Pepro Tech
Originally published online as doi:10.1189/jlb.0307157 on August 7, 2007

Published online before print August 7, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.0307157v1
82/5/1185    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pirhonen, J.
Right arrow Articles by Matikainen, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pirhonen, J.
Right arrow Articles by Matikainen, S.
(Journal of Leukocyte Biology. 2007;82:1185-1192.)
© 2007 by Society for Leukocyte Biology

IFN-{alpha} regulates Toll-like receptor-mediated IL-27 gene expression in human macrophages

Jaana Pirhonen1, Jukka Sirén, Ilkka Julkunen and Sampsa Matikainen

Department of Viral Diseases and Immunology, National Public Health Institute, Helsinki, Finland

1 Correspondence: Department of Viral Diseases and Immunology, National Public Health Institute, Mannerheimintie 166, FI-00300, Helsinki, Finland. E-mail: jaana.pirhonen{at}ktl.fi


arrow
ABSTRACT
 
IL-27 is a novel member of the IL-12 cytokine family. IL-27 has pro- and anti-inflammatory properties, and it controls the responses of adaptive immunity. It promotes the differentiation of naïve Th cells and suppresses the effector functions of Th17 cells. Biologically active IL-27 is a heterodimer composed of EBV-induced gene 3 (EBI3) and p28 proteins. We report that TLR-dependent expression of IL-27 in human macrophages is mediated by IFN-{alpha}. Stimulation of macrophages with agonists for TLR3 {polyinosinic:polycytidylic acid [poly(I:C)]}, TLR4 (LPS), or TLR7/8 (R848) results in concurrent expression of EBI3 and p28. The p28 expression is inhibited with neutralizing anti-IFN-{alpha} antibodies. Unlike poly(I:C), LPS, and R848, TLR2 agonist (S)-[2,3-bis(palmitoyloxy)-(2RS)-propyl]-N-palmitoyl-(R)-Cys-(S)-Ser(S)-Lys4-OH trihydrochloride does not stimulate macrophages to produce IFN-{alpha}, and therefore, it is not able to turn on the expression of p28. There is an IFN-stimulated response element (ISRE) in the p28 gene promoter. IFN-{alpha} enhances the expression of IFN regulatory factor 1 (IRF-1) in macrophages and induces binding of IRF-1 to the p28 ISRE site. The data provide a mechanistic basis for the IFN-{alpha}-mediated activation of IL-27. The data emphasize a role of IFN-{alpha} in immune responses, which rely on the recognition of pathogens by TLRs.

Key Words: interferon regulatory factor • IFN-stimulated response element • transcriptional activation • viral infection


arrow
INTRODUCTION
 
IL-27 is the most recently discovered member of the IL-12 family of cytokines [1 ]. Like its relatives IL-12 and IL-23, it is secreted as a heterodimer consisting of a helical protein bound to a soluble receptor-like subunit. The cytokine subunit of IL-27 heterodimer is p28, a novel protein related to IL-12p35. Its receptor-like subunit is EB13, which is an IL-12/IL-23 p40-related protein encoded by EBY-induced gene 3.

IL-27 was first characterized as a proinflammatory cytokine, which induces the early differentiation of Th1 cells [2 3 4 5 ]. However, subsequent studies with in vivo models of inflammation demonstrate that IL-27 also exerts a multifaceted, inhibitory effect on immune responses. It attenuates inflammatory responses by limiting the production of proinflammatory cytokines [6 7 8 9 ]. Furthermore, IL-27 can negatively regulate Th cell differentiation. It inhibits the production of T cell growth and survival factor IL-2 [10 , 11 ], and in particular, it suppresses the development of IL-17-producing Th cells [12 , 13 ]. Consequently, IL-27 first plays a role in the initiation of Th1 differentiation, and then, it controls the intensity and duration of adaptive immune responses [14 ].

A major cellular source of IL-27 is APCs, including macrophages. In the host’s defense system against invading pathogens, macrophages represent a bridge between the innate and adaptive immunity. In the early innate response, macrophages recognize microbes by their pattern recognition receptors such as TLRs [15 ]. The engagement of TLRs activates intracellular signaling pathways, leading to the transcription of IL-27 and other cytokines. Once secreted, the cytokines stimulate the adaptive immune response in lymphocytes. Efficient secretion of IL-27 requires that both of its subunits, EBI3 and p28, are transcribed within the same cell [1 ]. Few microbes have been reported promoting the coexpression of EBI3 and p28 in macrophages and dendritic cells (DCs) [16 17 18 ]. However, the evidence that TLRs are involved in the microbe-induced IL-27 expression comes from the studies where TLRs are activated directly with synthetic compounds, which mimic their natural ligands. In human DCs, stimulation of TLR3 with polyinosinic-polycytidylic acid [poly(I:C)] leads to induction of IL-27 [19 ]. Similarly, engagement of TLR4 with LPS results in the expression of both IL-27 genes [1 , 19 ]. The TLR-dependent expression of EBI3 in murine DCs is induced via the activation of transcription factors NF-{kappa}B and PU.1 [20 ]. Transcriptional regulation of the p28 gene is largely unknown.

In this study, we report that in human macrophages, TLR-dependent expression of IL-27 is regulated by IFN-{alpha} via transactivation of p28. We identified two putative IFN-stimulated response elements (ISREs) in the IL-27 p28 gene promoter and show that a stimulation of macrophages with IFN-{alpha} results in the binding of IFN regulatory factor 1 (IRF-1) to the p28 ISRE1 site. The contribution of IFN-{alpha} explains the difference that is seen in the IL-27 expression of macrophages, which are stimulated with various TLR agonists or live viruses. Macrophages, which are treated with agonists for TLR3, TLR4, and TLR7/8, express both IL-27 genes. The TLR2 agonist, in contrasts, fails to activate p28, although it enhances the expression of EBI3. This is a result of the inability of the TLR2 agonist to switch on the expression of IFN-{alpha}. The data establish a molecular basis for the regulation of IL-27 expression and underscore the role of IFN-{alpha} in the early, TLR-mediated immune responses.


arrow
MATERIALS AND METHODS
 
Differentiation of macrophages from peripheral blood-derived monocytes
Monocytes from healthy blood donors were isolated and purified as described previously [21 ]. In brief, PBLs were subjected to Ficoll-Paque (Pharmacia Biotech, Uppsala, Sweden) gradient centrifugation and depleted from lymphocytes by allowing monocytes to adhere onto six-well cell culture plates (Falcon Multiwell, Becton Dickinson, Franklin Lakes, NJ, USA). Macrophages were obtained by culturing the monocytes for 1 week in serum-free medium (Life Technologies, Gaithersburg, MD, USA) supplemented with 10 ng/ml GM-CSF (BioSource, Nivelles, Belgium).

Stimulation of macrophages with TLR ligands
TLR2 ligand (S)-[2,3-bis(palmitoyloxy)-(2RS)-propyl]-N-palmitoyl-(R)-Cys-(S)-Ser(S)-Lys4-OH trihydrochloride (Pam3Cys) was purchased from EMC Microcollections (Tübingen, Germany); TLR3 ligand poly(I:C) and TLR4 ligand LPS (Escherichia coli K12) from Sigma-Aldrich (Steinheim, Germany); and TLR7 ligand loxoribine and TLR7/8 ligand resiquimod R848 from InvivoGen (San Diego, CA, USA). The functional concentrations of TLR2, TLR3, TLR4, TLR7, and TLR7/8 ligands were pretitrated, and the final amounts used in experiments were 100 ng/ml, 30 µg/ml, 1 µg/ml, 100 µM, and 1 µg/ml, respectively.

Macrophages were treated with TLR ligands in RPMI-1640 medium with 10% FCS. The stimulated cells and cell culture supernatants were harvested 1–9 h after TLR ligand stimulations, and samples for Northern blotting, EMSA, ELISA, and biological IFN analyses were prepared. Each sample represents a pool of separately stimulated macrophages from four different blood donors, and the results are representatives of three to four independent but identically conducted experiments.

Infection of macrophages with influenza and Sendai viruses
Human pathogenic influenza A virus (strain Beijing/353/89, H3N2) and murine Sendai virus (strain Cantell) were grown as described previously [21 ]. To infect macrophages, we used 25 hemagglutination (HA) U/ml influenza A and 150 HA U/ml Sendai virus, which were let to adsorb for 1 h, after which the cells were washed with PBS and fed with RPMI-1640 medium containing 10% FCS. The cells and cell-free culture supernatants for Northern blotting and ELISA samples were harvested 3–24 h after the infections.

Cytokines and antibodies
Highly purified human leukocyte IFN-{alpha} and IFN-{gamma} were provided by the Finnish Red Cross Blood Transfusion Service (Helsinki, Finland). Neutralizing antibodies against human IFN-{alpha} have been described previously [22 ]. Dr. Richard Pine (Public Health Research Institute, Newark, NJ, USA) [23 ] provided the anti-IRF-1 antibody used in EMSA supershift experiments. The anti-IRF-8 antibody C-19X was from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA).

Biological assay for IFN-{alpha}
The amount of IFN-{alpha}/β in macrophage culture supernatants was assayed in HEp2 cells by the vesicular stomatitis virus plaque reduction method [24 ]. The results are expressed as IU/ml, using an international control IFN-{alpha} preparation as a standard.

RNA isolation and Northern blot analysis
Total cellular RNA from macrophages was isolated with an RNeasy kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. Northern blottings and hybridizations of membranes with human myxovirus resistance A (MxA) [25 ], IRF-1 [26 ], EBI3, and p28 cDNA probes were performed as described previously [21 ]. The probes for EBI3 and p28 were cloned from total cellular RNA obtained from Sendai virus-infected macrophages by RT-PCR using oligonucleotides ATTGCTCCTGGATCCTGCCGCCTG (sense) and GCTTGTAACGGATCCAGTACTTCA (antisense) and GGTGTCTGGGGATCCCCAAGGCCC (sense) and AGAGGAGCTGGATCCAGGACACCT (antisense), respectively.

EMSA
EMSA was performed as described previously [27 , 28 ]. The following oligonucleotides were used as probes: IL-27 p28 promoter ISRE1 5'-GATCGCAGGACGGAAAGTGAAACCGGGCA (nucleotides between positions –88 and –64 from the transcription start site); p28 promoter ISRE2 5'-GATCTGAACACAAAGCTGAAAGTACAAGC (nucleotides between positions –87 and –111); and ISRE15 of IFN-stimulated gene 15 (ISG15) 5'-GATCAGCTTGATCGGGAAAGGGAAACGAAACTGAAGCCA-3' [29 , 30 ].


arrow
RESULTS
 
IL-27 gene expression is activated through TLR3, TLR4, and TLR8
We have shown that human monocyte-derived macrophages express several TLRs, which can activate cytokine production in these cells [31 , 32 ]. To investigate the role of TLRs in IL-27 expression, we stimulated human macrophages with TLR agonists. IL-27 is a heterodimer, and first, we analyzed the RNA expression of its two subunits EBI3 and p28 (Fig. 1 ). poly(I:C), LPS, and R848, representing ligands for TLR3, TLR4, and TLR7/8, respectively, induced mRNA expression of EBI3 and p28 in macrophages (Fig. 1) . The kinetics of EBI3 and p28 expressions was comparable, and the expression peaks were achieved in 6 h after stimulation with TLR3, TLR4, and TLR7/8 agonists. Instead, TLR2 agonist Pam3Cys induced EBI3 gene expression without affecting that of p28. It is of note that ligation of TLR7 by loxoribine did not turn on IL-27 genes (data not shown). This suggests that R848, which is recognized by TLR7 and TLR8 [33 ], stimulated EBI3 and p28 gene expression through TLR8 rather than TLR7.


Figure 1
View larger version (86K):
[in this window]
[in a new window]

 
Figure 1. TLR ligands up-regulate IL-27 gene expression in macrophages. Human primary macrophages were stimulated with ligands for TLR3 [poly(I:C), 30 µg/ml], TLR7/8 (R848, 1 µg/ml), TLR2 (Pam3Cys, 100 ng/ml), and TLR4 (LPS, 1 µg/ml). The cells were harvested at indicated times, and total cellular RNA was collected. Pooled RNA samples (20 µg/lane) were subjected to Northern blot analysis with EB13 and p28 cDNA probes. Ethidium bromide staining of ribosomal RNA bands was used to control equal RNA loading.

IFN-{alpha} up-regulates IL-27 gene expression
Unlike influenza virus, Sendai virus is a potent inducer of IL-12 and IL-23 in macrophages [34 ]. Therefore, we anticipated that Sendai virus stimulates IL-27 genes as well. The unforeseen result was that influenza virus infection enhances the expression of p28, although modest compared with the Sendai virus-induced p28 expression. In any case, without the activation of EBI3 gene, influenza virus is not able to stimulate IL-27 secretion from macrophages (Fig. 2 ). The relative slow kinetics of p28 induction in macrophages hints that it is not activated directly in response to influenza virus infection. We have seen that IFN-{alpha} is an essential factor in the activation of many secondary response genes during viral infections [29 , 30 , 35 ]. To assess the effect of IFN-{alpha} in IL-27 induction, we treated virus-infected cells with neutralizing anti-IFN-{alpha}/β antibodies. We found that the influenza virus-induced p28 gene expression is mediated by IFN-{alpha} (Fig. 3A ). In the case of Sendai virus infection, IFN-{alpha} seems not to be responsible for the enhancement of IL-27 gene expression in macrophages (Fig. 3A) . On the contrary, Sendai virus stimulates EBI3 and p28 mRNA expression independently of IFN-{alpha}.


Figure 2
View larger version (65K):
[in this window]
[in a new window]

 
Figure 2. IL-27 gene expression in influenza A or Sendai virus-infected human macrophages. The cells were infected with influenza virus strain A/Beijing/353/89 (H3N2) or Sendai virus strain Cantell and were harvested at 3, 6, 12, or 24 h after the infections. Total cellular RNA was isolated and Northern blotting analysis was performed with EBI3 and p28 cDNA probes.


Figure 3
View larger version (32K):
[in this window]
[in a new window]

 
Figure 3. Neutralization of IFN-{alpha}/β abrogates IL-27 p28 gene expression in the virus infection and TLR ligand-stimulated cells. Influenza A or Sendai virus-infected macrophages were treated with 5000 NU/ml anti-IFN-{alpha}/β antibodies (Ab) given at 1, 3, and 6 h after infections (A). Alternatively, macrophages were stimulated with poly(I:C), R848, Pam3Cys, and LPS and treated with neutralizing anti-IFN-{alpha}/β antibodies at 1 and 3 h after stimulations (B). Total RNA was extracted from the cells at 9 h after virus infections and 6 h after stimulations with TLR ligands, and Northern blot analysis was performed with EBI3, p28, and MxA cDNA probes.

IFN-{alpha} also plays a part in the TLR-mediated IL-27 induction. Macrophages, which are stimulated directly through their TLR3, TLR4, or TLR7/8, produce IFN-{alpha} (Table 1 ). Neutralization of it with anti-IFN-{alpha}/β antibodies diminishes the TLR-induced expression of p28 (Fig. 3B) . This suggests that the engagement of given TLRs enhances the IL-27 expression via IFN-{alpha}. In addition, IFN-{alpha} provides an explanation to the lack of p28 induction in response to the TLR2 agonist. Unlike TLR3, TLR4, and TLR7/8 agonists, the TLR2 agonist does not turn on the production of IFN-{alpha} in macrophages. The failure of the TLR2 agonist to stimulate IFN-{alpha} production is fairly comprehensive. IFN-{alpha} was not detected in TLR2-stimulated macrophages by measuring the amount of biologically active IFN-{alpha} (Table 1) nor the expression of the MxA gene (Fig. 3B) , whose transcriptional activation is controlled strictly by IFN-{alpha} [36 ].


View this table:
[in this window]
[in a new window]

 
Table 1. IFN-{alpha}/β Production in TLR Ligand-Stimulated Macrophagesa

The way that IFN-{alpha} acted as an up-regulator of p28 led us to study more closely the effect of IFN-{alpha} on its expression. Treatment of macrophages with IFN-{alpha} does not noticeably affect the amount of p28 mRNA in influenza or Sendai virus-infected cells (Fig. 4A ). This is not surprising when bearing in mind that virus infection per se stimulates considerable production of IFN-{alpha} [21 ]. Instead, when macrophages are stimulated with TLR agonists, the mRNA expression of p28 is enhanced in response to IFN-{alpha} treatment (Fig. 4B and 4C) . Actually, IFN-{alpha} as such seems to activate the p28 gene without further stimulation with TLR agonists. IFN-{alpha} also slightly inhibits the mRNA expression of EBI3 (Fig. 4B and 4C) . A relative constant ratio of p28 mRNA:EBI3 mRNA increases from 0.3–0.8 to 1.4–1.7 when TLR3, TLR4, or TLR7/8 agonist-stimulated macrophages are treated with IFN-{alpha}.


Figure 4
View larger version (44K):
[in this window]
[in a new window]

 
Figure 4. IFN-{alpha} regulates the gene expression of IL-27. Macrophages were treated with IFN-{alpha} (100 IU/ml) and infected with influenza A or Sendai viruses (A) or stimulated with poly(I:C), R848, Pam3Cys, and LPS (B). Nine hours postinfections and 6 h after TLR ligand stimulations, the cells were harvested, and Northern blot analysis was performed with EBI3 and p28 cDNA probes. (B) The results were quantitated by measuring the band intensities using Kodak Digital Science 1D image analysis software. (C) Relative TLR ligand-induced EBI3 and p28 mRNA levels as compared with respective control samples are shown.

IFN-{alpha} activates p28 gene transcription through inducing the binding of IRF-1 to ISRE in the p28 promoter
IFN-{alpha} activates its specific target genes through ISREs, which reside in the promoter regions of these genes. IFN-{alpha} stimulation leads to binding of the ISG factor 3 (ISGF3) complex and/or IRF-1 transcription factors to the ISRE sites. We made a computer analysis of EBI3 and p28 genes and found out that there are no recognized ISRE sites in the EBI3 promoter. The p28 promoter, instead, contains two putative ISRE sites, ISRE1 and ISRE2. To investigate whether these ISREs play a role in the IFN-{alpha}-induced IL-27 p28 expression, we performed EMSA with p28 ISRE probes. Indeed, treatment of macrophages with IFN-{alpha} induces in 2–3 h binding of a protein/DNA complex to a p28 ISRE1 (Fig. 5B ) but not to a ISRE2 site (data not shown). The position of the ISRE1 binding complex in the gel suggests that it consists of IRF-1 and/or IRF-8 proteins instead of Stat1, Stat2, and IRF-9, which comprise the ISG15-binding ISGF3 complex in IFN-{alpha}-treated macrophages (Fig. 5C) . Toward this end, we performed supershift analyses with the ISRE1 probe plus anti-IRF-1 or anti-IRF-8 antibodies. Figure 6 shows that the ISRE1 binding complex consists of IRF-1 proteins, whereas IRF-8 is not part of it. We also performed Northern blot analysis to ensure that stimulation of macrophages with IFN-{alpha} induces IRF-1 gene expression (Fig. 7 ). IFN-{alpha} up-regulates IRF-1 expression in macrophages as efficiently as IFN-{gamma}, which is generally considered the primary inducer of IRF-1. It is of note that transactivation of IRF-1 in response to IFN-{alpha} precedes that of p28 (Fig. 7) . This emphasizes the proposed role of IRF-1 in the IFN-{alpha}-dependent activation of IL-27 p28 gene expression. IFN-{gamma}-induced IRF-1 activation is also followed by enhanced p28 expression.


Figure 5
View larger version (67K):
[in this window]
[in a new window]

 
Figure 5. Characterization of the human IL-27 p28 promoter and binding of nuclear complex to the ISRE site of the promoter in IFN-{alpha}-stimulated macrophages. (A) DNA sequence of the human IL-27 p28 proximal promoter up to –500 bp upstream of the TSS. Putative cis-acting elements were identified with the MatInspector software program. (B and C) Macrophages were stimulated with IFN-{alpha} (100 IU/ml). After the indicated times, the cells were harvested, and nuclear extracts were prepared. The extracts were incubated with 32P-labeled IL-27 p28 ISRE1 probe (A) or ISRE15 probe (B), which was used as a positive control, and analyzed by EMSA. TSS, transcription start site; Ets-1, E26 transformation specific sequence.


Figure 6
View larger version (62K):
[in this window]
[in a new window]

 
Figure 6. IFN-{alpha} induces DNA binding of IRF-1 to IL-27 p28 ISRE1. Macrophages were stimulated with IFN-{alpha} (100 IU/ml) for 3 h. The nuclear extracts from the cells were incubated for 15 min in room temperature with anti-IRF-1 or anti-IRF-8 antibodies, followed by EMSA with p28 ISRE1 probe (A) or ISRE15 probe (B). The supershift indicates that the IFN-{alpha}-induced DNA binding protein complex is composed of IRF-1.


Figure 7
View larger version (61K):
[in this window]
[in a new window]

 
Figure 7. IFN-{alpha} and IFN-{gamma} induce sequential expression of IRF-1 and IL-27 p28. Macrophages were stimulated with IFN-{alpha} (100 IU/ml) or IFN-{gamma} (100 IU/ml). At the indicated time-points, the cells were harvested, and Northern blot analysis was performed with IRF-1 and p28 cDNA probes.


arrow
DISCUSSION
 
In macrophages, the engagement of TLRs by pathogen-associated molecular patterns triggers signaling cascades, which end in the expression of immunoregulatory cytokines. Secreted cytokines stimulate lymphocyte functions and thereby, transform the innate immunity signals to the responses of adaptive immunity. A key macrophage-derived cytokine, which shapes Th cell-dependent, adaptive responses, is IL-27. Recent studies have established a significant role for IL-27 in the host defense against microbial infections, but molecular mechanisms that govern the production of IL-27 in macrophages and other APCs have remained unclear.

In the present study, we report the expression of IL-27 in primary human macrophages and elucidate a mechanism by which IFN-{alpha} regulates TLR-dependent activation of IL-27, which is a heterodimer composed of EBI3 and p28 subunits. The shared heterodimeric structure of IL-27 with IL-12 and IL-23 suggests that the expression and secretion of IL-27 are regulated in the same way as the formation of bioactive IL-12 and IL-23, which requires the expression of their respective subunits within the same cell. However, unlike their counterparts in IL-12 and IL-23 heterodimers, EBI3 and p28 of IL-27 are not linked by a disulfide bond. The lack of disulfide bonds hypothetically allows for an extracellular association of p28 and EBI3, which are produced in distinct cells. In fact, EBI3 is secreted, at least in vitro, by itself [1 ]. However, as human p28 is not secreted without coexpression of EBI3, it appears that the production of functional IL-27 requires the coexpression and cosecretion of its subunits. We noticed that stimulation of macrophages with agonists for TLR3 [poly(I:C)] or TLR4 (LPS) induces a synchronized mRNA expression of both IL-27 genes (Fig. 1) . This is consistent with the studies reporting a concurrent induction of EBI3 and p28 in human DCs after stimulation with poly(I:C) and LPS [1 , 19 ]. There are indications that TLR2 agonist Pam3Cys, in contrast, has a poor ability to stimulate IL-27 genes in murine bone marrow or human monocyte-derived DCs [19 , 37 ]. In our experimental system, Pam3Cys does enhance the mRNA expression of EBI3. However, it fails to induce p28 expression. Another novel observation is that IL-27 expression can be activated through TLR7/8. R848, which is an agonist for TLR7 and TLR8, stimulates EBI3 and p28 expression in macrophages. Instead, loxoribine, which is recognized by TLR7 alone, does not activate either of the IL-27 genes. This could mean that R848 induces IL-27 preferentially through TLR8. In human macrophages, TLR8 is expressed constitutively and in a much higher level than TLR7, whose expression needs infection-related stimuli [31 , 32 ]. The pronounced expression of TLR8 probably favors that R848 affects through TLR8 rather than TLR7.

After binding a ligand, TLRs associate with particular adaptor molecules to activate downstream signaling molecules, which are needed for the transcription of their target genes. TLR3 recruits adaptor molecule Toll-IL-1R domain-containing adaptor protein-inducing IFN-β (TRIF), and TLR7 and TLR8 use MyD88. TLR4 signals via MyD88 but can also trigger transcriptional activation using the MyD88-independent TRIF pathway [15 ]. In mouse macrophages, LPS-induced p28 expression is reported to be totally dependent on MyD88 [38 ]. Human macrophages express the components of both signaling pathways [32 ], and it is also possible that in these cells, LPS induces IL-27 by activating the MyD88 pathway. The fact that R848 stimulates p28 and EBI3 expression confirms that MyD88-dependent signaling is involved in the induction of IL-27 genes. Conversely, activation of p28 and EBI3 by poly(I:C) indicates that the IL-27 gene expression is also induced via a MyD88-independent pathway.

Besides TLR3, cytoplasmic helicase proteins retinoic acid-inducible protein I (RIG-I ) and melanoma differentiation-associated gene 5 (MDA-5) can recognize dsRNA [39 , 40 ], thus providing an alternative route for poly(I:C) to stimulate IL-27 expression. However, it has been shown that when poly(I:C) is administrated extracellularly, as in our experimental system, it acts via TLR3 and is not detected by RIG-I or MDA-5 [41 ]. It seems that RIG-I and MDA-5 also play a minor role in the virus infection-induced IL-27 expression. It is reported that in myeloid cells, like macrophages, Sendai virus-derived RNA is recognized independently of RIG-I [42 ]. ssRNA of Sendai virus is detected by TLR8, and it is probable that the virus induces the expression of p28 and EBI3 (Fig. 2) in human macrophages via TLR8. We have seen that influenza virus enhances the production of Types I and III IFNs in a TLR3-independent way via RIG-I and MDA-5 [43 , 44 ]. Nevertheless, when we wanted to see if the same applies to IL-27 expression in influenza virus-infected macrophages, we found that influenza virus was not able to stimulate a concurrent expression of IL-27 genes (Fig. 2) . To recapitulate, TLRs play a dominant role in the activation of IL-27 expression in human macrophages. Stimulation through TLR3, TLR4, or TRL8, with TLR agonists or Sendai virus, enhances the expression EBI3 and p28 of IL-27.

The failure of influenza virus to stimulate the production of IL-27 was not an unexpected result. We have seen before that influenza virus cannot activate the expression of other IL-12 family cytokines either [34 ]. What we did not anticipate was the fact that influenza virus elicits the mRNA expression of p28 (Fig. 2) . However, neutralization of IFN-{alpha} activity in influenza virus-infected macrophages inhibited the activation of p28 expression completely. Hence, influenza virus activates p28 via IFN-{alpha}, which is a dominant cytokine, which macrophages produce in response to viral infections. Sendai virus causes a more notable secretion of IFN-{alpha} in macrophages than influenza virus [21 ]. Nevertheless, when we treated Sendai virus-infected cells with neutralizing IFN-{alpha} antibodies, the virus-induced p28 expression was not abolished (Fig. 3A) . In macrophages, Sendai virus triggers on the expression of many secondary response genes in the absence of IFN-{alpha} [30 , 35 ], and it seems that it can activate p28 independently of IFN-{alpha}.

Macrophages, which are stimulated through TLR3, TLR4, or TLR8, produce IFN-{alpha} (Table 1) , and indeed, this endogenous IFN-{alpha} participates in the TLR-induced activation of p28. Neutralization of IFN-{alpha} results in the inhibition of p28 gene expression in the cells treated with TLR agonists (Fig. 3B) . In addition, the exogenously given IFN-{alpha} enhances the p28 expression further (Fig. 4B) . Unlike agonists for TLR3, TLR4, and TLR8, the TLR2 agonist does not elicit the production of IFN-{alpha} (Fig. 3B) . Consequently, it is not able to stimulate the expression of p28 (Fig. 1) . Yet, the exogenous IFN-{alpha} induces p28 expression in the TLR2-stimulated or even unstimulated cells (Fig. 4B) . Thus, the induction of p28 expression by IFN-{alpha} does not require any additional, TLR-dependent stimulus.

Given the ability of IFN-{alpha} to transactivate p28 expression directly (Fig. 7) , we conducted a computer analysis of the p28 gene. The IL-27 p28 promoter was found to contain two putative IFN-{alpha}-responsive sites, ISRE1 and ISRE2. The EMSA with p28 ISRE probes proved that IFN-{alpha} induced the binding of a protein/DNA complex to ISRE1 (Fig. 5B) while ISRE2, which actually represents a binding site for AP-1, was not responsive to IFN-{alpha}. The supershift analyses implied that the complex consisted of IRF-1 proteins (Fig. 6) . In contrast to the ISG15 element, which also bound the ISGF3 complex in response to IFN-{alpha}, IL-27 p28 ISRE1 was not able to bind ISGF3 after the cytokine stimulation. The sequential activation of IRF-1 and p28 genes in IFN-{alpha}-stimulated macrophages (Fig. 7) corroborated the idea that IRF-1 mediates the IFN-{alpha}-induced activation of the IL-27 p28 gene. IFN-{gamma} also stimulates IRF-1 expression, which is followed by enhanced expression of p28. In their recent paper, Liu et al. [38 ] report that LPS- and IFN-{gamma}-induced expression of p28 is impaired in IRF-1-deficient mice. The observation that p28 expression is dependent on IRF-1 in murine macrophages is in line with our studies with human cells. It appears that similarly to murine p28, the expression of human p28 is regulated at the mRNA level.

In summary, our present study demonstrates the TLR-mediated activation of IL-27 expression in human macrophages. Stimulation through TLR3, TLR4, and TLR7/8 induces the expression of IL-27-encoding genes p28 and EBI3. TLR7/8 ligand, especially, is a strong enhancer of IL-27, and this along with its ability to induce IL-12 could explain the effectiveness of TLR7/8 agonists as an immunostimulatory agent. TLR2 stimulation, on the contrary, fails to activate the p28 gene, although it enhances EBI3 expression. An explanation of this selective activation of IL-27 genes is the effect of IFN-{alpha}. That is, unlike other TLR agonists, the TLR2 agonist does not stimulate IFN-{alpha} production from macrophages, and we have established a regulative role for IFN-{alpha} in the activation of IL-27. We identified an ISRE on the IL-27 p28 gene promoter and show that stimulation of macrophages with IFN-{alpha} results in the binding of IRF-1 to the p28 ISRE site with a subsequent activation of p28 transcription. Similarly to the TLR ligand-induced p28 expression, IFN-{alpha} mediates the activation of p28 in influenza virus-infected cells. Our results emphasize that IFN-{alpha}, the prominent cytokine produced in viral infections, has a significant impact on the regulation of early immune responses via TLRs.


arrow
ACKNOWLEDGEMENTS
 
The Academy of Finland, the Helsingin Sanomat Centennial Foundation, and the Paulo Foundation supported this work. We thank Dr. Richard Pine for the generous provision of the anti-IRF-1 antibody.

Received March 14, 2007; revised June 25, 2007; accepted July 3, 2007.


arrow
REFERENCES
 
    1
  1. Pflanz, S., Timans, J., Cheung, J., Rosales, R., Kanzler, J., Gilbert, J., Hibbert, L., Churakova, T., Travis, M., Vaisberg, E., Blumenschein, W. M., Mattson, J. D., Wagner, J. L., To, W., Zurawski, S., McClanahan, T. K., Gorman, D. M., Bazan, J. F., de Waal Malefyt, R., Rennick, D., Kastelein, R. A. (2002) IL-27, a heterodimeric cytokine composed of EB13 and p28 protein, induces proliferation of naive CD+ T cells Immunity 16,779-790[CrossRef][Medline]
  2. 2
  3. Chen, Q., Ghilardi, N., Wang, H., Baker, T., Xie, M. H., Gurney, A., Grewal, I. S., de Sauvage, F. J. (2000) Development of Th1-type immune responses requires the type I cytokine receptor TCCR Nature 407,916-920[CrossRef][Medline]
  4. 3
  5. Yoshida, H., Hamano, S., Senaldi, G., Covey, T., Faggioni, R., Mu, S., Xia, M., Wakeham, A. C., Nishina, H., Potter, J., Saris, C. J., Mak, T. W. (2001) WSX-1 is required for the initiation of Th1 responses and resistance to L. major infection Immunity 15,569-578[CrossRef][Medline]
  6. 4
  7. Takeda, A., Hamano, S., Yamanaka, A., Hanada, T., Ishibashi, T., Mak, T. W., Yoshimura, A., Yoshida, H. (2003) Cutting edge: role of IL-27/WSX-1 signaling for induction of T-bet through activation of STAT1 during initial Th1 commitment J. Immunol. 170,4886-4890[Abstract/Free Full Text]
  8. 5
  9. Lucas, S., Ghilardi, N., Li, J., de Sauvage, F. J. (2003) IL-27 regulates IL-12 responsiveness of naive CD4+ T cells through Stat1-dependent and -independent mechanisms Proc. Natl. Acad. Sci. USA 100,15047-15052[Abstract/Free Full Text]
  10. 6
  11. Villarino, A., Hibbert, L., Lieberman, L., Wilson, E., Mak, T., Yoshida, H., Kastelein, R. A., Saris, C., Hunter, C. A. (2003) The IL-27R (WSX-1) is required to suppress T cell hyperactivity during infection Immunity 19,645-655[CrossRef][Medline]
  12. 7
  13. Artis, D., Villarino, A., Silverman, M., He, W., Thornton, E. M., Mu, S., Summer, S., Covey, T. M., Huang, E., Yoshida, H., Koretzky, G., Goldschmidt, M., Wu, G. D., de Sauvage, F., Miller, H. R., Saris, C. J., Scott, P., Hunter, C. A. (2004) The IL-27 receptor (WSX-1) is an inhibitor of innate and adaptive elements of type 2 immunity J. Immunol. 173,5626-5634[Abstract/Free Full Text]
  14. 8
  15. Rosas, L. E., Satoskar, A. A., Roth, K. M., Keiser, T. L., Barbi, J., Hunter, C., de Sauvage, F. J., Satoskar, A. R. (2006) Interleukin-27R (WSX-1/T-cell cytokine receptor) gene-deficient mice display enhanced resistance to Leishmania donovani infection but develop severe liver immunopathology Am. J. Pathol. 168,158-169[Abstract/Free Full Text]
  16. 9
  17. Yoshimura, T., Takeda, A., Hamano, S., Miyazaki, Y., Kinjyo, I., Ishibashi, T., Yoshimura, A., Yoshida, H. (2006) Two-sided roles of IL-27: induction of Th1 differentiation on naive CD4+ T cells versus suppression of proinflammatory cytokine production including IL-23-induced IL-17 on activated CD4+ T cells partially through STAT3-dependent mechanism J. Immunol. 177,5377-5385[Abstract/Free Full Text]
  18. 10
  19. Villarino, A. V., Stumhofer, J. S., Saris, C. J., Kastelein, R. A., de Sauvage, F. J., Hunter, C. A. (2006) IL-27 limits IL-2 production during Th1 differentiation J. Immunol. 176,237-247[Abstract/Free Full Text]
  20. 11
  21. Owaki, T., Asakawa, M., Kamiya, S., Takeda, K., Fukai, F., Mizuguchi, J., Yoshimoto, T. (2006) IL-27 suppresses CD28-mediated [correction of medicated] IL-2 production through suppressor of cytokine signaling 3 J. Immunol. 176,2773-2780[Abstract/Free Full Text]
  22. 12
  23. Batten, M., Li, J., Yi, S., Kljavin, N. M., Danilenko, D. M., Lucas, S., Lee, J., de Sauvage, F. J., Ghilardi, N. (2006) Interleukin 27 limits autoimmune encephalomyelitis by suppressing the development of interleukin 17-producing T cells Nat. Immunol. 7,929-936[CrossRef][Medline]
  24. 13
  25. Stumhofer, J. S., Laurence, A., Wilson, E. H., Huang, E., Tato, C. M., Johnson, L. M., Villarino, A. V., Huang, Q., Yoshimura, A., Sehy, D., Saris, C. J., O’Shea, J. J., Hennighausen, L., Ernst, M., Hunter, C. A. (2006) Interleukin 27 negatively regulates the development of interleukin 17-producing T helper cells during chronic inflammation of the central nervous system Nat. Immunol. 7,937-945[CrossRef][Medline]
  26. 14
  27. Owaki, T., Asakawa, M., Morishima, N., Hata, K., Fukai, F., Matsui, M., Mizuguchi, J., Yoshimoto, T. (2005) A role for IL-27 in early regulation of Th1 differentiation J. Immunol. 175,2191-2200[Abstract/Free Full Text]
  28. 15
  29. Kawai, T., Akira, S. (2006) TLR signaling Cell Death Differ 13,816-825[CrossRef][Medline]
  30. 16
  31. Veckman, V., Miettinen, M., Pirhonen, J., Siren, J., Matikainen, S., Julkunen, I. (2004) Streptococcus pyogenes and Lactobacillus rhamnosus differentially induce maturation and production of Th1-type cytokines and chemokines in human monocyte-derived dendritic cells J. Leukoc. Biol. 75,764-771[Abstract/Free Full Text]
  32. 17
  33. Schuetze, N., Schoeneberger, S., Mueller, U., Freudenberg, M. A., Alber, G., Straubinger, R. K. (2005) IL-12 family members: differential kinetics of their TLR4-mediated induction by Salmonella enteritidis and the impact of IL-10 in bone marrow-derived macrophages Int. Immunol. 17,649-659[Abstract/Free Full Text]
  34. 18
  35. Fakruddin, J. M., Lempicki, R. A., Gorelick, R. J., Yang, J., Adelsberger, J. W., Garcia-Pineres, A. J., Pinto, L. A., Lane, H. C., Imamichi, T. (2007) Noninfectious papilloma virus-like particles inhibit HIV-1 replication: implications for immune control of HIV-1 infection by IL-27 Blood 109,1841-1849[Abstract/Free Full Text]
  36. 19
  37. Schnurr, M., Toy, T., Shin, A., Wagner, M., Cebon, J., Maraskovsky, E. (2005) Extracellular nucleotide signaling by P2 receptors inhibits IL-12 and enhances IL-23 expression in human dendritic cells: a novel role for the cAMP pathway Blood 105,1582-1589[Abstract/Free Full Text]
  38. 20
  39. Wirtz, S., Becker, C., Fantini, M. C., Nieuwenhuis, E. E., Tubbe, I., Galle, P. R., Schild, H. J., Birkenbach, M., Blumberg, R. S., Neurath, M. F. (2005) EBV-induced gene 3 transcription is induced by TLR signaling in primary dendritic cells via NF-{kappa} B activation J. Immunol. 174,2814-2824[Abstract/Free Full Text]
  40. 21
  41. Pirhonen, J., Sareneva, T., Kurimoto, M., Julkunen, I., Matikainen, S. (1999) Virus infection activates IL-1 β and IL-18 production in human macrophages by a caspase-1-dependent pathway J. Immunol. 162,7322-7329[Abstract/Free Full Text]
  42. 22
  43. Mogensen, K. E., Pyhala, L., Cantell, K. (1975) Raising antibodies to human leukocyte interferon Acta Pathol. Microbiol. Scand. B 83,443-450[Medline]
  44. 23
  45. Pine, R., Decker, T., Kessler, D. S., Levy, D. E., Darnell, J. E., Jr (1990) Purification and cloning of interferon-stimulated gene factor 2 (ISGF2): ISGF2 (IRF-1) can bind to the promoters of both β interferon- and interferon-stimulated genes but is not a primary transcriptional activator of either Mol. Cell. Biol. 10,2448-2457[Abstract/Free Full Text]
  46. 24
  47. Cantell, K., Hirvonen, S., Kauppinen, H. L., Kalkkinen, N. (1991) Rapid production of interferon-{gamma} in uninduced human leukocyte suspensions J. Interferon Res. 11,231-236[Medline]
  48. 25
  49. Ronni, T., Melen, K., Malygin, A., Julkunen, I. (1993) Control of IFN-inducible MxA gene expression in human cells J. Immunol. 150,1715-1726[Abstract]
  50. 26
  51. Maruyama, M., Fujita, T., Taniguchi, T. (1989) Sequence of a cDNA coding for human IRF-1 Nucleic Acids Res. 17,3292[Free Full Text]
  52. 27
  53. Andrews, N. C., Faller, D. V. (1991) A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells Nucleic Acids Res. 19,2499[Free Full Text]
  54. 28
  55. Matikainen, S., Ronni, T., Hurme, M., Pine, R., Julkunen, I. (1996) Retinoic acid activates interferon regulatory factor-1 gene expression in myeloid cells Blood 88,114-123[Abstract/Free Full Text]
  56. 29
  57. Sareneva, T., Matikainen, S., Kurimoto, M., Julkunen, I. (1998) Influenza A virus-induced IFN-{alpha}/β and IL-18 synergistically enhance IFN-{gamma} gene expression in human T cells J. Immunol. 160,6032-6038[Abstract/Free Full Text]
  58. 30
  59. Matikainen, S., Pirhonen, J., Miettinen, M., Lehtonen, A., Govenius-Vintola, C., Sareneva, T., Julkunen, I. (2000) Influenza A and Sendai viruses induce differential chemokine gene expression and transcription factor activation in human macrophages Virology 276,138-147[CrossRef][Medline]
  60. 31
  61. Miettinen, M., Sareneva, T., Julkunen, I., Matikainen, S. (2001) IFNs activate Toll-like receptor gene expression in viral infections Genes Immun. 2,349-355[CrossRef][Medline]
  62. 32
  63. Siren, J., Pirhonen, J., Julkunen, I., Matikainen, S. (2005) IFN-{alpha} regulates TLR-dependent gene expression of IFN-{alpha}, IFN-β, IL-28, and IL-29 J. Immunol. 174,1932-1937[Abstract/Free Full Text]
  64. 33
  65. Jurk, M., Heil, F., Vollmer, J., Schetter, C., Krieg, A. M., Wagner, H., Lipford, G., Bauer, S. (2002) Human TLR7 or TLR8 independently confer responsiveness to the antiviral compound R-848 Nat. Immunol. 3,499[CrossRef][Medline]
  66. 34
  67. Pirhonen, J., Matikainen, S., Julkunen, I. (2002) Regulation of virus-induced IL-12 and IL-23 expression in human macrophages J. Immunol. 169,5673-5678[Abstract/Free Full Text]
  68. 35
  69. Pirhonen, J., Sareneva, T., Julkunen, I., Matikainen, S. (2001) Virus infection induces proteolytic processing of IL-18 in human macrophages via caspase-1 and caspase-3 activation Eur. J. Immunol. 31,726-733[CrossRef][Medline]
  70. 36
  71. Aebi, M., Fah, J., Hurt, N., Samuel, C. E., Thomis, D., Bazzigher, L., Pavlovic, J., Haller, O., Staeheli, P. (1989) cDNA structures and regulation of two interferon-induced human Mx proteins Mol. Cell. Biol. 9,5062-5072[Abstract/Free Full Text]
  72. 37
  73. Redecke, V., Hacker, H., Datta, S. K., Fermin, A., Pitha, P. M., Broide, D. H., Raz, E. (2004) Cutting edge: Activation of Toll-like receptor 2 induces a Th2 immune response and promotes experimental asthma J. Immunol. 172,2739-2743[Abstract/Free Full Text]
  74. 38
  75. Liu, J., Guan, X., Ma, X. (2007) Regulation of IL-27 p28 gene expression in macrophages through MyD88- and interferon-{{gamma}}-mediated pathways J. Exp. Med. 204,141-152[Abstract/Free Full Text]
  76. 39
  77. Yoneyama, M., Kikuchi, M., Natsukawa, T., Shinobu, N., Imaizumi, T., Miyagishi, M., Taira, K., Akira, S., Fujita, T. (2004) The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses Nat. Immunol. 5,730-737[CrossRef][Medline]
  78. 40
  79. Andrejeva, J., Childs, K. S., Young, D. F., Carlos, T. S., Stock, N., Goodbourn, S., Randall, R. E. (2004) The V proteins of paramyxoviruses bind the IFN-inducible RNA helicase, mda-5, and inhibit its activation of the IFN-β promoter Proc. Natl. Acad. Sci. USA 101,17264-17269[Abstract/Free Full Text]
  80. 41
  81. Alexopoulou, L., Holt, A. C., Medzhitov, R., Flavell, R. A. (2001) Recognition of double-stranded RNA and activation of NF-{kappa}B by Toll- like receptor 3 Nature 413,732-738[CrossRef][Medline]
  82. 42
  83. Melchjorsen, J., Jensen, S. B., Malmgaard, L., Rasmussen, S. B., Weber, F., Bowie, A. G., Matikainen, S., Paludan, S. R. (2005) Activation of innate defense against a paramyxovirus is mediated by RIG-I and TLR7 and TLR8 in a cell-type-specific manner J. Virol. 79,12944-12951[Abstract/Free Full Text]
  84. 43
  85. Matikainen, S., Siren, J., Tissari, J., Veckman, V., Pirhonen, J., Severa, M., Sun, Q., Lin, R., Meri, S., Uze, G., Hiscott, J., Julkunen, I. (2006) Tumor necrosis factor {alpha} enhances influenza A virus-induced expression of antiviral cytokines by activating RIG-I gene expression J. Virol. 80,3515-3522[Abstract/Free Full Text]
  86. 44
  87. Siren, J., Imaizumi, T., Sarkar, D., Pietila, T., Noah, D. L., Lin, R., Hiscott, J., Krug, R. M., Fisher, P. B., Julkunen, I., Matikainen, S. (2006) Retinoic acid inducible gene-I and mda-5 are involved in influenza A virus-induced expression of antiviral cytokines Microbes Infect 8,2013-2020[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
C. Molle, M. Goldman, and S. Goriely
Critical Role of the IFN-Stimulated Gene Factor 3 Complex in TLR-Mediated IL-27p28 Gene Expression Revealing a Two-Step Activation Process
J. Immunol., February 15, 2010; 184(4): 1784 - 1792.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
H. Yoshida, M. Nakaya, and Y. Miyazaki
Interleukin 27: a double-edged sword for offense and defense
J. Leukoc. Biol., December 1, 2009; 86(6): 1295 - 1303.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Tanaka, T. Yoshimoto, T. Naka, S. Nakae, Y.-i. Iwakura, D. Cua, and M. Kubo
Natural Occurring IL-17 Producing T Cells Regulate the Initial Phase of Neutrophil Mediated Airway Responses
J. Immunol., December 1, 2009; 183(11): 7523 - 7530.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Greenwell-Wild, N. Vazquez, W. Jin, Z. Rangel, P. J. Munson, and S. M. Wahl
Interleukin-27 inhibition of HIV-1 involves an intermediate induction of type I interferon
Blood, August 27, 2009; 114(9): 1864 - 1874.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
X. Zhang, J. Jin, Y. Tang, D. Speer, D. Sujkowska, and S. Markovic-Plese
IFN-{beta}1a Inhibits the Secretion of Th17-Polarizing Cytokines in Human Dendritic Cells via TLR7 Up-Regulation
J. Immunol., March 15, 2009; 182(6): 3928 - 3936.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Vultaggio, F. Nencini, P. M. Fitch, L. Fili, L. Maggi, P. Fanti, A. deVries, E. Beccastrini, F. Palandri, C. Manuelli, et al.
Modified Adenine (9-Benzyl-2-Butoxy-8-Hydroxyadenine) Redirects Th2-Mediated Murine Lung Inflammation by Triggering TLR7
J. Immunol., January 15, 2009; 182(2): 880 - 889.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.0307157v1
82/5/1185    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pirhonen, J.
Right arrow Articles by Matikainen, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pirhonen, J.
Right arrow Articles by Matikainen, S.