Accuri C6 Flow Cytometer System
Originally published online as doi:10.1189/jlb.0607366 on November 8, 2007

Published online before print November 8, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Supplemental Figures
Right arrow All Versions of this Article:
jlb.0607366v1
83/3/456    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lotfi, R.
Right arrow Articles by Lotze, M. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lotfi, R.
Right arrow Articles by Lotze, M. T.
(Journal of Leukocyte Biology. 2008;83:456-460.)
© 2008 by Society for Leukocyte Biology

Eosinophils induce DC maturation, regulating immunity

Ramin Lotfi*,{dagger} and Michael Thomas Lotze{dagger},1

* Institute for Clinical Transfusion Medicine and Immunogenetics Ulm, University of Ulm, Red Cross Blood Center, BaWü-Hessen, Germany; and
{dagger} University of Pittsburgh, Departments of Surgery and Bioengineering, Pittsburgh, Pennsylvania, USA

1Correspondence: University of Pittsburgh Cancer Institute, Surgery and Bioengineering, Hillmann Cancer Center, 5117 Centre Avenue, Rm. G.21, Pittsburgh, PA 15213, USA. E-mail: lotzemt{at}upmc.edu

ABSTRACT

There are increased eosinophils in tumors, and they are generally associated with a good prognosis, whereas their presence in rejecting allografts is largely seen as a harbinger of poor outcome. The biologic role of eosinophils in their pathogenesis is more poorly understood than in allergy and asthma. Myeloid conventional dendritic cells (DCs) and conversely, plasmacytoid DCs are similarly associated with a good prognosis in cancer patients. We hypothesize that eosinophils, similar to NK cells, could mature DCs, and that could be responsible for regulating immunity in the setting of necrosis-associated chronic inflammation as occurs in cancer and transplant rejection. We have demonstrated that CpG DNA promotes eosinophil-induced DC maturation. As such, a greater linkage than had previously been considered between innate immune cells such as eosinophils and the adaptive immune response can be considered. Granulocytes were isolated from normal human whole blood by density gradient centrifugation followed by ammonium chloride-potassium lysis of the remaining red cells. Eosinophils were negatively separated using magnetic beads. Immature DCs were generated from CD-14 positively separated monocytes, which were cultured for 6 days with GM-CSF and IL-4. CpG ODN 2395 (CpG-C) as a pathogen-associated molecular pattern surrogate was used to induce eosinophil-based DC maturation. Transwells were used to assess cell–cell interaction between eosinophils and DCs. Eosinophil survival was assessed by flow cytometry; cells, which did not stain with Sytox-Orange, were considered viable. In the presence of CpG-C, eosinophils induced DC maturation. Similar results were obtained when eosinophils were pretreated with CpG for 4 h, washed, and cocultured afterwards with DCs. Eosinophil-induced maturation of DCs directly correlated with the eosinophil:DC ratio. Transwell studies showed that the direct cell–cell interaction between eosinophils and DCs enhances maturation. CpGs did not adversely affect eosinophil survival; thus, we could exclude the possibility that DC maturation was caused by sensing eosinophil cell death. While eosinophil-derived neurotoxin did not contribute to the described effect, DCs took up and internalized major basic protein (MBP), which was released from CpG-stimulated eosinophils, revealed by confocal imaging and flow cytometry. Thus, the DC maturational-inducing effect of eosinophils may be a result of released MBP from eosinophils. CpG-activated eosinophils mature conventional DCs. The role of viral or bacterial products or potentially, host-derived DNA as eosinophil activators with consequent DC maturation should be considered in more detail in the inflammatory settings in which eosinophils have been observed.

Key Words: dendritic cells • asthma • tumor immunology • CpG • DAMPs

INTRODUCTION

The role of eosinophils in inflammation is controversial [1 , 2 ]. The appearance of an eosinophil-like amoeboid granulocyte in invertebrate species without lymphocytes is consistent with its evolution as part of an early innate host response system [3 ]. Persistence of eosinophils among individual species, which have undergone selective pressure during the last millennia, strongly suggests their importance in immunity [4 ]. Asthma and helminthic infections are the two typical conditions in humans associated with tissue and blood eosinophilia. The prevailing hypotheses regarding eosinophil effector function are based on two observations: Eosinophils contain cytotoxic proteins, which they can release following activation; and eosinophils often localize to damaged tissue in allergic and autoimmune disorders, vasculitis, granulomatous disease, interstitial, and other pulmonary diseases, transplantation graft rejection, as well as neoplastic and myeloproliferative diseases [1 , 4 , 5 ]. Nevertheless, conflicting and inconsistent results concerning eosinophil cytotoxic effector function suggest an alternative role for these granulocytes. Lysis of parasites by eosinophils and eosinophil granule products in vitro has been well demonstrated. There has, however, been conflicting evidence about the protective efficacy of eosinophils in animals depleted of eosinophils and subsequently challenged with a variety of parasites [2 ]. Although anti-IL-5 antibody treatment of asthma patients effectively reduces airway and blood eosinophil levels, this treatment appears to have little effect on acute/chronic pulmonary pathology [6 ].

Infections of the lower respiratory tract are known factors exacerbating asthma symptoms. Based on the observation that dendritic cells (DCs) are required for the development of chronic eosinophilic airway inflammation in response to inhaled antigen in sensitized mice [7 ], we hypothesized that eosinophils sensing pathogen- or damage-associated molecular pattern molecules (PAMPs and DAMPs, respectively) are capable of initiating an immune response, specifically inducing maturation of DCs. Eosinophil-matured DCs, rather than eosinophils themselves, may be responsible for regulating immunity during chronic inflammatory diseases such as asthma. For the first time, we show that in the presence of CpG DNA, as a surrogate for microbial pathogens, eosinophils induce DC maturation in vitro. While eosinophil-derived neurotoxin (EDN) did not contribute to the described effect, DCs took up and internalized major basic protein (MBP), which was released from CpG-stimulated eosinophils.

MATERIALS AND METHODS

Isolation of eosinophils and monocytes
In the context of an Institutional Review Board-approved protocol, human granulocytes and monocytes were purified from whole blood by density gradient centrifugation using Ficoll-PaqueTM Plus (Amersham Biosciences, Piscataway, NJ, USA), followed by lysis of red cells using ammonium chloride solution (155 mM NH4Cl, 10 mM KHCO3, and 0.1 mM EDTA). Human eosinophils were negatively separated from other granulocytes using MACS separation (Miltenyi Biotec, Auburn, CA, USA), following the manufacturer’s instructions. The purity was assessed by H&E staining and was at least 95%. Monocytes were positively separated from the mononuclear cell fraction using magnetically labeled, anti-human CD14 antibodies (StemSep, Stem Cell Technologies, Vancouver, BC, Canada), according to the manufacturer’s instructions.

Generation of DCs and culture conditions
Immature DCs (iDCs) were generated from monocytes using IL-4 (500 U/ml, R&D Systems, Minneapolis, MN, USA) and GM-CSF (1000 U/ml, Leukine®, Immunex Corp., Seattle, WA, USA), as described previously. Maturation of DCs was induced by adding TNF-{alpha} (50 ng/ml) and IL-1β (10 ng/ml, R&D Systems). Cells were cultured in RPMI 1640 (Cellgro, Mediatech Inc., Herndon, VA, USA), supplemented with 10% FBS (Gibco Invitrogen, Carlsbad, CA, USA) and containing 100 U/ml Penicillin-G, 0.25 µg/ml Amphotericin B, and 100 µg/ml streptomycin (Cellgro, Mediatech Inc.) in a humidified atmosphere at 37°C with 5% CO2. Once iDCs were generated, all further coculture experiments were performed for 3 days in the presence of IL-5 (10 ng/ml) and GM (200 ng/ml) in media. CpG-ODN 2395 (CpG-C; TCGTCGTTTTCGGCGCGCGCCG, Coley Pharmaceutical Group, Wellesley, MA, USA) served as surrogate for bacterial or viral DNA. Non-CpG-DNA (Hycult Biotechnology, Uden, Netherlands) served as a control for CpG-induced effects.

Staining for surface antigens and flow cytometry
DCs were fixed for 15 min using 2% paraformaldehyde (PFA). After blocking unspecific binding sites for at least 10 min with whole mouse IgG (Jackson ImmunoResearch Laboratories, West Grove, PA, USA), cells were incubated for at least 30 min with fluorescently labeled murine antibodies against human CD80, CD83, CD86, and HLA-DR (R&D Systems). The fluorescence of stained cells was assessed using a BD FACSArray (BD Biosciences, San Jose, CA, USA), and the data were analyzed using FACS-Diva software (BD Biosciences). At least 20,000 events were acquired in all flow cytometric analyses.

Viability assay
Cell viability was assessed after 2 days by staining with Sytox-Orange (Molecular Probes, Eugene, OR, USA) following the manufacturer’s instructions. As a result of the fact that all coculture studies were performed in the presence of GM-CSF and IL-5, we decided to incubate eosinophils with CpGs in the presence of both cytokines. Incubation with recombinant human GM-CSF (200 ng/ml, Leukine®, Immunex Corp.) plus IL-5 (10 ng/ml) alone served as control for survival. CpG-ODN 2395 (CpG-C; Coley Pharmaceutical Group) was used in survival assays. Sytox-Orange-negative cells were considered as viable. At least 20,000 events were acquired in all flow cytometric analyses. Flow cytometry was performed using a BD FACSArray (BD Biosciences), and the data were analyzed using FACS-Diva software (BD Biosciences).

Transwell assay
To assess cell–cell interaction, iDCs (5x105/well) were separated from eosinophils (5x105/well) using 24-well Costar-Transwells® with a membrane pore size of 0.4 µm (Corning, Corning, NY, USA). DCs were harvested after 3 days of coculture, fixed with 2% PFA, and stained for surface markers as described above.

Intracellular staining for MBP and indirect assessment of degranulation of eosinophils
DCs, cultured alone or in the presence of eosinophils, were stimulated with CpG-ODN 2395. After 6 h, DCs were fixed with 2% PFA for 15 min, followed by 10 min of permeabilization with 75% ethanol. Fixed and permeabilized cells were incubated for 30 min with murine anti-human MBP antibody (BD Biosciences, PharMingen) as primary and PerCP-labeled rat anti-mouse IgG as secondary antibody (R&D Systems). Flow cytometric analysis was performed using FACScan (BD Biosciences).

Confocal microscopy
Cells, which were fixed, permeabilized, and stained for flow cytometry analysis, as described above, were viewed on a confocal-scanning fluorescence microscope (FluoView, Olympus, Center Valley, PA, USA).

ELISA for released EDN
Eosinophils as monoculture or as coculture with DCs were stimulated with CpG-ODN 2395 for 6 h. Supernatant was spun twice and analyzed for EDN using an ELISA kit (Immundiagnostik AG, Germany) following the manufacturer’s instructions.

Oxidative burst
Approximately 0.4 x 106 eosinophils/ml were preincubated with 1 µM 2', 7'-dichlorodihydrofluorescein diacetate (H2DCFDA; Invitrogen Molecular Probes) in phenol-red-free, prewarmed RPMI-1640 media (Cellgro, Mediatech Inc.), supplemented with 10% FBS (Gibco-Invitrogen) and containing 100 U/ml Penicillin-G, 0.25 µg/ml Amphotericin B, and 100 µg/ml streptomycin (Cellgro, Mediatech Inc.). After 10 min, eosinophils were stimulated for 30 min with CpG-ODN 2395, and fMLP served as a positive control. Oxidative burst was assessed using flow cytometry (FACScan, BD Biosciences).

RESULTS

Eosinophils enhance DC maturation
Given the fact that infections cause exacerbation of eosinophil-associated diseases such as asthma and atopic dermatitis, we tested the capacity of eosinophils to induce maturation of DCs in the presence of CpGs as surrogates for bacterial and viral DNA. CpGs, by themselves, are reported to induce DC maturation [8 , 9 ]. Eosinophils respond to CpGs and express the CpG receptor, TLR9 [10 ]. In in vitro experiments, we could demonstrate that in the presence of eosinophils, DCs up-regulate maturation markers (CD80, CD83, CD86, and HLA-DR) at a CpG concentration, which by itself, only minimally induced DC maturation (Fig. 1 ). Consistent with expression of maturation markers, we could also demonstrate microscopic changes of DC morphology (Supplemental Fig. 1). Comparing eosinophils with whole granulocyte population, consisting predominantly of neutrophils, we could demonstrate that the induction of DC maturation is mediated by eosinophils and not neutrophils. (Fig. 2 ).


Figure 1
View larger version (27K):
[in this window]
[in a new window]

 
Figure 1. Eosinophils enhance DC maturation. iDCs (5x105/well) were stimulated with a suboptimal concentration of CpG-ODN 2395 in the presence or absence of eosinophils (Eos; 5x105/well) using 24-well plates. After 3 days, cells were fixed and examined by flow cytometry for various markers. Flow cytometric analysis of DCs demonstrates the highest up-regulation of maturation markers on DCs when stimulated with CpGs in the presence of eosinophils.


Figure 2
View larger version (42K):
[in this window]
[in a new window]

 
Figure 2. Induction of DC maturation is mediated by eosinophils and not neutrophils. iDCs (5x105/well) were stimulated with a suboptimal concentration of CpG-ODN 2395 in the presence or absence of eosinophils or whole granulocyte (Gr) population (5x105/well) containing predominantly neutrophils. At 3 days, flow cytometric analysis of DCs demonstrates the highest up-regulation of maturation markers on DCs when stimulated with CpGs in the presence of eosinophils.

Eosinophil-induced maturation of DCs directly correlates with the eosinophil:DC ratio
In the presence of CpG-C (ODN 2395), we cocultured iDCs for 3 days with eosinophils at various eosinophil:DC ratios starting at one eosinophil:100 DCs up to 10 eosinophils:one DC. We could demonstrate that in the presence of CpG-C, higher numbers of eosinophils correlated positively with expression of maturation markers on DCs (Fig. 3 ).


Figure 3
View larger version (43K):
[in this window]
[in a new window]

 
Figure 3. Eosinophil-induced maturation of DCs correlates directly with the number of eosinophils. iDCs (5x105/well) were stimulated with a suboptimal concentration of CpG-ODN 2395 in the presence or absence of individual concentration of eosinophils with a range of one eosinophil per 100 DCs up to 10 eosinophils per one DC. Flow cytometric analysis of DCs following 3 days of stimulation revealed a correlation between up-regulation of maturation markers and the higher ratio of eosinophils:DC. T0, phenotype prior to coculture; no EOS or maturational agents.

Eosinophils induce DC maturation even without direct cell–cell contact
To study the cross-talk between eosinophils and DCs, it was of interest to determine if direct cell–cell interaction between eosinophils and DCs is obligatory for eosinophil-induced DC maturation. Local separation of eosinophils from DCs in transwell studies showed that the direct cell–cell interaction between eosinophils and DCs may enhance maturation, but the inducing effect was not obligatory (Fig. 4 ).


Figure 4
View larger version (21K):
[in this window]
[in a new window]

 
Figure 4. Eosinophils induce DC maturation without requirement for direct cell–cell contact. iDCs (5x105/well) were cocultured with eosinophils (5x105/well) using 24-well transwells with a membrane pore size of 0.4 µm, keeping the two cell populations locally separated. DCs were harvested after 3 days of coculture, fixed with 2% PFA, and stained for maturation markers. The results were compared with cells in direct coculture under otherwise the same conditions. Direct coculture has a somewhat higher maturation-inducing effect.

CpGs do not alter eosinophil survival but cause eosinophils to degranulate
DCs are capable of sensing cell death, which induces their maturation. Eosinophils are end-differentiated cells with a short lifespan; thus, it was necessary to exclude the possibility that death of eosinophils in coculture is responsible for DC maturation. In a 2-day survival assay, we could demonstrate that CpGs did not adversely affect eosinophil survival; 91.7% (SD: 2.5%) of CpG-treated eosinophils were still viable after 2 days compared with 94% (SD: 1.4%) in media containing GM-CSF and IL 5. Thus, we could exclude the possibility that DC maturation was caused by sensing eosinophil cell death.

To assess the biological effect of CpG-C as a TLR9 ligand on eosinophils and to characterize factors that may contribute to eosinophil-induced DC maturation, we measured intracellular MBP in DCs cocultured with eosinophils. MBP is not expressed in DCs but in eosinophils and is released following stimulation. We could show that DCs take up and internalize released MBP from eosinophils (Fig. 5 ). Based on this observation, we could demonstrate indirectly that eosinophils degranulate following 6 h treatment with CpG with associated MBP release (Fig. 5) . EDN induces DC maturation [11 ]. Thus, we tested the EDN concentration in supernatants of eosinophils stimulated for 2, 6, and 8 h with CpG-C. In our studies, stimulation with CpG-ODN 2395 did not induce EDN release (Supplemental Fig. 2), nor did it have any apparent effect on the oxidative burst of eosinophils (Supplemental Fig. 3).


Figure 5
View larger version (10K):
[in this window]
[in a new window]

 
Figure 5. DCs take up and internalize MBP released from CpG-stimulated eosinophils. Flow cytometry-based detection of intracellular MBP in DCs cocultured with eosinophils. DCs themselves do not express any MBP (A and B), which is an eosinophil-specific protein released by degranulation following stimulation of eosinophils. After 6 h coculture of eosinophils with autologous DCs, MBP can be detected in DCs by flow cytometric means (C). CpG stimulation of eosinophils in coculture induces enhanced MBP release from eosinophils, which is up-taken by DCs (D). Confocal microscopy shows DCs (C and D) with intracellular MBP (red) released from cocultured and CpG-stimulated eosinophils. Staining for HLA-DR was performed (green) to distinguish DCs from eosinophils.

DISCUSSION

Although eosinophilia is often observed in the context of autoimmune processes such as asthma and atopic dermatitis as well as helminthic infection, little is known about the precise biological function of these granulocytes. The notion that eosinophils are effector cells is not always consistent with experimental in vitro or in vivo data [1 , 2 ]. Specifically, the clinical approaches using anti-IL-5 antibodies to treat patients with asthma failed to improve symptoms, although their airway and blood eosinophil levels were significantly reduced. Infections of the lower respiratory tract are known factors exacerbating asthma symptoms. Based on the observation that DCs are required for the development of chronic eosinophilic airway inflammation in response to inhaled antigen in sensitized mice [7 ], we hypothesized that eosinophils sensing PAMPs are capable of initiating an immune response, specifically stimulating DCs. We could demonstrate that indeed, eosinophils are capable of enhancing DC maturation, acting to catalyze CpG-induced DC maturation. Eosinophil-matured DCs, rather than eosinophils themselves, may be responsible for regulating immunity during chronic inflammatory diseases such as asthma. This would also be a plausible explanation for the failure of eosinophil-specific treatment of asthma, as other leukocytes, such as NK cells [7 , 12 ], may substitute for eosinophil-enhanced DC maturation [13 ]. Given that CD40 ligand (CD154) induces DC maturation of monocyte-derived iDCs [14 ], we tested whether CpG is capable of inducing CD154 up-regulation in eosinophils and obtained conflicting results (data not shown). CD154 expression on eosinophils is not causative for inducing DC maturation. CpG had no effect on oxidative burst of eosinophils. Of the tested possible pathways of how eosinophils may respond to CpG and act to enhance pathogen-associated signals, MBP release was the only one we could demonstrate; thus, DC maturation may be a result of released MBP, which is internalized by DCs. The capability of MBP to induce DC maturation is currently under investigation.

It is of great interest to characterize the eosinophil-matured DCs in terms of DC polarization. A polarizing effect of NK cells on DC has been described [12 , 13 ]. We are examining the polarizing effect of eosinophils on DCs, aiming to better understand the biologic impact of eosinophils in immune responses and chronic inflammation. Whether other molecular pattern molecules, specifically DAMPs, activate eosinophils and induce eosinophil-enhanced DC maturation is currently under investigation. Thus, eosinophils may not only mediate a direct effector role as killing parasites but may also modulate immunity by interacting with other cells, such as DCs.

We advance a new and under-appreciated proximal event in the pathogenesis of infection-exacerbated asthma and other eosinophil-associated diseases, emphasizing the potential role of DCs in their pathogenesis. Studying eosinophil–DC interactions opens new strategies for targeting key factors to interfere with an eosinophil-induced/enhanced state of disease. Given the emergent understanding of the role of DAMPs in the pathogenesis of cancer and the possible beneficial impact of mature DCs as well as eosinophils [15 ] in the treatment of cancer, our results would open new strategies for treatment of not only asthma but also cancer-related, eosinophil-enhanced DC maturation.

ACKNOWLEDGEMENTS

This project was funded, in part, by 1 PO1 CA 101944-01A2 (M. T. L.), Integrating NK and DC into Cancer Therapy, and under a grant with the Pennsylvania Department of Health. The department specifically disclaims responsibility for any analyses, interpretations, or conclusions. We thank Hubert Schrezenmeier for critical review of our manuscript and helpful discussions. We also thank Karin Fuchs and Volker Mailänder for their help and advice in confocal microscopy.

Received June 9, 2007; revised October 15, 2007; accepted October 15, 2007.

REFERENCES

    1
  1. Lotfi, R., Lee, J. J., Lotze, M. T. (2007) Eosinophilic granulocytes and damage-associated molecular pattern molecules (DAMPs): role in the inflammatory response within tumors J. Immunother. 30,16-28[Medline]
  2. 2
  3. Klion, A. D., Nutman, T. B. (2004) The role of eosinophils in host defense against helminth parasites J. Allergy Clin. Immunol. 113,30-37[CrossRef][Medline]
  4. 3
  5. Ravindranath, M. H. (1978) The individuality of plasmatocytes and granular hemocytes of arthropods—a review Dev. Comp. Immunol. 2,581-594[CrossRef][Medline]
  6. 4
  7. Lee, J. J., Lee, N. A. (2005) Eosinophil degranulation: an evolutionary vestige or a universally destructive effector function? Clin. Exp. Allergy 35,986-994[CrossRef][Medline]
  8. 5
  9. Cormier, S. A., Taranova, A. G., Bedient, C., Nguyen, T., Protheroe, C., Pero, R., Dimina, D., Ochkur, S. I., O'Neill, K., Colbert, D., Lombari, T. R., Constant, S., McGarry, M. P., Lee, J. J., Lee, N. A. (2006) Pivotal Advance: eosinophil infiltration of solid tumors is an early and persistent inflammatory host response J. Leukoc. Biol. 79,1131-1139[Abstract/Free Full Text]
  10. 6
  11. Leckie, M. J., ten Brinke, A., Khan, J., Diamant, Z., O'Connor, B. J., Walls, C. M., Mathur, A. K., Cowley, H. C., Chung, K. F., Djukanovic, R., Hansel, T. T., Holgate, S. T., Sterk, P. J., Barnes, P. J. (2000) Effects of an interleukin-5 blocking monoclonal antibody on eosinophils, airway hyper-responsiveness, and the late asthmatic response Lancet 356,2144-2148[CrossRef][Medline]
  12. 7
  13. Lambrecht, B. N., Salomon, B., Klatzmann, D., Pauwels, R. A. (1998) Dendritic cells are required for the development of chronic eosinophilic airway inflammation in response to inhaled antigen in sensitized mice J. Immunol. 160,4090-4097[Abstract/Free Full Text]
  14. 8
  15. Popovic, P. J., DeMarco, R., Lotze, M. T., Winikoff, S. E., Bartlett, D. L., Krieg, A. M., Guo, Z. S., Brown, C. K., Tracey, K. J., Zeh, H. J., 3rd (2006) High mobility group B1 protein suppresses the human plasmacytoid dendritic cell response to TLR9 agonists J. Immunol. 177,8701-8707[Abstract/Free Full Text]
  16. 9
  17. Hartmann, G., Weiner, G. J., Krieg, A. M. (1999) CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells Proc. Natl. Acad. Sci. USA 96,9305-9310[Abstract/Free Full Text]
  18. 10
  19. Nagase, H., Okugawa, S., Ota, Y., Yamaguchi, M., Tomizawa, H., Matsushima, K., Ohta, K., Yamamoto, K., Hirai, K. (2003) Expression and function of Toll-like receptors in eosinophils: activation by Toll-like receptor 7 ligand J. Immunol. 171,3977-3982[Abstract/Free Full Text]
  20. 11
  21. Yang, D., Chen, Q., Rosenberg, H. F., Rybak, S. M., Newton, D. L., Wang, Z. Y., Fu, Q., Tchernev, V. T., Wang, M., Schweitzer, B., Kingsmore, S. F., Patel, D. D., Oppenheim, J. J., Howard, O. M. (2004) Human ribonuclease A superfamily members, eosinophil-derived neurotoxin and pancreatic ribonuclease, induce dendritic cell maturation and activation J. Immunol. 173,6134-6142[Abstract/Free Full Text]
  22. 12
  23. Kalinski, P., Giermasz, A., Nakamura, Y., Basse, P., Storkus, W. J., Kirkwood, J. M., Mailliard, R. B. (2005) Helper role of NK cells during the induction of anticancer responses by dendritic cells Mol. Immunol. 42,535-539[CrossRef][Medline]
  24. 13
  25. Kalinski, P., Mailliard, R. B., Giermasz, A., Zeh, H. J., Basse, P., Bartlett, D. L., Kirkwood, J. M., Lotze, M. T., Herberman, R. B. (2005) Natural killer-dendritic cell cross-talk in cancer immunotherapy Expert Opin. Biol. Ther. 5,1303-1315[CrossRef][Medline]
  26. 14
  27. Dauer, M., Obermaier, B., Herten, J., Haerle, C., Pohl, K., Rothenfusser, S., Schnurr, M., Endres, S., Eigler, A. (2003) Mature dendritic cells derived from human monocytes within 48 hours: a novel strategy for dendritic cell differentiation from blood precursors J. Immunol. 170,4069-4076[Abstract/Free Full Text]
  28. 15
  29. Simson, L., Ellyard, J. I., Dent, L. A., Matthaei, K. I., Rothenberg, M. E., Foster, P. S., Smyth, M. J., Parish, C. R. (2007) Regulation of carcinogenesis by IL-5 and CCL11: a potential role for eosinophils in tumor immune surveillance J. Immunol. 178,4222-4229[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
R. Lotfi, G. I. Herzog, R. A. DeMarco, D. Beer-Stolz, J. J. Lee, A. Rubartelli, H. Schrezenmeier, and M. T. Lotze
Eosinophils Oxidize Damage-Associated Molecular Pattern Molecules Derived from Stressed Cells
J. Immunol., October 15, 2009; 183(8): 5023 - 5031.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Mansson and L.-O. Cardell
Role of atopic status in Toll-like receptor (TLR)7- and TLR9-mediated activation of human eosinophils
J. Leukoc. Biol., April 1, 2009; 85(4): 719 - 727.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Supplemental Figures
Right arrow All Versions of this Article:
jlb.0607366v1
83/3/456    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lotfi, R.
Right arrow Articles by Lotze, M. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lotfi, R.
Right arrow Articles by Lotze, M. T.