBMCs cytotoxicity at all E:T ratios. A similar trend in reduction of cytotoxic ability was observed in PBMC isolated from smokers (Fig. 8B) . Finally, we assayed the killing ability of purified NK cells and found that cigarette smoke-treated NK cells displayed significantly decreased cytotoxic activity compared with untreated NK cells (Fig. 8C) .


Figure 8
View larger version (39K):
[in this window]
[in a new window]

 
Figure 8. Cigarette smoke attenuates poly I:C-induced NK cytotoxic activities. (A) Freshly isolated PBMCs from healthy nonsmokers were placed in 1% SCM for 30 min and stimulated with poly I:C (10 ug/ml) for 48 h. Cells were then cocultured with 51Cr-labeled K562 tumor cells at E:T cell ratios of 50:1, 25:1, and 12.5:1 for 4 h. (B) Positively selected, purified NK cells from nonsmoking volunteers were pretreated with SCM and cultured with or without poly I:C for 48 h and then challenged against 51Cr-labeled K562 cells at E:T cell ratios of 50:1, 25:1, and 12.5:1 for 4 h. (C) PBMCs isolated from asymptomatic smokers and nonsmoking volunteers were stimulated with poly I:C for 48 h, followed by coculture with 51Cr-labeled K562 tumor cells at E:T cell ratios of 5:1, 2.5:1, and 1:1 for 4 h. Cytolytic ability of NK cells was measured by a {gamma}-counter. Data represent mean ± SEM of three independent experiments done in triplicate. (D) Purified NK/NKT cells were untreated or SCM-treated and then cultured with or without poly I:C for 48 h. Perforin expression by CD56+ NK/NKT cells was assessed by flow cytometry. Data represent one out of three independent experiments. (E) The cumulative data of three repeated experiments of D. Results expressed are mean ± SEM of three experiments done in triplicate; *, P < 0.05.

Perforin, a cytoplasmic granular protein, has been known to be involved in NK cytotoxicity. We therefore used flow cytometry to evaluate the expression levels of perforin in SCM-treated NK cells compared with control cells. We observed that poly I:C stimulation failed to up-regulate perforin expression in SCM-treated NK cells compared with higher levels of perforin expression observed in control NK cells (Fig. 8D and 8E) .

Cigarette smoke inhibits IL-12 secretion by poly I:C-stimulated PBMCs
IL-12 is secreted by APCs upon activation by TLR-3 agonists and mediates NK cell IFN-{gamma} production and cytotoxicity [16 , 18 ]. To determine whether cigarette smoke influences the production of IL-12 by poly I:C-activated APCs, we pretreated PBMCs with SCM and then stimulated with poly I:C. Interestingly, SCM-treated PBMCs failed to produce IL-12 upon poly I:C induction, in contrast to the control PBMCs, which produced high amounts of IL-12 (Fig. 9A ). We further examined PBMCs isolated from smoking individuals to evaluate the in vivo effects of cigarette smoke on IL-12 production. poly I:C-activated PBMCs from smokers produced less IL-12 compared with nonsmokers (Fig. 9B) . To determine whether the blockade of IL-12 production could influence IFN-{gamma} production, PBMCs were pretreated with anti-IL-12 mAb and then stimulated with poly I:C. Neutralization of IL-12 in PBMCs blocked IFN-{gamma} secretion (Fig. 9C) at a comparable level of that observed with SCM-treated PBMCs, suggesting that cigarette smoke-induced inhibition of IFN-{gamma} in PBMCs resulted from blocking of IL-12 secretion.


Figure 9
View larger version (19K):
[in this window]
[in a new window]

 
Figure 9. The effects of cigarette smoke on IL-12. (A) Freshly isolated PBMCs from nonsmoking individuals were placed in 1% SCM for 30 min and stimulated with poly I:C for 24 h. Cell supernatants were collected and assayed for IL-12p40 by ELISA. (B) PBMCs from smoking and nonsmoking volunteers were stimulated with poly I:C for 24 h, and cell supernatants were harvested and assayed for IL-12p40 production. (C) Freshly isolated PBMCs from nonsmoking individuals were untreated or preincubated with anti-human IL-12 mAb for 1 h at 37°C, followed by poly I:C stimulation for 24 h. Cell supernatants were then measured for IFN-{gamma} production. Data (A–C) represent mean ± SEM of five independent experiments performed in triplicate. (D) Purified NK cells and PBMCs from nonsmoking volunteers were cultured in medium alone or in the presence of poly I:C. Cell supernatants (24 h) were assayed for IL-12p40 production. (E) NK/NKT cells purified from healthy, nonsmoker volunteers were preincubated with anti-IL-12 mAb at 37°C for 1 h or left untreated and then cultured alone or in the presence of poly I:C. Cell supernatants harvested at 48 and 72 h were assayed by ELISA for IFN-{gamma} production. Results (C and D) expressed are mean ± SEM of three independent experiments done in triplicate.

To ascertain whether cigarette smoke can directly inhibit IFN-{gamma} production by NK cells, we measured IL-12 production in purified NK/NKT cells cultured with poly I:C. We also pretreated NK/NKT cells with anti-IL-12 mAb and stimulated with poly I:C. Our data showed that purified NK cells did not produce any detectable amount of IL-12 upon poly I:C stimulation (Fig. 9D) . Moreover, neutralization of NK cells with anti-IL-12 mAb and subsequent induction with poly I:C did not result in any noticeable reduction of IFN-{gamma} levels compared with the poly I:C-treated control cells (Fig. 9E) .

DISCUSSION

Cigarette smoke has been shown to compromise a wide range of immunological events, including innate and adaptive immune responses [1 ]. The impact of cigarette smoke on human NK cell function and the underlining mechanism(s) remain poorly understood. The focus of the current study was to investigate how cigarette smoke affects cytokine production and cytotoxic activity by NK cells.

The effect of cigarette smoke on NK cell function was assessed using SCM or directly, by comparing ex vivo NK cells isolated from healthy nonsmokers and smokers. NK cells were stimulated using poly I:C, a TLR-3 agonist and a potent inducer of the innate immune system. poly I:C is a synthetic mimic of dsRNA, an intermediate in the replication of viruses.

We demonstrate for the first time that cigarette smoke inhibited the production of IFN-{gamma} and TNF-{alpha} by NK cells following poly I:C stimulation. In addition, cigarette smoke reduced NK cell cytotoxic ability, which was associated with reduced perforin expression by poly I:C-stimulated human NK cells. Importantly, cigarette smoke did not impact cell viability. Moreover, cigarette smoke did not affect the expression of TLR-3 or RIG-I mRNA, the molecular machinery enabling them to respond to poly I:C/dsRNA. Thus, it is unlikely that compromised NK cell function was a result of a toxic effect on these cell types. In contrast, cigarette smoke likely inhibits IFN-{gamma} secretion by interfering with cytokine signaling pathways required for IFN-{gamma} production.

Inhibition of IFN-{gamma} production by PBMCs as a result of exposure to cigarette smoke is in agreement with a recent study by Ouyang et al. [22 ], although there are differences in the experimental approach, including the concentration of SCM and exposure time, as well as the stimulation protocol (PMA vs. poly I:C). More recently, it has been reported that nicotine inhibits the IL-18-enhanced production of IFN-{gamma} by PBMCs [23 ]. Whether the observed inhibition of NK cells in our study is a result of nicotine is currently not known. Tobacco smoke contains more than 4000 components. Identification of the factor(s) that ultimately suppress NK cell function is outside the scope of this study.

We and other groups have recently demonstrated that poly I:C directly enhances IFN-{gamma} production by purified NK cells [14 , 15 ]. To confirm that NK cells are the main source of IFN-{gamma} in PBMC, we assessed IFN-{gamma} production by PBMCs, NK/NKT cells, and NK-depleted PBMCs. NK cell-depleted PBMCs failed to produce any detectable amounts of IFN-{gamma} upon poly I:C stimulation, whereas normal PBMCs and purified NK/NKT cells produced high levels of IFN-{gamma}. Furthermore, intracellular flow cytometric analysis clearly demonstrated that NK cells but not NKT cells are the predominant source of IFN-{gamma} in poly I:C-activated NK/NKT cells. Taken together, these data show that NK cells are the main source of IFN-{gamma} in PBMCs. Consequently, attenuated IFN-{gamma} production by PBMC is a result of compromised NK cell function.

Controversies exist whether cigarette smoke decreases [24 ] or increases TNF-{alpha} production in smokers’ PBMCs [25 , 26 ]. Our data reveal a significant decrease of TNF-{alpha} production by PBMC and NK cells following poly I:C stimulation. Despite differences in experimental protocols, our data are in agreement with Ouyang et al. [22 ], who demonstrated a dramatic reduction (up to 90%) of TNF-{alpha} release by cigarette smoke-exposed PBMCs upon PMA stimulation. TNF-{alpha} is a known inducer of NK cell IFN-{gamma} secretion and cytotoxicity. Specifically, TNF-{alpha} expression precedes and stimulates IFN-{gamma} production by NK cells. However, the decreased TNF-{alpha} release observed in smoke-exposed PBMCs and NK cells may unlikely synergize the effects of cigarette smoke, and anti-IL-12 mAb treatment alone blocked NK cell IFN-{gamma} production completely. Inhibition of TNF-{alpha} by cigarette smoke, therefore, is not required for observed inhibition of IFN-{gamma}. That the effect of cigarette smoke on TNF-{alpha} is reversible is in agreement with the beneficial health effects of smoking cessation.

The common consequence of cigarette smoke is the development of COPD associated with airway inflammatory cell accumulation, including macrophages and neutrophils [27 , 28 ]. Smoking leads to the activation and recruitment of inflammatory cells to the lungs with eventual release of inflammatory cytokines such as IL-8 and IL-6 [29 , 30 ]. Several lines of evidence reveal that cigarette differentially regulates LPS-stimulated secretion of IL-6 or IL-8 by pulmonary macrophages [31 32 33 34 ]. However, data about the influence of cigarette smoke on TLR-3 agonist-induced secretion of IL-6 or IL-8 by macrophages are relatively scarce. In this study, we observed no obvious influence of cigarette smoke in vitro or ex vivo on the production of IL-6 by poly I:C-activated PBMCs. In contrast, IL-8 production was markedly reduced by SCM-treated PBMCs despite poly I:C stimulation, although smokers showed a nonsignificant level of attenuation. These findings suggest that cigarette smoke has little or no likely impacts on pulmonary innate defense mechanisms mediated by IL-6 or IL-8 during viral infections.

NK cells are considered a vital member of the innate immune system by virtue of their cytolytic ability to kill infected and cancer cells. It has been well documented that NK cell-killing ability is up-regulated by the TLR-3 agonist poly I:C [14 15 16 ]. There have been conflicting reports that cigarette smoke decreases [35 , 36 ], increases [37 ], or has no effect [38 ] on NK cytotoxic activities. Our current findings that cigarette smoke significantly attenuates NK cell cytotoxic ability to kill K562 tumor cells suggest an increased vulnerability of smokers to infections and cancers. Indeed, epidemiological studies show an increased incidence of upper and lower respiratory tract infections even in young smokers [39 , 40 ]. Interestingly, the higher incidence of viral infection is not exclusive to respiratory viruses such as influenza but also applies for sexually transmitted viruses such as HIV [41 , 42 ]. Furthermore, we recently showed that decreased NK-mediated killing activity associated with increased tumor burden in smoke-exposed mice [7 ].

Several lines of evidence suggest that NK cells and CD8+ cytotoxic T cells mediate cytotoxicity, mainly by the granule exocytosis pathway, which relies on perforin and granzyme B, in addition to a number of activating and inhibitory receptor-mediated pathways [43 , 44 ]. Perforin is expressed by NK cells and T cells and is up-regulated by cytokine as well as ligand stimulation [45 ]. Cigarette smoke-induced prevention of perforin up-regulation by poly I:C-activated NK cells in our studies may be, in part, associated with decreased NK cell cytotoxicity. This is, so far, the first experimental evidence indicating cigarette smoke attenuates poly I:C-augmented human NK cytotoxic activity by blocking perforin up-regulation. Decreased cytotoxic killing ability of NK/CTLs in HIV/AIDS patients has been shown to associate with reduced perforin expression [46 ]. As the effect of cigarette smoke on perforin versus NK cytoxicity is not as robust as what we observed for IFN-{gamma}, the possible involvement of other molecular mechanisms cannot not be ruled out. NK cell function is regulated by a fine balance of positive and negative signaling pathways initiated by multiple inhibitory and activating receptors [47 ]. To this end, we have evaluated the expression of NKG2D, the widely expressed NK-activating receptor, in SCM-treated PBMCs/NK cells by flow cytometry, but no significant changes were observed (data not shown). Inflammatory cytokines IFN-{gamma} and TNF-{alpha} have also been known to regulate NK cytotoxicity; therefore, the reduced levels of these cytokines might be linked to reduced cytotoxicity in addition to a perforin-mediated pathway.

It is well known that IL-12 regulates NK cell-mediated IFN-{gamma} production [25 , 26 , 48 , 49 ]. In this study, we report for the first time that cigarette smoke blocked IL-12p40 production by poly I:C-activated PBMCs. Recently, it has been shown that nicotine inhibits the IL-18-enhanced production of IL-12 by human PBMCs [23 ]. We have confirmed that the inhibition of IFN-{gamma} production in PBMCs by cigarette smoke is mediated via IL-12 inhibition, as preincubation of PBMCs with anti-IL-12 mAb diminished IFN-{gamma} release by PBMCs at a comparable level that observed with cigarette smoke treatments. As we observed a substantial level of IL-12 blocking by neutralizing PBMCs with IL-12 mAb alone, it is therefore unlikely that other cytokines produced by non-NK cells are involved. This is in line with other studies that blocking of APC-derived IL-12 production by genetic mutation of p35/40 [49 ] or by anti-IL-12 mAb [48 ] prevented complete production of NK cell IFN-{gamma} production in a mouse model in vivo. The function of NK cells might have been regulated by fine-tuning of multiple activating and inhibitory cytokines released by a variety of immune cells in poly I:C-activated PBMCs. We therefore speculate that direct activation of a small population of IFN-{gamma}-producing NK subsets among the PBMC population may not be possible as a result of mechanisms yet to be elucidated. This in turn might let NK cells depend on APC-derived IL-12 to produce IFN-{gamma}. It has been shown that poly I:C can stimulate human NK cells in an APC-dependent [16 , 17 ] and in an APC-independent [14 , 15 ] manner. In addition, we observed that cigarette smoke had an effect, independent of APC-derived IL-12, on IFN-{gamma} production by purified human NK cells. This was confirmed, as there was no IL-12 production from purified human NK cells, and the pretreatment of purified NK cells with anti-IL-12 mAb failed to inhibit IFN-{gamma} production upon poly I:C stimulation. This suggests that cigarette smoke-mediated inhibition of IFN-{gamma} secretion by NK/NKT cells can be APC-derived, IL-12-dependent and -independent.

Collectively, our results demonstrate that cigarette smoke inhibits IFN-{gamma} and IL-12 secretion and has a significant impact on cytotoxic killing ability of poly I:C-activated human PBMCs and purified NK cells. These findings provide further evidence to explain why cigarette smokers are often prone to viral infections and cancers. Investigating the molecular mechanisms and other cytokines regulating the NK cell functions would provide more insights into the impacts of cigarette smoke on innate immunity against viral infections and cancers.

ACKNOWLEDGEMENTS

This work was supported by Philip Morris USA Inc. and by Philip Morris International (K. L. M. and A. A. A.). A. A. A. and K. L. M. are recipients of Rx and D/Canadian Institutes of Health Research (CIHR) Research Career Award in Health Sciences Canada, and M. R. S. is holder of a CIHR New Investigator Award. We are thankful to Navkiran Gill and Carla Bauer for technical assistance.

Received July 20, 2007; revised November 1, 2007; accepted November 2, 2007.

REFERENCES

    1
  1. Sopori, M. (2002) Effects of cigarette smoke on the immune system Nat. Rev. Immunol. 2,372-377[CrossRef][Medline]
  2. 2
  3. Ezzati, M., Lopez, A. D. (2003) Estimates of global mortality attributable to smoking in 2000 Lancet 362,847-852[CrossRef][Medline]
  4. 3
  5. Holt, P. G., Keast, D. (1977) Environmentally induced changes in immunological function: acute and chronic effects of inhalation of tobacco smoke and other atmospheric contaminants in man and experimental animals Bacteriol. Rev. 41,205-216[Free Full Text]
  6. 4
  7. Sopori, M. L., Kozak, W. (1998) Immunomodulatory effects of cigarette smoke J. Neuroimmunol. 83,148-156[CrossRef][Medline]
  8. 5
  9. Chang, J. C., Distler, S. G., Kaplan, A. M. (1990) Tobacco smoke suppresses T cells but not antigen-presenting cells in the lung-associated lymph nodes Toxicol. Appl. Pharmacol. 102,514-523[CrossRef][Medline]
  10. 6
  11. Robbins, C. S., Dawe, D. E., Goncharova, S. I., Pouladi, M. A., Drannik, A. G., Swirski, F. K., Cox, G., Stampfli, M. R. (2004) Cigarette smoke decreases pulmonary dendritic cells and impacts antiviral immune responsiveness Am. J. Respir. Cell Mol. Biol. 30,202-211[Abstract/Free Full Text]
  12. 7
  13. Lu, L. M., Zavitz, C. C., Chen, B., Kianpour, S., Wan, Y., Stampfli, M. R. (2007) Cigarette smoke impairs NK cell-dependent tumor immune surveillance J. Immunol. 178,936-943[Abstract/Free Full Text]
  14. 8
  15. Bancroft, G. J. (1993) The role of natural killer cells in innate resistance to infection Curr. Opin. Immunol. 5,503-510[CrossRef][Medline]
  16. 9
  17. Biron, C. A. (1997) Activation and function of natural killer cell responses during viral infections Curr. Opin. Immunol. 9,24-34[CrossRef][Medline]
  18. 10
  19. Cerwenka, A., Lanier, L. L. (2001) Natural killer cells, viruses and cancer Nat. Rev. Immunol. 1,41-49[CrossRef][Medline]
  20. 11
  21. Janeway, C. A., Jr, Medzhitov, R. (2002) Innate immune recognition Annu. Rev. Immunol. 20,197-216[CrossRef][Medline]
  22. 12
  23. Takeda, K., Kaisho, T., Akira, S. (2003) Toll-like receptors Annu. Rev. Immunol. 21,335-376[CrossRef][Medline]
  24. 13
  25. Ferson, M., Edwards, A., Lind, A., Milton, G. W., Hersey, P. (1979) Low natural killer-cell activity and immunoglobulin levels associated with smoking in human subjects Int. J. Cancer 23,603-609[Medline]
  26. 14
  27. Lauzon, N. M., Mian, F., MacKenzie, R., Ashkar, A. A. (2006) The direct effects of Toll-like receptor ligands on human NK cell cytokine production and cytotoxicity Cell. Immunol. 241,102-112[CrossRef][Medline]
  28. 15
  29. Schmidt, K. N., Leung, B., Kwong, M., Zarember, K. A., Satyal, S., Navas, T. A., Wang, F., Godowski, P. J. (2004) APC-independent activation of NK cells by the Toll-like receptor 3 agonist double-stranded RNA J. Immunol. 172,138-143[Abstract/Free Full Text]
  30. 16
  31. Sivori, S., Falco, M., Della Chiesa, M., Carlomagno, S., Vitale, M., Moretta, L., Moretta, A. (2004) CpG and double-stranded RNA trigger human NK cells by Toll-like receptors: induction of cytokine release and cytotoxicity against tumors and dendritic cells Proc. Natl. Acad. Sci. USA 101,10116-10121[Abstract/Free Full Text]
  32. 17
  33. Pisegna, S., Pirozzi, G., Piccoli, M., Frati, L., Santoni, A., Palmieri, G. (2004) p38 MAPK activation controls the TLR3-mediated up-regulation of cytotoxicity and cytokine production in human NK cells Blood 104,4157-4164[Abstract/Free Full Text]
  34. 18
  35. Alli, R. S., Khar, A. (2004) Interleukin-12 secreted by mature dendritic cells mediates activation of NK cell function FEBS Lett. 559,71-76[CrossRef][Medline]
  36. 19
  37. Ma, X., Trinchieri, G. (2001) Regulation of interleukin-12 production in antigen-presenting cells Adv. Immunol. 79,55-92[Medline]
  38. 20
  39. Bernhard, D., Huck, C. W., Jakschitz, T., Pfister, G., Henderson, B., Bonn, G. K., Wick, G. (2004) Development and evaluation of an in vitro model for the analysis of cigarette smoke effects on cultured cells and tissues J. Pharmacol. Toxicol. Methods 50,45-51[CrossRef][Medline]
  40. 21
  41. Mosmann, T. (1983) Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays J. Immunol. Methods 65,55-63[CrossRef][Medline]
  42. 22
  43. Ouyang, Y., Virasch, N., Hao, P., Aubrey, M. T., Mukerjee, N., Bierer, B. E., Freed, B. M. (2000) Suppression of human IL-1β, IL-2, IFN-{gamma}, and TNF-{alpha} production by cigarette smoke extracts J. Allergy Clin. Immunol. 106,280-287[CrossRef][Medline]
  44. 23
  45. Takahashi, H. K., Iwagaki, H., Hamano, R., Yoshino, T., Tanaka, N., Nishibori, M. (2006) Effect of nicotine on IL-18-initiated immune response in human monocytes J. Leukoc. Biol. 80,1388-1394[Abstract/Free Full Text]
  46. 24
  47. Ryder, M. I., Saghizadeh, M., Ding, Y., Nguyen, N., Soskolne, A. (2002) Effects of tobacco smoke on the secretion of interleukin-1β, tumor necrosis factor-{alpha}, and transforming growth factor-β from peripheral blood mononuclear cells Oral Microbiol. Immunol. 17,331-336[CrossRef][Medline]
  48. 25
  49. Bernzweig, E., Payne, J. B., Reinhardt, R. A., Dyer, J. K., Patil, K. D. (1998) Nicotine and smokeless tobacco effects on gingival and peripheral blood mononuclear cells J. Clin. Periodontol. 25,246-252[CrossRef][Medline]
  50. 26
  51. Zeidel, A., Beilin, B., Yardeni, I., Mayburd, E., Smirnov, G., Bessler, H. (2002) Immune response in asymptomatic smokers Acta Anaesthesiol. Scand. 46,959-964[CrossRef][Medline]
  52. 27
  53. Hogg, J. C., Chu, F., Utokaparch, S., Woods, R., Elliott, W. M., Buzatu, L., Cherniack, R. M., Rogers, R. M., Sciurba, F. C., Coxson, H. O., Pare, P. D. (2004) The nature of small-airway obstruction in chronic obstructive pulmonary disease N. Engl. J. Med. 350,2645-2653[Abstract/Free Full Text]
  54. 28
  55. Bohadana, A., Teculescu, D., Martinet, Y. (2004) Mechanisms of chronic airway obstruction in smokers Respir. Med. 98,139-151[CrossRef][Medline]
  56. 29
  57. Keatings, V. M., Collins, P. D., Scott, D. M., Barnes, P. J. (1996) Differences in interleukin-8 and tumor necrosis factor-{alpha} in induced sputum from patients with chronic obstructive pulmonary disease or asthma Am. J. Respir. Crit. Care Med. 153,530-534[Abstract]
  58. 30
  59. Francus, T., Romano, P. M., Manzo, G., Fonacier, L., Arango, N., Szabo, P. (1992) IL-1, IL-6, and PDGF mRNA expression in alveolar cells following stimulation with a tobacco-derived antigen Cell. Immunol. 145,156-174[CrossRef][Medline]
  60. 31
  61. Karimi, K., Sarir, H., Mortaz, E., Smit, J. J., Hosseini, H., De Kimpe, S. J., Nijkamp, F. P., Folkerts, G. (2006) Toll-like receptor-4 mediates cigarette smoke-induced cytokine production by human macrophages Respir. Res. 7,66[CrossRef][Medline]
  62. 32
  63. Moodie, F. M., Marwick, J. A., Anderson, C. S., Szulakowski, P., Biswas, S. K., Bauter, M. R., Kilty, I., Rahman, I. (2004) Oxidative stress and cigarette smoke alter chromatin remodeling but differentially regulate NF-{kappa}B activation and proinflammatory cytokine release in alveolar epithelial cells FASEB J. 18,1897-1899[Abstract/Free Full Text]
  64. 33
  65. McCrea, K. A., Ensor, J. E., Nall, K., Bleecker, E. R., Hasday, J. D. (1994) Altered cytokine regulation in the lungs of cigarette smokers Am. J. Respir. Crit. Care Med. 150,696-703[Abstract]
  66. 34
  67. Gaschler, G. J., Zavitz, C. C., Bauer, C. M., Skrtic, M., Lindahl, M., Robbins, C. S., Chen, B., Stampfli, M. R. (2007) Cigarette smoke exposure attenuates cytokine production by mouse alveolar macrophages Am. J. Respir. Cell Mol. Biol. Epub ahead of print
  68. 35
  69. Takeuchi, M., Nagai, S., Izumi, T. (1988) Effect of smoking on natural killer cell activity in the lung Chest 94,688-693[CrossRef][Medline]
  70. 36
  71. Meliska, C. J., Stunkard, M. E., Gilbert, D. G., Jensen, R. A., Martinko, J. M. (1995) Immune function in cigarette smokers who quit smoking for 31 days J. Allergy Clin. Immunol. 95,901-910[CrossRef][Medline]
  72. 37
  73. Newman, L. S., Kreiss, K., Campbell, P. A. (1991) Natural killer cell tumoricidal activity in cigarette smokers and in silicotics Clin. Immunol. Immunopathol. 60,399-411[CrossRef][Medline]
  74. 38
  75. Phillips, B., Marshall, M. E., Brown, S., Thompson, J. S. (1985) Effect of smoking on human natural killer cell activity Cancer 56,2789-2792[CrossRef][Medline]
  76. 39
  77. Pauwels, R. A., Buist, A. S., Ma, P., Jenkins, C. R., Hurd, S. S. (2001) Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease: National Heart, Lung, and Blood Institute and World Health Organization Global Initiative for Chronic Obstructive Lung Disease (GOLD): executive summary Respir. Care 46,798-825[Medline]
  78. 40
  79. Arcavi, L., Benowitz, N. L. (2004) Cigarette smoking and infection Arch. Intern. Med. 164,2206-2216[Abstract/Free Full Text]
  80. 41
  81. Crothers, K., Griffith, T. A., McGinnis, K. A., Rodriguez-Barradas, M. C., Leaf, D. A., Weissman, S., Gibert, C. L., Butt, A. A., Justice, A. C. (2005) The impact of cigarette smoking on mortality, quality of life, and comorbid illness among HIV-positive veterans J. Gen. Intern. Med. 20,1142-1145[CrossRef][Medline]
  82. 42
  83. Kark, J. D., Lebiush, M., Rannon, L. (1982) Cigarette smoking as a risk factor for epidemic a(h1n1) influenza in young men N. Engl. J. Med. 307,1042-1046[Abstract]
  84. 43
  85. Trapani, J. A., Smyth, M. J. (2002) Functional significance of the perforin/granzyme cell death pathway Nat. Rev. Immunol. 2,735-747[CrossRef][Medline]
  86. 44
  87. Van Dommelen, S. L., Sumaria, N., Schreiber, R. D., Scalzo, A. A., Smyth, M. J., Degli-Esposti, M. A. (2006) Perforin and granzymes have distinct roles in defensive immunity and immunopathology Immunity 25,835-848[CrossRef][Medline]
  88. 45
  89. Kagi, D., Ledermann, B., Burki, K., Seiler, P., Odermatt, B., Olsen, K. J., Podack, E. R., Zinkernagel, R. M., Hengartner, H. (1994) Cytotoxicity mediated by T cells and natural killer cells is greatly impaired in perforin-deficient mice Nature 369,31-37[CrossRef][Medline]
  90. 46
  91. Qi, W., Yongjun, J., Yanan, W., Zining, Z., Xiaoxu, H., Jing, L., Hong, S. (2006) Differential expression of perforin in cytotoxic lymphocyte in HIV/AIDS patients of China J. Clin. Immunol. 26,339-346[CrossRef][Medline]
  92. 47
  93. Colucci, F., Di Santo, J. P., Leibson, P. J. (2002) Natural killer cell activation in mice and men: different triggers for similar weapons? Nat. Immunol. 3,807-813[CrossRef][Medline]
  94. 48
  95. Orange, J. S., Biron, C. A. (1996) An absolute and restricted requirement for IL-12 in natural killer cell IFN-{gamma} production and antiviral defense. Studies of natural killer and T cell responses in contrasting viral infections J. Immunol. 156,1138-1142[Abstract]
  96. 49
  97. Nguyen, K. B., Salazar-Mather, T. P., Dalod, M. Y., Van Deusen, J. B., Wei, X. Q., Liew, F. Y., Caligiuri, M. A., Durbin, J. E., Biron, C. A. (2002) Coordinated and distinct roles for IFN-{alpha} β, IL-12, and IL-15 regulation of NK cell responses to viral infection J. Immunol. 169,4279-4287[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0707481v1
83/3/774    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mian, M. F.
Right arrow Articles by Ashkar, A. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mian, M. F.
Right arrow Articles by Ashkar, A. A.