Journal of Leukocyte Biology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published online as doi:10.1189/jlb.0407259 on August 20, 2007

Published online before print August 20, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0407259v1
82/5/1344    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kanayama, A.
Right arrow Articles by Miyamoto, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kanayama, A.
Right arrow Articles by Miyamoto, Y.
(Journal of Leukocyte Biology. 2007;82:1344-1352.)
© 2007 by Society for Leukocyte Biology

Apoptosis triggered by phagocytosis-related oxidative stress through FLIPS down-regulation and JNK activation

Atsuhiro Kanayama1 and Yusei Miyamoto

Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, Kashiwa, Chiba Japan

1 Correspondence: Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, Bioscience Building 402, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8562, Japan. E-mail: kanayama-atsuhiro{at}k.u-tokyo.ac.jp


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tumor necrosis factor-{alpha} (TNF-{alpha})-activated neutrophils phagocytose and eliminate bacteria by using such oxidants as hydrogen peroxide (H2O2) and hypochlorous acid (HOCl), which is produced from H2O2 by myeloperoxidase (MPO). Thereafter, neutrophils eventually undergo apoptosis to prevent excessive inflammation. However, it is unclear how this process is regulated. Here, we show that cotreatment of TNF-{alpha}-resistant neutrophilic HL-60 cells with taurine chloramine (TauCl), a detoxified form of HOCl, and TNF-{alpha} renders them susceptible to apoptosis, mostly by preventing nuclear factor-{kappa}B (NF-{kappa}B) activation. Of several NF-{kappa}B target genes tested, FLICE inhibitory protein short form (FLIPS) was specifically down-regulated by TauCl. TNF-{alpha}/TauCl cotreatment-induced apoptosis was largely blocked by stable expression of FLIPS. Cotreatment with TNF-{alpha} and H2O2 promoted apoptotic signaling via MPO activation and subsequent attenuation of FLIPS expression. TNF-{alpha} priming with H2O2 or bacteria caused MPO-dependent apoptosis in human neutrophils. However, FLIPS knock-down by siRNA did not affect the viability of cells treated with TNF-{alpha}, implying that TauCl may affect another pathway in TNF-{alpha}-driven apoptosis. Indeed, oxidization of thioredoxin-1 (Trx-1) by TauCl induced the activation of apoptosis signal-regulating kinase 1 (ASK1) and cJun N-terminal kinase (JNK), thereby triggering TNF-{alpha}-mediated apoptosis. Taken together, these results indicate that the antiapoptotic signaling induced by TNF-{alpha} via NF-{kappa}B activation can be altered to promote apoptosis via H2O2-MPO-mediated FLIPS down-regulation and JNK activation.

Key Words: taurine chloramine • ASK1 • TNF


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Neutrophils are polymorphonuclear leukocytes that play an essential role in innate immunity against microorganisms [1 , 2 ]. When resting neutrophils are stimulated by priming mediators such as TNF-{alpha}, NADPH oxidase is phosphorylated, enabling it to produce a large amount of O2, which is immediately converted to hydrogen peroxide (H2O2) [3 ]. Primed neutrophils bind bacteria via specific receptors and subsequently phagocytose them. Myeloperoxidase (MPO), a lysosomal heme enzyme, is released into the phagosome by degranulation. There, using H2O2 as a substrate, MPO generates hypochlorous acid (HOCl), which efficiently destroys microorganisms in the phagosome [4 5 6 7 ].

If HOCl is produced in excess, however, it can damage cytosolic components as well. To prevent such self-damage, HOCl is able to react with amino acids to form chloramines [8 ]. Taurine chloramine (TauCl) is the most common chloramine because taurine is the most abundant free amino acid in the neutrophil cytoplasm [9 ]. Chloramines are much less cytotoxic to neutrophils than HOCl and therefore chloramine production in the cytosol is considered to be a detoxification reaction [10 ]. After neutrophils have killed bacteria, they are destined to undergo apoptosis and be subsequently cleared by macrophages, ensuring the timely termination of inflammation [11 12 13 ]. Interestingly, neutrophils from patients with chronic granulomatous disease (CGD), in which NADPH oxidase is impaired, exhibit delayed apoptosis and granuloma development [14 15 16 ]. This suggests that phagocytosis-related reactive oxygen species (ROS) play an important role in neutrophil apoptosis. However, the regulation of neutrophil cell death by these ROS is not well understood.

Nuclear factor-{kappa}B (NF-{kappa}B) is a transcription factor that controls the expression of a variety of genes, including proinflammatory mediators (e.g., iNOS and IL-8), as well as antiapoptotic molecules, such as FLICE inhibitory protein (FLIP), X-chromosome-linked iap (XIAP), and Bfl-1/A1 [17 18 19 ]. In general, the binding of TNF-{alpha} to its specific receptor initiates the activation of kinases such as TAK1 and IKK, leading to the proteasomal degradation of I{kappa}B{alpha} and the consequent activation of NF-{kappa}B [reviewed in 20 ]. Control of NF-{kappa}B activation is a necessary part of the innate immune response. Previously, we showed that TauCl inhibits NF-{kappa}B activation by oxidizing I{kappa}B{alpha}, thereby preventing its degradation [21 ]. In addition, we and other groups have shown that TauCl attenuates the production of inflammatory cytokines such as IL-8, iNOS, and COX-2, which prevent excessive and prolonged inflammation [11 , 21 22 23 24 , reviewed in 25 ].

In addition to activating NF-{kappa}B, TNF-{alpha} also triggers apoptosis by structuring a large cytosolic complex known as complex II, which consists of TRADD, RIP, FADD, and caspase-8 [26 ]. In complex II, activated caspase-8 cleaves procaspase-3 into its active form. Caspase-8 activation is blocked by FLIP, and caspase-3 activation is directly suppressed by XIAP [27 28 29 30 ]. To date, three FLIP isoforms (FLIPL, FLIPS, and FLIPR) have been identified. FLIPL is structurally similar to caspase-8 in that it contains two tandem death effector domains (DEDs) and an inactive caspase-like domain. FLIPS and FLIPR harbor the same DEDs as FLIPL but have distinct shorter C-terminal sequences. All of the FLIP isoforms efficiently inhibit caspase-8 activation by competitive interference via a homotypic DED-DED interaction; less clear is how they control neutrophil cell death.

We studied H2O2-MPO-related apoptosis in TNF-{alpha}-primed neutrophils. We also investigated the effects of TauCl on cJun N-terminal kinase (JNK), which may promote apoptosis downstream of the TNF receptor.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell culture and preparation of human neutrophils
Promyelocytic leukemia HL-60 cells and HEK293T cells from American Type Culture Collection (Manassas, VA, USA) were cultured as described previously [21 ]. Exponentially growing HL-60 cells were differentiated into neutrophilic cells in the presence of 1.3% DMSO for 4 days. Human neutrophils were freshly isolated from the venous blood of healthy volunteers by centrifugation through Ficoll-Paque Plus (Amersham Biosciences, Piscataway, NJ, USA) following dextran sedimentation. After hypotonic lysis of the erythrocytes, the residual cells (>96% neutrophils by May-Grünwald-Giemsa staining) were resuspended in RPMI 1640.

Cell viability and DNA fragmentation assays
Cell (5 x 104) viability was assessed using a WST-8 kit (Dojindo, Japan), unless otherwise described. To detect DNA fragmentation, treated cells were washed twice with PBS and kept in 100% ethanol for 1 h at 4°C. The cells were then centrifuged, resuspended in phosphate citrate buffer (PCB) containing 0.2 M Na2HPO4 and 4 mM citric acid, and incubated at room temperature for 20 min. After centrifugation at 10,000 g for 5 min at 4°C, the RNA and protein in the supernatant were digested by successive incubation with 0.1 mg/ml RNase A (Sigma, St. Louis, MO, USA) at 37°C for 1 h and with 0.2 mg/ml proteinase K (Sigma) at 50°C for 30 min. The solution was then electrophoresed in a 2% agarose gel and inspected under UV light for DNA fragmentation.

Measurement of caspase activity
The activities of caspases-3 and -8 were measured using the corresponding caspase detection kits (MBL, Nagoya, Japan). Briefly, treated cells were lysed with the buffers provided in the kits and centrifuged for 1 min at 10,000 g. Each supernatant was incubated in a 96-well plate with either 200 µM DEVD-pNA or 200 µM IETD-pNA to assay the activity of caspase-3 or caspase-8, respectively. The optical density of each solution was measured at 405 nm using a microplate reader (Bio-Rad, Hercules, CA, USA).

Antibodies and reagents
The antibodies used for Western blot analysis were purchased from the following companies: caspase-3, XIAP, HA, and thioredoxin-1 (Trx-1) from Santa Cruz Biotechnology (Santa Cruz, CA, USA), caspase-8 from MBL, and FLIP from Alexis (San Diego, CA, USA). Anti-JNK and -p-JNK (Thr183/Tyr185) antibodies were obtained from Cell Signaling Technology (Danvers, MA, USA). TNF-{alpha} and 4-aminobenzoic hydrazide (ABAH) were from Sigma. Caspase inhibitors (zVAD-fmk, zDEVD-fmk, zIETD-fmk, and zLEHD-fmk) and BAY11-7082 were purchased from Calbiochem (La Jolla, CA, USA). SP600125 was obtained from BIOMOL (Plymouth Meeting, PA, USA). All other reagents were of analytical grade. TauCl was freshly prepared, as described previously [21 ].

RT-PCR
RNA was isolated from cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA). Reverse transcription was performed with SuperScript III reverse transcriptase and oligo (dT)12-18 primer (Invitrogen). The synthesized first-strand DNA was used as a template for PCR. The sequences of the PCR primers were as follows: FLIPL sense, ccataatgggagaagtaaag; FLIPL antisense, acatcctcctgatgtgatgc; FLIPS sense, cgaggcaagataagcaagg; FLIPS antisense, cacatggaacaatttccaag; XIAP sense, agggacaagaatatataaac; XIAP antisense, tcctcttgcaggcgccttag; Bfl-1 sense, gttgtgtccgtagacactgc; Bfl-1 antisense, aacttctagaaaagtcatcc; β-actin sense, atggatgatgatatcgccgc; and β-actin antisense, aggggggcctcggtcagcag.

Cloning of FLIPS and establishment of an HL-60 cell line stably expressing FLIPS
FLIPS cDNA was obtained from HEK293T cells and subcloned into either pcDNA3 with a FLAG tag or pEF with an HA tag and a puromycin-resistance gene. Ten micrograms of plasmid were transfected into 1 x 107 HL-60 cells by electroporation at 250 V and 800 µF with an Electro Cell Manipulator 600 (BTX, Holliston, MA, USA). A clone stably expressing HA-FLIPS was identified by selection with 1 mg/ml puromycin.

Determination of Trx-1 redox status
To distinguish oxidized Trx-1 [Trx-1(SS)] from its reduced form [Trx-1(SH)2], Trx-1 was treated with TauCl under SDS-free conditions and subjected to native PAGE, as described elsewhere [31 , 32 ]. Briefly, Trx-1 was treated with TauCl prepared in phosphate buffer at 37°C for 30 min and then incubated at 37°C for 30 min in an alkylation buffer containing 8 M urea, 100 mM Tris-HCl (pH 8.2), 1 mM EDTA, and 30 mM iodoacetate. After acetone precipitation, the samples were treated with 1 mM dithiothreitol at 37°C for 30 min. Subsequently, 10 mM iodoacetamide was added, and the mixture was incubated at 37°C for 30 min before being mixed with sample buffer (20 mM Tris-HCl, pH 6.8, 10% glycerol, and 0.01% bromophenol blue) and subjected to native PAGE (4% stacking gel and 15% separating gel). The proteins were transferred to a PVDF membrane and immunoblotted with anti-Trx-1 antibody.

RNA interference
To knock down the expression of FLIPS and ASK1, the following RNA oligonucleotides were designed: FLIPS sense, ccuaugcccauuguccugaucugaa; FLIPS antisense, uucagaucaggacaaugggcauagggu; ASK1 sense, ccgacuggcugagagugaauu; and ASK1 antisense, uucacucucagccagucgguu. The annealed oligos were introduced into HL-60 cells by electroporation at 250 V and 800 µF. The cells were then cultured for 24 h, and the electroporation was repeated. After an additional 48 h, the cells were exposed to each experimental reagent.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Induction of apoptosis by TauCl in TNF-{alpha}-activated neutrophilic HL-60 cells
Given that TauCl inhibits the activation of NF-{kappa}B by TNF-{alpha} [21 ], we investigated whether TauCl triggers apoptosis in TNF-{alpha}-stimulated neutrophilic HL-60 cells. Although cell viability was not significantly altered by exposure to TNF-{alpha} (20 ng/ml, 4 h) or TauCl (1 mM, 4 h), cotreatment with TNF-{alpha} and TauCl resulted in a 72% reduction in viability (Fig. 1A ). Furthermore, cotreatment with TNF-{alpha} (20 ng/ml) and an NF-{kappa}B inhibitor BAY11-7082 (5 µM) decreased cell viability. Similar data were obtained by microscopic observation of morphological changes in cells treated with TNF-{alpha} and TauCl (not shown). These results, together with those of a previous study [21 ], suggest that TauCl inhibits NF-{kappa}B activation and subsequently triggers TNF-{alpha}-mediated cell death. Pretreatment of cells with a pan-caspase inhibitor (zVAD-fmk, 10 µM) for 30 min markedly improved cell survival, indicating that the cells had died in a caspase-dependent manner (Fig. 1B) . To confirm that the cell death was apoptotic, chromosomal DNA was extracted from the cells and electrophoresed in agarose gels. A clear smear and several DNA ladders were detected in the cells cotreated with TNF-{alpha} and TauCl compared with the untreated or TNF-{alpha}-treated cells (Fig. 1C , lanes 1, 2, and 4). TauCl alone produced minor smearing (lane 3). These results indicate that cotreatment with TNF-{alpha} plus TauCl or BAY11-7082 initiates apoptosis in neutrophilic HL-60 cells.


Figure 1
View larger version (25K):
[in this window]
[in a new window]

 
Figure 1. Apoptosis in neutrophilic HL-60 cells induced by cotreatment with TNF-{alpha} and TauCl. (A) HL-60 cells were differentiated into neutrophil-like cells by incubation with 1.3% DMSO for 4 days. The cells (5x104) were resuspended in fresh medium and then treated with TNF-{alpha} (20 ng/ml) (solid bar) in the presence of TauCl (1 mM) or BAY11-7082 (5 µM) for 4 h. Cell viability was determined using a WST-8 kit. Untreated cells are represented by an open bar. The data are given as means ± SD (n=3). (B) Neutrophilic HL-60 cells pretreated with zVAD-fmk (10 µM) for 30 min were exposed to TNF-{alpha} (20 ng/ml) and TauCl (1 mM) for 4 h, and then cell viability was measured. The data are given as means ± SD (n=3). (C) Neutrophilic HL-60 cells were treated with TNF-{alpha} (20 ng/ml) and TauCl (1 mM) for 4 h. The cells were then washed with PBS (–), and their genomic DNA was extracted as described in the Materials and Methods and subjected to 2% agarose gel electrophoresis. (D and E) Neutrophilic HL-60 cells were pretreated with 10 µM each caspase inhibitor (caspase-3, zDEVD-fmk; caspase-8, zIETD-fmk; caspase-9, zLEHD-fmk) for 30 min and then treated with TNF-{alpha} (20 ng/ml) and TauCl (1 mM) for 4 h. After washing with PBS (–), the cells were assayed for caspase-3 activity (means±SD, n=3) (D) or tested by Western blot analysis using antibodies against caspase-3 and caspase-8 (E).

 
Most caspase-dependent cell death involves caspase-3 activation, and thus we measured caspase-3 activity in vitro in neutrophilic HL-60 cells treated with TNF-{alpha} and TauCl. Caspase-3 activity was greatly elevated in cells cotreated with TNF-{alpha} and TauCl (Fig. 1D) . To determine which caspase was responsible for the activation of caspase-3, the cells were pretreated with 10 µM caspase-8 and caspase-9 inhibitors (zIETD-fmk and zLEHD-fmk, respectively) for 30 min. Caspase-3 activation was markedly inhibited with zIETD-fmk, whereas zLEHD-fmk had little effect (Fig. 1D) . The activation of caspase-3 by cotreatment with TNF-{alpha} and TauCl was confirmed by Western blot analysis against the activated form of caspase-3 (p17) (Fig. 1E , upper, lane 4); p17 was not observed in cells that had been pretreated with zIETD-fmk (lane 5). These results indicate that caspase-3 activation depends primarily on caspase-8 and partially on caspase-9.

Next, we investigated caspase-8 activation in cells treated under similar conditions. Two spliced forms of procaspase-8, p41 and p43, were observed in cells treated with TNF-{alpha} and TauCl (Fig. 1E , lower, lane 4). However, pretreatment with zIETD-fmk for 30 min inhibited the splicing of procaspase-8 (lane 5). Taken together, these results indicate that TNF-{alpha}/TauCl cotreatment leads to caspase-8 activation, followed by caspase-3 activation.

Attenuation of TNF-{alpha}-induced FLIPS expression by TauCl
The inhibition of NF-{kappa}B activation by TauCl suppresses the expression of inflammatory genes such as iNOS and IL-8 [21 22 23 24 ]. Anti-apoptotic genes such as FLIP, XIAP, and Bfl-1/A1 are also under the control of NF-{kappa}B [17 18 19 ]. Therefore, we attempted to identify which genes are suppressed by TauCl in neutrophilic HL-60 cells. RT-PCR analyses revealed that FLIPS was expressed even without stimulation and that its expression was enhanced by TNF-{alpha} (Fig. 2A , lanes 1 and 2). Basal as well as enhanced FLIPS expression was completely attenuated by TauCl in the presence and absence of TNF-{alpha} (Fig. 2A , lanes 3 and 4). In contrast, FLIPL expression was mildly down-regulated under similar conditions, and that of XIAP and Bfl-1 was unaffected. In addition, FLIPS protein expression was markedly induced by TNF-{alpha} (Fig. 2B , lane 2) and greatly reduced in TauCl-treated cells in the presence and absence of TNF-{alpha}, whereas the level of XIAP did not change (Fig. 2B , lanes 3 and 4). Although FLIPL expression was detected by RT-PCR, FLIPL was barely detectable by Western blot analysis, indicating that FLIPS may be the major isoform involved in preventing apoptosis in TNF-{alpha}-stimulated neutrophilic HL-60 cells.


Figure 2
View larger version (36K):
[in this window]
[in a new window]

 
Figure 2. Effect of TNF-{alpha} and TauCl on antiapoptotic gene expression. (A) After treatment of neutrophilic HL-60 cells with TNF-{alpha} (20 ng/ml) and TauCl (1 mM) for 4 h, RNA was extracted, and gene expression was assayed by RT-PCR. β-actin was used as an internal control. (B) Neutrophilic HL-60 cells were treated with TNF-{alpha} (20 ng/ml) and TauCl (1 mM) for 4 h, and then their cell extracts were analyzed by Western blot analysis for FLIP (upper) and XIAP (lower) expression. (C) pcDNA3-FLAG-FLIPS (0.1 µg) was transfected into HEK293T cells, and 48 h later, the cells were treated with TauCl (1 mM) for 4 h. The cells were then lysed, and their extracts were examined by Western blot analysis with anti-FLAG antibody.

 
To confirm that the inhibitory effect of TauCl on FLIPS expression is due to the results of reduced transcriptional activity of NF-{kappa}B, the effect of TauCl on FLIPS expression was studied using HEK293T cells transfected with pcDNA3-FLAG-FLIPS. The FLIPS expression driven by T7 promoter was unaffected by TauCl (Fig. 2C) ; therefore, TauCl probably inhibits FLIPS expression in neutrophilic HL-60 cells by blocking NF-{kappa}B activation and not by affecting any post-transcriptional events.

Blockade of TNF-{alpha}/TauCl-induced caspase-8 activation by constitutive HA-FLIPS expression
To examine whether decreased FLIPS expression is responsible for TNF-{alpha}/TauCl-induced apoptosis, an HA-FLIPS expression vector was stably transfected into HL-60 cells to establish a new cell line, HL-60/HA-FLIPS. As a control, the empty vector was also transfected into HL-60 cells, generating the line HL-60/vec. As shown in Fig. 3A , HA-FLIPS was stably expressed in the HL-60/HA-FLIPS line. Cell viability following TNF-{alpha}/TauCl co-treatment was markedly improved in the HL-60/HA-FLIPS cells (Fig. 3B) . In addition, even though caspases-8 and -3 were activated in HL-60/vec cells treated with TNF-{alpha} and TauCl, no activation was detected in the HL-60/HA-FLIPS cells (Fig. 3C , lanes 2 and 4). These results strongly indicate that FLIPS expression effectively blocks TNF-{alpha}/TauCl-induced apoptosis in neutrophilic HL-60 cells.


Figure 3
View larger version (24K):
[in this window]
[in a new window]

 
Figure 3. Inhibition of caspase activation by stable expression of FLIPS. (A) The expression of HA-FLIPS in HL-60 cells was confirmed by Western blot analysis with anti-FLIP antibody. (B) Following the treatment of neutrophilic HL-60/vec or HL-60/HA-FLIPS cells with or without TNF-{alpha} (20 ng/ml) and TauCl (1 mM) for 4 h, cell viability was determined. The data are given as means ± SD (n=3). (C) Each neutrophilic cell line was treated with TNF-{alpha} (20 ng/ml) and TauCl (1 mM) for 4 h, the cells were harvested, and the expression of caspase-8, caspase-3, and FLIPS was analyzed by Western blot analysis.

 
Induction of apoptosis in HL-60 cells by TNF-{alpha} and H2O2 via the H2O2-MPO system
Under physiological conditions, TauCl is intracellularly synthesized from taurine and HOCl, which is generated by MPO from H2O2 and Cl during phagocytosis. Therefore, we hypothesized that, like TauCl, H2O2 may facilitate apoptosis in the presence of TNF-{alpha}. MPO is expressed in HL-60 cells, and the intracellular taurine concentration is ~1 mM. In addition, H2O2 (100 µM) effectively attenuates NF-{kappa}B activation [21 ]. Therefore, neutrophilic HL-60 cells were cotreated with 20 ng/ml TNF-{alpha} and 100 µM H2O2 and then inspected for DNA fragmentation (Fig. 4A , lane 3). Fragmentation was observed in TNF-{alpha}/H2O2 treated cells and largely blocked by pre-treatment of the cells with the MPO inhibitor (ABAH, lane 4), but unaffected by ABAH pre-treatment in TNF-{alpha}/TauCl-treated cells (lanes 5 and 6). Activation of caspases-8 and -3 was observed in cells treated with TNF-{alpha} and H2O2 (Fig. 4B , lane 3); pretreatment with ABAH blocked this activation (lane 4). Thus, H2O2 triggered apoptosis when administered with TNF-{alpha} and MPO activity was required for the outcome. FLIPS expression was totally abrogated by TNF-{alpha}/ H2O2 cotreatment, but it was rescued by pretreatment with ABAH (Fig. 4B , lanes 3 and 4). XIAP expression was completely unaffected by similar treatments. Taken together, these results indicate that TauCl may be synthesized intracellularly by MPO, down-regulates FLIPS expression, and triggers apoptosis in HL-60 cells.


Figure 4
View larger version (38K):
[in this window]
[in a new window]

 
Figure 4. Induction of DNA fragmentation, caspase activation, and FLIPS down-regulation by the H2O2-MPO system in HL-60 cells. After pretreatment with the MPO inhibitor ABAH (0.5 mM, 30 min), neutrophilic HL-60 cells were treated with H2O2 (100 µM) or TauCl (1 mM) in the presence of TNF-{alpha} (20 ng/ml). (A) Genomic DNA fragmentation was assessed by electrophoresis in a 2% agarose gel. (B) The expression of caspase-8, caspase-3, FLIPS, and XIAP was analyzed by Western blot analysis.

 
Induction of MPO-dependent cell death by TNF-{alpha} and H2O2 or bacteria in human neutrophils
To examine whether the H2O2-MPO system actually functions in proapoptotic signaling, freshly isolated human neutrophils were treated with either TNF-{alpha} or H2O2, and no effect on cell viability was observed with either treatment (Fig. 5A ). In contrast, cotreatment with TNF-{alpha} and H2O2 markedly reduced cell viability. As was the case with the HL-60 cells, the reduction in cell viability was MPO-dependent and apoptotic, because pretreatment with ABAH and zVAD-fmk attenuated the effect. To further investigate whether TNF-{alpha} promotes apoptosis in neutrophils exposed to bacteria, neutrophils were incubated with Escherichia coli for 4 h in the presence of TNF-{alpha} (Fig. 5B) . In the presence of both TNF-{alpha} and bacteria, the viability of the neutrophils was reduced by 47% compared with that of cells exposed to bacteria alone. This reduction was blocked by ABAH pretreatment and partially but significantly attenuated by pretreatment with zVAD-fmk. Furthermore, TNF-{alpha}-induced FLIPS expression was inhibited in the presence of H2O2 (Fig. 5C , lane 3) but was completely rescued by ABAH pretreatment (lane 4). In contrast, FLIPL was not expressed regardless of the presence of TNF-{alpha}. Thus, these results indicate that, even in human neutrophils, TNF-{alpha} priming with H2O2 or bacteria triggers apoptosis by altering FLIPS expression in an MPO-dependent manner. ABAH restored cell viability, but zVAD-fmk did not, suggesting that neutrophils may die via an ROS-dependent but nonapoptotic process.


Figure 5
View larger version (21K):
[in this window]
[in a new window]

 
Figure 5. Induction of apoptosis by H2O2 or bacteria in TNF-{alpha}-primed human neutrophils. Freshly isolated human neutrophils (5x104) were pretreated with ABAH (0.5 mM) or zVAD-fmk (10 µM) for 30 min and then treated with H2O2 (1 mM) (A) or bacteria (1x106) (B) in the presence of TNF-{alpha} (20 ng/ml). After 4 h, cell viability was assessed by WST-8 assay (n=4) (A) or trypan blue exclusion (n=4) (B). The data are given as means ± SD. (C) The expression of FLIPS in treated human neutrophils was analyzed by Western blot analysis with anti-FLIP antibody.

 
Effect of FLIPS knock-down by siRNA on cell viability
To examine how the level of endogenous FLIPS affects cell viability, FLIPS expression was knocked down by siRNA. As shown in Fig. 6A , TNF-{alpha}-induced FLIPS expression was down-regulated by siRNA in HL-60 cells. Unexpectedly, the knock-down of FLIPS had no effect on the viability of cells treated with TNF-{alpha}, while TauCl (1 mM, 4 h) induced apoptosis (Fig. 6B) . These results indicate that, even when FLIPS expression was suppressed by siRNA, the cells remained resistant to TNF-{alpha}.


Figure 6
View larger version (21K):
[in this window]
[in a new window]

 
Figure 6. Effect of FLIPS knock-down on cell viability. FLIPS-specific siRNA (20 nM) was introduced into HL-60 cells as described in the Materials and Methods. (A) The cells were stimulated with TNF-{alpha} (20 ng/ml) for 4 h, and then their extracts were subjected to Western blot analysis with anti-FLIP antibody. (B) Cells were incubated with or without TauCl (1 mM) in the presence of TNF-{alpha} (20 ng/ml). After 4 h, TNF-{alpha}-dependent changes in cell viability were determined by WST-8 assay. The data are given as means ± SD (n=3).

 
Activation of the ASK1-JNK pathway by TauCl
To address why the knock-down of FLIPS expression alone did not produce apoptosis in TNF-{alpha}-treated cells, we examined whether TauCl might have an alternative role in TNF-{alpha}-mediated apoptosis. As JNK is known to be activated by TNF-{alpha} and prolonged JNK activation induces apoptosis [33 ], we investigated the potential role of JNK in the apoptosis of cells treated with TNF-{alpha} and TauCl. As shown in Fig. 7A , pretreatment with the JNK inhibitor SP600125 inhibited TNF-{alpha}-dependent cell death. Treatment of cells with TNF-{alpha} and TauCl for 30 min strongly induced phosphorylation of JNK compared with that induced by treatment with TNF-{alpha} alone (Fig. 7B , lanes 2 and 4). TNF-{alpha}-induced JNK phosphorylation disappeared following exposures of up to 4 h, whereas TauCl treatment resulted in sustained JNK phosphorylation regardless of the presence of TNF-{alpha} (lanes 6-8). This indicates the involvement of JNK phosphorylation in apoptosis. To further clarify mechanisms underlying JNK activation by TauCl, siRNA against ASK1 was performed in HL-60 cells. The results indicate that the JNK phosphorylation by TauCl in the presence of TNF-{alpha} is blocked by the reduced expression of ASK1 (Fig. 8A , lanes 3, 4, 7, and 8). Trx-1 is a physiological inhibitor of ASK1; the oxidation of Trx-1 triggers its release from ASK1, which is activated in the process [34 ]. Therefore, we examined the effect of TauCl on the redox status of Trx-1 by native gel analysis. Trx-1 was detected in its reduced form following exposure to 1 mM DTT for 30 min (Fig. 8B , lanes 1 and 2), confirming that this assay is appropriate for its previously reported purpose [31 , 32 ]. When Trx-1 was treated with TauCl (10 and 30 µM) for 30 min, Trx-1 was greatly oxidized in a dose-dependent manner (lanes 3 and 4). Taken together, these results strongly suggest that TauCl directly oxidizes Trx-1, thereby activating the ASK1-JNK pathway, which leads to TNF-{alpha}-mediated apoptosis.


Figure 7
View larger version (22K):
[in this window]
[in a new window]

 
Figure 7. Effect of a JNK inhibitor on TNF-{alpha}-dependent cell death. (A) Cells preincubated with 5 µM SP600125 for 30 min were incubated with TNF-{alpha} (20 ng/ml) and TauCl (1 mM) for an additional 4 h. Cell viability was then assessed by WST-8 assay. The data are given as means ± SD (n=3). (B) Cells treated with TNF-{alpha} (20 ng/ml) and TauCl (1 mM) for either 0.5 h or 4 h. The treated cells were then harvested and subjected to Western blot analysis with anti-p-JNK and anti-JNK antibodies.

 

Figure 8
View larger version (57K):
[in this window]
[in a new window]

 
Figure 8. Involvement of Trx-1 and ASK1 in TauCl-mediated JNK activation. (A) Cells were treated with TNF-{alpha} (20 ng/ml) and TauCl (1 mM) for 4 h before being analyzed for JNK phosphorylation by Western blot analysis. (B) Recombinant Trx-1 was treated with DTT (1 mM) and TauCl (10 and 30 µM) at 37°C for 30 min in vitro and then sequentially treated with 30 mM iodoacetate, 1 mM dithiothreitol, and 10 mM iodoacetamide to analyze the redox status of Trx-1. The proteins were subjected to native PAGE in 15% gels, and the protein bands were transferred to a PVDF membrane and immunoblotted with anti-Trx-1 antibody.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Recently, it was reported that TauCl induces apoptosis in B cells by activating caspase-9 [35 , 36 ]. Emerson et al. [36 ] showed that treatment of B cells with 1 mM TauCl for 24 h induced less than 30% cell death, and after 48 h, apoptosis was due primarily to mitochondrial damage and caspase-9 activation. In our experiments, we observed ~15% cell death by TauCl treatment (1 mM, 4 h) (Fig. 1A and 4A) . Furthermore, TauCl induced slight activation of caspase-3 (Fig. 1D) . A small amount of DNA fragmentation was also observed in cells treated with TauCl (Fig. 1C , lane 3). These results indicate that TauCl itself has a potential to induce apoptosis. Both caspases-8 and -9 appear to be involved in the caspase-3 activation, because their respective inhibitors attenuated caspase-3 activation to similar extents (data not shown). In contrast, cotreatment of HL-60 cells with TauCl and TNF-{alpha} resulted in marked apoptosis primarily due to caspase-8 activation rather than caspase-9 activation (Fig. 1D) . TauCl/TNF-{alpha} cotreatment did not affect the expression of XIAP, an effective caspase-9 inhibitor, or Bfl-1, an antiapoptotic mitochondrial molecule (Fig. 2A and 2B) . These results indicate that in the presence of TNF-{alpha}, TauCl promotes apoptosis in neutrophilic HL-60 cells primarily via caspase-8/-3 activation.

Upon bacterial invasion, TNF-{alpha} is secreted from local immune cells and liver [37 ]. TNF-{alpha} then activates neutrophils, enabling them to carry out phagocytosis and respiratory burst by phosphorylating NADPH oxidase [3 ]. Cells with genetic defects in the NADPH oxidase system show reduced production of O2 and bactericidal activity with delayed apoptosis and granuloma development [14 15 16 , 38 ]. In the current study, we showed that both neutrophilic HL-60 cells and human neutrophils treated with TNF-{alpha} are susceptible to apoptosis by cotreatment with TauCl, H2O2, or even bacteria. In the case of treatment with H2O2, DNA fragmentation, caspase-8/-3 activation, and reduced FLIPS expression were observed (Fig. 4) . These alterations were blocked by pretreatment with ABAH, a specific inhibitor of MPO. Furthermore, ABAH failed in inhibition of the DNA fragmentation caused by TNF-{alpha}/TauCl cotreatment (Fig. 4A , lanes 5 and 6). These results indicate that the H2O2-MPO system and generated ROS play important roles in apoptosis triggered by H2O2 and bacteria. Therefore, our findings may explain why neutrophils deficient in ROS generation are resistant to apoptosis.

Ahmad et al. [39 ] reported that when HL-60 cells were treated with 100 µM H2O2 for 18 h, less than 40% of the cells underwent apoptosis. They also observed significant caspase-8 and caspase-3 activation beginning at 4 h, which increased rapidly after 8 h and reached its maximum at 12 h. These data suggest that ~10% of cells may undergo cell death after 4 h of exposure to 100 µM H2O2. In addition, we previously showed that treatment with 100 µM H2O2 suppressed TNF-{alpha}-mediated I{kappa}B{alpha} degradation and NF-{kappa}B activation in HL-60 cells [21 ]. Pretreatment with the MPO inhibitor ABAH restored NF-{kappa}B activation, indicating that the effect of H2O2 on the NF-{kappa}B pathway is not irreversible. Therefore, treatment of HL-60 cells with 100 µM H2O2 is sufficient to induce TNF-{alpha}-mediated apoptosis. In contrast, similarly treated human neutrophils did not undergo TNF-{alpha}-dependent cell death in our preliminary experiment. A concentration of 1 mM H2O2 was ultimately necessary to induce significant cell death. Although we cannot be exact about the endogenous concentration of H2O2 in neutrophils during bacterial infection, more than 60 nmol of H2O2 were produced in 1 x 106 neutrophils treated with PMA, and more than 6 nmol of H2O2 were produced in 1 x 106 neutrophils treated with ionomycin [40 ]. We estimate that the intracellular volume of these cells is around a few microliters. If so, the concentration of endogenous H2O2 should exceed 1 mM. The low sensitivity of neutrophils to H2O2 might be partly because catalase inhibition is required to induce apoptosis in human neutrophils [40 ].

FLIP is highly expressed in heart, muscle, and lymphoid tissues [27 ], and three isoforms have been identified: FLIPL, FLIPS, and FLIPR. FLIPR was most recently isolated from Raji cells, and its inhibitory role in B cell apoptosis has been indicated [41 ]. The antiapoptotic function of FLIPL in isolated leukocytes and cell lines has been extensively studied [17 , 26 27 28 ]. FLIPS is expressed in T cells [17 , 41 , 42 ]. A distinct role for FLIPS has not been elucidated, however. We have identified for the first time FLIPS induction by TNF-{alpha} in neutrophilic HL-60 cells and human neutrophils (Fig. 2B 4B and 5C) . Furthermore, we have shown that induced FLIPS expression is critical for preventing apoptosis (Fig. 3) . Although FLIPL and FLIPS have similar affinities for caspase-8 and both inhibit the activation of caspase-8 by TNF-{alpha}, FasL, and TRAIL, FLIPL may promote apoptosis because it facilitates caspase-8 activation through its C-terminal caspase-like domain, which FLIPS does not possess [27 , 43 , 44 ]. In this context, FLIPS may be an exclusive inhibitor of caspase-8 and a dominant regulator of cell fate in neutrophils.

In addition to the identification of FLIPS as a target for down-regulation by TauCl treatment, we also found that TauCl directly oxidizes Trx-1 and activates ASK1, thereby contributing to sustained JNK phosphorylation (Fig. 7B and 8) . Pharmacological experiments indicated that JNK activation is required for TNF-{alpha}/TauCl-induced apoptosis (Fig. 7A) . These results may explain why reduced FLIPS expression by siRNA failed to induce apoptosis in TNF-{alpha}-treated cells (Fig. 6) . Although JNK was transiently phosphorylated in response to TNF-{alpha}, the effect disappeared after 4 h. On the basis of our current and previous data [21 ], we propose that in TNF-{alpha}-primed neutrophils TauCl serves as a proapoptotic oxidant by targeting I{kappa}B{alpha} to suppress NF-{kappa}B, thereby down-regulating FLIPS expression, and by targeting Trx-1 to activate ASK1, leading to sustained JNK activation. It is likely that both of these independent events concertedly facilitate apoptosis in TNF-{alpha}-primed neutrophils.

How JNK phosphorylation by TauCl leads to TNF-{alpha}-mediated apoptosis remains unclear. One possibility is that JNK phosphorylation is necessary for the activation of caspase-8 via disruption of the TRAF2-cIAP complex [33 ]. In this way, JNK activation may initially promote Bid cleavage and caspase-8 activation through mechanisms involving the release of Smac/DIABLO from mitochondria. It has been shown that TNF-{alpha} prevents both cytochrome c release from mitochondria and caspase-9 activation [33 ]. This is consistent with our results showing that caspase-8 rather than caspase-9 is dominantly responsible for the induction of apoptosis by TNF-{alpha} and TauCl (Fig. 1D) . The FLIPS down-regulation by TauCl should help accelerate caspase-8 activation by TNF-{alpha} and TauCl-mediated JNK activation because FLIPS appears to be the most highly expressed inhibitor of caspase-8 in neutrophils.

In summary, our results indicate that H2O2-MPO-mediated FLIPS down-regulation and JNK activation initiate apoptosis when TNF-{alpha}-primed neutrophils phagocytose bacteria. Additional studies on the mechanisms underlying apoptosis in neutrophils may explain the significance of the signaling pathways that are initiated to prevent excessive inflammation in vivo during phagocytosis.


    ACKNOWLEDGEMENTS
 
A. K. and Y. M. were partly supported by grants-in-aid from the Ministry of Education, Culture, Sports, Science and Technology. This work was supported in part by the Foundation for Promotion of Cancer Research in Japan (A. K.).

Received April 27, 2007; revised June 24, 2007; accepted July 24, 2007.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Swain, S. D., Rohn, T. T., Quinn, M. T. (2002) Neutrophil priming in host defense: role of oxidants as priming agents Antioxid. Redox Signal. 4,69-83[CrossRef][Medline]
  2. Sheppard, F. R., Kelher, M. R., Moore, E. E., McLaughlin, N. J. D., Banerjee, A., Silliman, C. C. (2005) Structural organization of the neutrophil NADPH oxidase: phosphorylation and translocation during priming and activation J. Leukoc. Biol. 78,1025-1042[Abstract/Free Full Text]
  3. Dang, P. M.-C., Stensballe, A., Boussetta, T., Raad, H., Dewas, C., Kroviarski, Y., Hayem, G., Jensen, O. N., Gougerot-Pocidalo, M.-A., El-Benna, J. (2006) A specific p47phox-serine phosphorylated by convergent MAPKs mediates neutrophil NADPH oxidase priming at inflammatory sites J. Clin. Invest. 116,2033-2043[CrossRef][Medline]
  4. Klebanoff, S. J. (2005) Myeloperoxidase: friend and foe J. Leukoc. Biol. 77,598-625[Abstract/Free Full Text]
  5. Hampton, M. B., Kettle, A. J., Winterbourn, C. C. (1996) Involvement of superoxide and myeloperoxidase in oxygen-dependent killing of Staphylococcus aureus by neutrophils Infect. Immun. 64,3512-3517[Abstract]
  6. Aratani, Y., Koyama, H., Nyui, S., Suzuki, K., Kura, F., Maeda, N. (1999) Severe impairment in early host defense against Candida albicans in mice deficient in myeloperoxidase Infect. Immun. 67,1828-1836[Abstract/Free Full Text]
  7. Hirche, T. O., Gaut, J. P., Heinecke, J. W., Belaaouaj, A. (2005) Myeloperoxidase plays critical roles in killing Klebsiella pneumoniae and inactivating neutrophil elastase: effects on host defense J. Immunol. 174,1557-1565[Abstract/Free Full Text]
  8. Stapleton, P. P., O’Flaherty, L., Redmond, H. P., Bouchier-Hayes, D. J. (1998) Host defense—a role for the amino acid taurine? J. Parenter. Enterol. Nutr. 22,42-48
  9. Fukuda, K., Hirai, Y., Yoshida, H., Nakajima, T., Usui, T. (1982) Free amino acid content of lymphocytes and granulocytes compared Clin. Chem. 28,1758-1761[Abstract/Free Full Text]
  10. Park, E., Schuller-Levis, G., Jia, J.-H., Quinn, M. R. (1997) Preactivation exposure of RAW 264.7 cells to taurine chloramine attenuates subsequent production of nitric oxide and expression of iNOS mRNA J. Leukoc. Biol. 61,161-166[Abstract]
  11. Fadok, V. A., Bratton, D. L., Konowal, A., Freed, P. W., Westcott, J. Y., Henson, P. M. (1998) Macrophages that have ingested apoptotic cells in vitro inhibit proinflammatory cytokine production through autocrine/paracrine mechanisms involving TGF-beta, PGE2, and PAF J. Clin. Invest. 101,890-898[Medline]
  12. Huynh, M.-L. N., Fadok, V. A., Henson, P. M. (2002) Phosphatidylserine-dependent ingestion of apoptotic cells promotes TGF-β1 secretion and the resolution of inflammation J. Clin. Invest. 109,41-50[CrossRef][Medline]
  13. Watson, R. W. G., Redmond, P., Wang, J. H., Condron, C., Bouchier-Hayes, D. (1996) Neutrophils undergo apoptosis following ingestion of Esherichia coli J. Immunol. 156,3986-3992[Abstract]
  14. Kasahara, Y., Iwai, K., Yache, A., Ohta, K., Konno, A., Seki, H., Miyawaki, T., Taniguchi, N. (1997) Involvement of reactive oxygen intermediates in spontaneous and CD95 (Fas/APO-1)-mediated apoptosis of neutrophils Blood 89,1748-1753[Abstract/Free Full Text]
  15. Brown, J. R., Goldblatt, D., Buddle, J., Morton, L., Thrasher, A. J. (2003) Diminished production of anti-inflammatory mediators during neutrophil apoptosis and macrophage phagocytosis in chronic granulomatous disease (CGD) J. Leukoc. Biol. 73,591-599[Abstract/Free Full Text]
  16. Kobayashi, S. D., Voyich, J. M., Braughton, K. R., Whitney, A. R., Nauseef, W. M., Malech, H. L., DeLeo, F. R. (2004) Gene expression profiling provides insight into the pathophysiology of chronic granulomatous disease J. Immunol. 172,636-643[Abstract/Free Full Text]
  17. Micheau, O., Lens, S., Gaide, O., Alevizopoulos, K., Tschopp, J. (2001) NF-{kappa}B signals induce the expression of c-FLIP Mol. Cell. Biol. 21,5299-5305[Abstract/Free Full Text]
  18. Stehlik, C., de Martin, R., Kumabashiri, I., Schmid, J. A., Binder, B. R., Lipp, J. (1998) Nuclear factor (NF)-{kappa}B-regulated X-chromosome-linked iap gene expression protects endothelial cells from tumor necrosis factor {alpha}-induced apoptosis J. Exp. Med. 188,211-216[Abstract/Free Full Text]
  19. Zong, W.-X., Edelstein, L. C., Chen, C., Bash, J., Gélinas, C. (1999) The prosurvival Bcl-2 homolog Bfl-1/A1 is a direct transcriptional target of NF-{kappa}B that blocks TNF{alpha}-induced apoptosis Genes Dev. 13,382-387[Abstract/Free Full Text]
  20. Chen, Z. J. (2005) Ubiquitin signalling in the NF-{kappa}B pathway Nat. Cell Biol. 7,758-765[CrossRef][Medline]
  21. Kanayama, A., Inoue, J., Sugita-Konishi, Y., Shimizu, M., Miyamoto, Y. (2002) Oxidation of I{kappa}B{alpha} at methionine 45 is one cause of taurine chloramine-induced inhibition of NF-{kappa}B activation J. Biol. Chem. 27,24049-24056
  22. Liu, Y., Tonna-DeMasi, M., Park, E., Schuller-Levis, G., Quinn, M. R. (1998) Taurine chloramine inhibits production of nitric oxide and prostaglandin E2 in activated C6 glioma cells by suppressing inducible nitric oxide synthase and cyclooxygenase-2 expression Brain Res. Mol. Brain Res. 59,189-195[Medline]
  23. Marcinkiewicz, J., Grabowska, A., Bereta, J., Bryniariski, K., Nowak, B. (1998) Taurine chloramine down-regulates the generation of murine neutrophil inflammatory mediators Immunopharmacology 40,27-38[CrossRef][Medline]
  24. Kim, J. W., Kim, C. (2005) Inhibition of LPS-induced NO production by taurine chloramine in macrophages is mediated through Ras-ERK-NF-{kappa}B Biochem. Pharmacol. 70,1352-1360[CrossRef][Medline]
  25. Schuller-Levis, G. B., Park, E. (2003) Taurine: new implications for an old amino acid FEMS Microbiol. Lett. 226,195-202[CrossRef][Medline]
  26. Micheau, O., Tschopp, J. (2003) Induction of TNF receptor I-mediated apoptosis via two sequential signaling complexes Cell 114,181-190[CrossRef][Medline]
  27. Irmler, M., Thome, M., Hahne, M., Schneider, P., Hofmann, K., Steiner, V., Bodmer, J.-L., Schröter, M., Burns, K., Mattmann, C., et al (1997) Inhibition of death receptor signals by cellular FLIP Nature 388,190-195[CrossRef][Medline]
  28. Yang, J. K., Wang, L., Zheng, L., Wan, F., Ahmed, M., Lenardo, M. J., Wu, H. (2005) Crystal structure of MC159 reveals molecular mechanism of Dros Inf ServC assembly and FLIP inhibition Mol. Cell 20,939-949[CrossRef][Medline]
  29. Deveraux, Q. L., Takahashi, R., Salvesen, G. S., Reed, J. C. (1997) X-linked IAP is a direct inhibitor of cell-death proteases Nature 388,300-304[CrossRef][Medline]
  30. Srinivasula, S. M., Hegde, R., Saleh, A., Datta, P., Shiozaki, E., Chai, J., Lee, R.-A., Robbins, P. D., Fernandes-Alnemri, T., Shi, Y., et al (2001) A conserved XIAP-interaction motif in caspase-9 and Smac/DIABLO regulates caspase activity and apoptosis Nature 410,112-116[CrossRef][Medline]
  31. Liu, H., Zhang, H., Iles, K. E., Rinna, A., Merrill, G., Yodoi, J., Torres, M., Forman, H. J. (2006) The ADP-stimulated NADPH oxidase activates the ASK-1/MKK4/JNK pathway in alveolar macrophages Free Radic. Res. 40,865-874[CrossRef][Medline]
  32. Watson, W. H., Pohl, J., Montfort, W. R., Stuchlik, O., Reed, M. S., Powis, G., Jones, D. P. (2003) Redox potential of human thioredoxin 1 and identification of a second dithiol/disulfide motif J. Biol. Chem. 278,33408-33415[Abstract/Free Full Text]
  33. Deng, Y., Ren, X., Yang, L., Lin, Y., Wu, X. (2003) A JNK-dependent pathway is required for TNF-{alpha}-induced apoptosis Cell 115,61-70[CrossRef][Medline]
  34. Saitoh, M., Nishitoh, H., Fujii, M., Takeda, K., Tobiume, K., Sawada, Y., Kawabata, M., Miyazono, K., Ichijo, H. (1998) Mammalian thioredoxin is a direct inhibitor of apoptosis signal-regulating kinase (ASK) 1 EMBO J. 17,2596-2606[CrossRef][Medline]
  35. Klamt, F., Shacter, E. (2005) Taurine monochloramine activates a cell death pathway involving Bax and caspase-9 J. Biol. Chem. 280,21346-21352[Abstract/Free Full Text]
  36. Emerson, D. K., McCormick, M. L., Schmidt, J. A., Knudson, C. M. (2005) The pathophysiology of tumor necrosis factors J. Biol. Chem. 280,3233-3324[Abstract/Free Full Text]
  37. Vassalli, P. (1992) Pleiotropic functions of TNF-{alpha} determine distinct IKKβ-dependent hepatocellular fates in response to LPS Annu. Rev. Immunol. 10,411-452[CrossRef][Medline]
  38. Ellson, C. D., Davidson, K., Ferguson, G. J., O’Connor, R., Stephens, L. R., Hawkins, P. T. (2006) Neutrophils from p40phox–/– mice exhibit severe defects in NADPH oxidase regulation and oxidant-dependent bacterial killing J. Exp. Med. 203,1927-1937[Abstract/Free Full Text]
  39. Ahmad, K. A., Clement, M. V., Pervaiz, S. (2003) Pro-oxidant activity of low doses of resveratrol inhibits hydrogen peroxide-induced apoptosis Ann. N. Y. Acad. Sci. 1010,365-373[CrossRef][Medline]
  40. Lundqvist-Gustafsson, H., Bengtsson, T. (1999) Activation of the granule pool of the NADPH oxidase accelerates apoptosis in human neutrophils J. Leukoc. Biol. 65,196-199[Abstract]
  41. Golks, A., Brenner, D., Fritsch, C., Krammer, P. H., Lavrik, I. N. (2005) c-FLIPR, a new regulator of death receptor-induced apoptosis J. Biol. Chem. 280,14507-14513[Abstract/Free Full Text]
  42. Kirchhoff, S., Müller, W. W., Krueger, A., Schmitz, I., Krammer, P. H. (2000) TCR-mediated up-regulation of c-FLIPshort correlates with resistance toward CD95-mediated apoptosis by blocking death-inducing signaling complex activity J. Immunol. 165,6293-6300[Abstract/Free Full Text]
  43. Krueger, A., Schmitz, I., Baumann, S., Krammer, P. H., Kirchhoff, S. (2001) Cellular FLICE-inhibitory protein splice variants inhibit different steps of caspase-9 activation at the CD95 death-inducing signaling complex J. Biol. Chem. 276,20633-20640[Abstract/Free Full Text]
  44. Micheau, O., Thome, M., Schneider, P., Holler, N., Tschopp, J., Nicholson, D. W., Briand, C., Grütter, M. G. (2002) The long form of FLIP is an activator of caspase-8 at the Fas death-inducing signaling complex J. Biol. Chem. 277,45162-45171[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Circ. Res.Home page
D. El Kebir, L. Jozsef, W. Pan, and J. G. Filep
Myeloperoxidase Delays Neutrophil Apoptosis Through CD11b/CD18 Integrins and Prolongs Inflammation
Circ. Res., August 15, 2008; 103(4): 352 - 359.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0407259v1
82/5/1344    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kanayama, A.
Right arrow Articles by Miyamoto, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kanayama, A.
Right arrow Articles by Miyamoto, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS