Journal of Leukocyte Biology Myeloid cells, immune suppression, tumor immunology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.0107035 on August 16, 2007

Published online before print August 16, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0107035v1
82/5/1126    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Clark, G. J.
Right arrow Articles by Hart, D. N. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Clark, G. J.
Right arrow Articles by Hart, D. N. J.
(Journal of Leukocyte Biology. 2007;82:1126-1135.)
© 2007 by Society for Leukocyte Biology

Novel human CD4+ T lymphocyte subpopulations defined by CD300a/c molecule expression

Georgina J. Clark1, Min Rao, Xinsheng Ju and Derek N. J. Hart

Mater Medical Research Institute, Brisbane, Queensland, Australia

1 Correspondence: Immunoregulation Team, DC Program, Mater Medical Research Institute, Aubigny Place, Raymond Tce, South Brisbane, Queensland 4101, Australia. E-mail: gclark{at}mmri.mater.org.au


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The CD300c (CMRF-35A) and CD300a (CMRF-35H) molecules are leukocyte surface proteins that are part of a larger family of immunoregulatory molecules encoded by a gene complex on human chromosome 17. The CMRF-35 monoclonal antibody binds to an epitope common to both molecules, expressed on most human leukocyte populations, apart from B lymphocytes and a subpopulation of CD4+ and CD8+ T lymphocytes. We describe the CMRF-35pos and CMRF-35– fractions of CD4+ T lymphocytes. The CMRF-35pos fraction can further be divided into CMRF-35++ and CMRF-35+CD4+ T lymphocyte subpopulations. Resting peripheral CD4+ T lymphocytes express CD300a mRNA and very low amounts of CD300c. Activation results in an initial decrease in CD300a gene expression before an increase in both CD300a and CD300c gene expression. The up-regulated expression of these genes was associated with increased CMRF-35 binding to activated T lymphocytes. The CMRF-35– fraction of CD4+ T lymphocytes proliferated to a greater extent than the CMRF-35pos fraction, in response to mitogens or allogeneic antigen. The poor proliferation of the CMRF-35pos CD4+ in response to mitogens was explained by increased apoptosis within this subpopulation. The recall antigen, tetanus toxoid, stimulated the CMRF-35++CD4+CD45RO+ but not the CMRF-35–CD4+CD45RO+ subpopulation. Resting CMRF-35++ CD4+ lymphocytes express low levels of IFN-{gamma} mRNA. Within 18 h following in vitro activation, CMRF-35++ CD4+ lymphocytes express more IFN-{gamma} mRNA and protein compared with the CMRF-35–CD4+ lymphocytes, however, after 24 h, both the CMRF-35+ and CMRF-35–CD4+ T lymphocytes were able to produce IFN-{gamma}. The CMRF-35++CD4+ T lymphocyte population contains the Th1 memory effector cells.

Key Words: CD300a • CD300c • T lymphocytes


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
T lymphocytes are heterogeneous, and a number of subpopulations have been defined phenotypically, for example, CD45RA is expressed on naïve T lymphocytes and CD45RO on memory T lymphocytes. Markers that relate more directly to function, particularly chemokine receptors and homing molecules, have subdivided memory T lymphocytes further, e.g., into those that lack CD62L and CCR7 as central (TCM) cells and those that express them and are capable of peripheral migration, the effector memory (TEM) populations [1 ]. Correlating the functional capacities of T lymphocyte subpopulations with phenotypically defined T lymphocyte subpopulations is central to our understanding of many disease processes and identifies target populations for future cell-based therapies.

The CD300 family of molecules is a group of Ig superfamily leukocyte surface molecules. At the 8th Human Leukocyte Differentiation Antigen Workshop, the CMRF-35 monoclonal antibody (mAb) was assigned to the CD300 cluster. The prototype members of this family are the CD300a (formerly CMRF-35H) and the CD300c (formerly CMRF-35A) molecules [2 , 3 ]. We have characterized four new members of this family [4 ], and these, like the prototype members CD300a and CD300c, are encoded by individual genes localized to a gene complex on human chromosome 17 [4 5 6 7 8 ]. Each CD300 molecule has a single V-like Ig domain. CD300a and CD300c share 80% amino acid sequence similarity between their Ig domains. The functions of these molecules and their biological ligands are unknown; however, CD300a contains ITIMs in its cytoplasmic sequence, and at least one of these is functional [5 ]. Thus, it is likely that the CD300 family molecules are involved in the regulation of the immune response.

The CMRF-35 mAb recognizes an epitope on both CD300c and CD300a and binds to most leukocytes, including monocytes, granulocytes, dendritic cells (DC), and natural killer cells. The CMRF-35 mAb binds to a subpopulation of peripheral T lymphocytes [9 ]. The aim of this paper was to characterize the CD4+ T lymphocyte population by their expression of the CD300 molecules. In this paper, we describe the phenotypic analysis of the peripheral CD4+ T lymphocyte CMRF-35pos population. The CMRF-35pos CD4+ T lymphocytes can be further subdivided into CMRF-35++ and CMRF-35+ populations, and the functional responses of these new CD4+ T lymphocyte subsets were analyzed. The CMRF-35++ CD4+ T lymphocyte population regulates T lymphocyte activation, indicating the functional significance of this novel subset and the likely importance of the CD300a/c molecules in T lymphocyte homeostasis and antigenic activation.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Samples
Fresh blood samples were obtained with consent from normal healthy donors or from buffy coats supplied through the Australian Red Cross Service (Brisbane, Australia) according to ethical guidelines approved by the Human Research Ethics Committee of the Mater Health Services. Donors were between 25 and 64 yr of age. Psoriasis samples were obtained with consent from clinically diagnosed patient donors according to ethical guidelines approved by the Human Research Ethics Committee of the Mater Health Services.

Phenotyping of T lymphocytes
Peripheral blood mononuclear cells (PBMC) were prepared by density gradient centrifugation over Ficoll-Paque Plus (Amersham Biosciences, Piscataway, NJ, USA). PBMC were labeled with CMRF-35 mAb [9 ] and sheep anti mouse secondary reagent (PE; Chemicon, Temecula, CA, USA, or Alexa 588, Invitrogen, Carlsbad, CA, USA) and directly conjugated CD4-PerCP, CD45RO-APC, and CD3-FITC, CD8-FITC, CD127-FITC, CD95-FITC, CLA-FITC, CD27-PE, CD38-PE, CD28-PE, CD62L-PE, CD195-FITC (BD Biosciences, San Jose, CA, USA), CXCR3-FITC or CCR7-FITC (R & D Systems, Minneapolis, MN, USA). Whole blood cells were labeled with antibodies prior to lysing red blood cells using FACS Lysing Solution (BD Biosciences). Cells were analyzed on a FACS Calibur or LSRII (BD Biosciences). Data were analyzed by gating on the CD4++, FSClow population of lymphocytes and excluding the CD4+, FSChigh monocyte population.

Quantitative analysis of CMRF-35 binding to CD4+ T lymphocytes
Quantitation of the levels of CMRF-35 binding to isolated CD4+ T lymphocytes was performed using a QIFKIT cytometric quantitation kit (DAKO), according to the manufacturer’s recommendations.

Isolation of CD4+ T lymphocytes
CD4+ T lymphocytes were purified from PBMC using Human CD4+ T cell enrichment cocktail (StemCell Technologies, Vancouver, BC, Canada) and a modified protocol [10 ]. CD4+ T lymphocytes were >95% pure. Purified CD4+ T lymphocytes were labeled with CMRF-35 mAb followed by sheep anti mouse secondary reagent and the CMRF-35++, CMRF-35+, and CMRF-35– populations were selected on a FACS ARIA (BD Biosciences). Fab fragments of the CMRF-35 mAb were prepared using an ImmunoPure Fab Preparation Kit, according to the manufacturer’s protocol (Pierce Biotechnology, Rockford, IL, USA). These were directly conjugated to FITC and used to sort the CD4+ T lymphocyte populations.

Allogeneic mixed leukocyte reactions
HLA-DR+Lin– DC were purified from PBMC as described by Osugi et al. [11 ]. Cell purity was routinely greater than 95%. For some experiments, BDCA-1+ DC were prepared using positive selection, according to the manufacturer’s recommendations (Miltenyi-Biotec). Allogeneic mixed leukocyte reactions (MLRs) were established using 5 x 104 HLA-DR+Lin– cells or irradiated BDCA-1+ DC, cultured with 105 allogeneic T cells that had been sorted into different subpopulations by CMRF-35 labeling, in complete RPMI 1640 media (RPMI 1640 containing 10% FCS, 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM glutamine, 10 mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid) solution (Invitrogen), 50 µM mercaptoethanol (Sigma, St. Louis, MO, USA) at 37°C in 5% CO2 for 5 days. T cell proliferation was measured by [3H]-thymidine uptake (1 µCi/well; 6.7 Ci/mM; Amersham Biosciences). Responses are reported as mean cpm ± SEM for triplicate wells.

Proliferation assay
T lymphocytes, 2 x 105 purified cells/well, were stimulated either with 30 µM PMA and 0.5 µM ionomycin or immobilized CD3 (10 µg/ml) and CD28 (10 µg/ml) [12 ] for 5 days. Proliferation was assessed by [3H]-thymidine uptake (1 µCi/well). Following stimulation, cells were analyzed for CD25 and CD69 up-regulation, cytokine synthesis, or induction of apoptosis. Alternatively, sorted T lymphocyte populations were labeled with CFSE and cultured with Dynabeads CD3/CD28 T cell expander (Dynal Biotech, Oslo, Norway) for up to 72 h. In some experiments, anti-human IFN-{gamma} mAb (B27 clone; BD PharMingen, San Jose, CA, USA) was added to neutralize secreted IFN-{gamma}.

Tetanus toxoid recall response
Purified T lymphocytes (5x104 per well) and autologous PBMC (2x104 per well, irradiated at 3000cGy) were incubated at a ratio of 2.5:1 (responder:stimulator) ratio. Tetanus toxoid (TT) was added at a concentration of 20 µg/ml. Following 5 days of culture, the lymphocytes' proliferation was assessed by the addition of [3H]-thymidine (1 µCi/well) 16 h before harvesting.

Cytokines analysis
To determine intracellular cytokine production by flow cytometry, cells were incubated with Golgi Plug (PharMingen, San Jose, CA) before labeling with IL-10-PE, IL-4-PE, and IFN-{gamma}-FITC or IFN-{gamma}-PE (PharMingen) using a Fix/Perm Kit (Caltag Laboratories).

Analysis of apoptosis
Apoptosis was assessed on 1 x 105 – 1 x 106 cells stained with Annexin V–EGFP (Clontech) and propidium iodide, at RT for 15 min in the dark before analysis on a FACS Calibur.

Real-time RT-PCR analysis
Total RNA was prepared using Trizol reagent (Invitrogen), treated with DNase I (Invitrogen), and transcribed into cDNA using Superscript III Platinum Two-Step qPCR kit (Invitrogen). Polymerase chain reaction (PCR) amplification for each cytokine used primers designed by Kruse et al. [13 ]. PCR standards for each cytokine consisted of known numbers of molecules of purified PCR product [14 ]. The primer and probe sequences for real-time PCR were ubiquitin converting enzyme (UCE)- forward: TGAAGAGAATCCACAAGGAATTGA, UCE-reverse: CAACAGGACCTGCTGAACACTG, UCE-probe: TGATCTGGCACGGGACCCTCCA [10 ], CD300a-forward: CCTGCACAACAGTGACCAAC, CD300a-reverse: CTGATGGCAACAGAGGGAT, CD300a-probe: TGGGAAACCCAGCTGCCTGTC, CD300c-forward: TGTCGCTATGAGAAGGA, CD300c-reverse: TGTCACATCGGAGAATC, CD300c-probe: CAGGACCCTCAACAAATTCTGGTGC, IFN-{gamma}-forward: AATAGCAACAAAAAGAAACGAGATGA, IFN-{gamma}-reverse: TGTATTGCTTTGCGTTGGACA and IFN-{gamma}-probe: AAAAGCTGACTAATTATTCGGTAACTGACTTGA [15 ], IL-2-forward: TGCATTGCACTAACTCTTGC, IL-2-reverse: CAGCAGTAAATGCTCCAGTTG, and IL-2-probe: TGTCACAAACAGTGCACCTACTTCAAGTTC [16 ]. Real-time PCR probes were labeled with 5'-Fam and 3'-BHQ1, (Biosearch Technologies, Novato, CA, USA). Reactions were prepared using Platinum Quantitative PCR SuperMix-UDG and Platinum Taq DNA polymerase. Amplification was performed on a Rotor-Gene 3000 (Corbett Research, Sydney, Australia). Data were analyzed using Rotor-Gene 6.0 software and REST2000 [17 ]. Data were normalized to the level of UCE.

Statistical analysis
One way ANOVA was performed on pooled data from multiple experiments. Comparisons between two groups were performed by two-tailed paired Student’s t test. Mann-Whitney U test was used to analyze binding of CMRF-35 to CD4+ T cells in normal and psoriasis donors. P < 0.05 was considered significant. Statistical analysis was performed using GraphPad Prism software (GraphPad Prism, San Diego, CA, USA).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Peripheral blood T lymphocytes express different levels of CD300a and CD300c
The CMRF-35 mAb binds CD300a and CD300c [2 ]. We have previously shown that CMRF-35 binds to between 79.1 and 90.5% (83.45±5.1%, n=7) of normal peripheral blood CD3+ cells [9 ]. The CMRF-35 mAb bound to 86.9±5.5% (n=10) of CD8+ lymphocytes but to a lesser proportion (56.2 ± 16%, n=28 with a range of 26.9 to 89.9, Fig. 1C ) of CD4+ T lymphocytes. In this paper, we extend our characterization of CMRF-35 binding to CD4+ T lymphocytes by defining novel subpopulations. CD4+ T lymphocytes were divided into CMRF-35pos and CMRF-35– populations and then divided further into CMRF-35++, CMRF-35+ and CMRF-35– populations (Fig. 1C) , accounting for 21.7 ± 10%, 34.04 ± 12.4%, and 19.6 ± 10.6% of the cells, respectively (the intervening CMRF-35 dim cells were excluded to ensure the purity of the flow cytometry gated populations (Fig. 1D) . By including CD45RO in the analysis, the CD4+ T lymphocytes were subdivided further into five distinct populations (Fig. 1E 1F) . The CD45RO+CD4+ subset contained most of the CMRF-35++ cells with 53.6 ± 23% labeled with CMRF-35 mAb, whereas 69.7 ± 16% of the CD45RA+ naïve CD4+ T lymphocytes expressed the CMRF-35 epitope but with lesser density (Fig. 1E) . This division into five distinct CD4 subpopulations on the basis of the flow cytometry dot plot labeling patterns (Fig. 1F) was consistent over the 28 donors. The phenotype analysis between whole blood and PBMC was compared (Fig. 2A 2B ). The pattern of CMRF-35 binding to CD4+CD45RO+ lymphocytes was similar, however, there appeared to be a slight variation in the MFI, with the PBMC fraction showing marginally increased intensity of staining with the CMRF-35 mAb. We performed repeat phenotyping on three normal donors and found that the CD4+CMRF-35+ T lymphocyte populations appeared to be stable, that is, were similar in these healthy individuals over at least three months (Fig. 2C 2D) . As the CMRF-35++ T lymphocytes were found in the CD45RO memory population and the CMRF-35+ cells were found mainly in the naïve CD45RO– T lymphocyte population, we assessed the binding of the CMRF-35 mAb to naïve cord blood CD4+ T lymphocytes and tonsil CD4+ T lymphocytes. Most cord blood CD4+ lymphocytes bound CMRF-35 mAb at low levels, and only a small population of CMRF-35–CD4+ T lymphocytes was identified (data not shown). Tonsil CD4+ lymphocytes showed high, medium, and low levels of CMRF-35 binding. Thus, the CMRF-35 detected a pattern of CD300a/c expression, which differs between naïve and experienced CD4+ T lymphocytes, and identified five peripheral CD4+CD45RO+ T lymphocyte populations that remain stable in the absence of disease.


Figure 1
View larger version (37K):
[in this window]
[in a new window]

  		Figure 1. Percentage of CMRF-35+ T lymphocyte subsets in normal subjects. Fresh human peripheral PBMC were labeled with CD8 or CD4, CD45RO, and CMRF-35. (A) Flow cytometry dot plot showing the binding of the CMRF-35 mAb on the CD8+ T lymphocyte subpopulation. Regions show the CMRF-35+ and CMRF-35– populations. CD8 T lymphocytes were subdivided into different populations on the basis of CMRF-35 and CD45RO staining in comparison to isotype negative controls. (B) Percentages of the different CD8+ T lymphocyte populations defined by CMRF-35 and CD45RO staining. (n=9). (C) Flow cytometry dot plot showing the binding of the CMRF-35 mAb on the CD4+ T lymphocyte subpopulation. This divided CD4+ T lymphocytes into a CMRF-35pos fraction (above double dotted line) and CMRF-35– fraction. The double-dotted line represents staining with an isotype control antibody. Regions show the CMRF-35++, CMRF-35+, and CMRF-35– populations. The CMRF-35pos population was further divided into CMRF-35++ and CMRF-35+ populations, as indicated by the dotted lines. (D) The proportions of CMRF-35 subpopulations indicated that most CD4+ T lymphocytes bound CMRF-35 and that, of these, most cells bound intermediate levels of mAb. (E) Flow cytometric dot plot indicating the binding of CMRF-35 and CD45RO to CD4+ T lymphocytes, demonstrating that the CMRF-35++ CD4 T lymphocytes are predominantly memory cells. (F) Percentages of the CD4+ T lymphocyte populations defined by CMRF-35 and CD45RO binding. The bars are means ± SD from 28 different donors.

 

Figure 2
View larger version (43K):
[in this window]
[in a new window]

  		Figure 2. Subdivision of CD4+ T lymphocytes by the CMRF-35 mAb is found in whole blood and remains stable over time. Flow cytometry dot plots from one donor (CR) displaying the binding of the CMRF-35 and CD45RO mAb gated on the CD4+ T lymphocyte subpopulation in whole blood (A) compared with peripheral blood mononuclear cells (B). Flow cytometry dot plots of two separate samples taken on day 1 (C) and day 60 (D) intervals from donor MM. The dot plots display the binding of the CMRF-35 and CD45RO mAb gated on the CD4+ T lymphocyte subpopulation.

 
Separation of CD4+ T lymphocytes into CMRF-35++, CMRF-35+, and CMRF-35– populations
CD4+ T lymphocytes were purified by negative selection and labeled with the CMRF-35 mAb followed by sheep anti mouse PE. FACS analysis of these samples enabled discrimination of the three populations as shown in Fig. 3A . The level of CMRF-35 binding to the CMRF-35++ population was 10-fold higher and 100-fold higher than to the CMRF-35+ and CMRF-35– populations, respectively, as quantified cytometrically using the QIFKIT.


Figure 3
View larger version (11K):
[in this window]
[in a new window]

  		Figure 3. CD4+ T lymphocytes can be subdivided by the CMRF-35 mAb. (A) Histogram of the binding of CMRF-35 mAb detected with sheep anti-mouse PE to the CD4+ T lymphocytes from peripheral blood. The dotted lines indicate where the gates are set to allow sorting of the populations for functional assays. (B) Real-time PCR analysis showing the relative expression of CD300a to UCE in the three CD4+ populations. CD300c expression was below the sensitivity in freshly sorted CD4 populations.

 
Expression of CD300a and CD300c genes in the CD4+ populations
As the CMRF-35 mAb binds to both CD300a and CD300c, we used RT-PCR to investigate their mRNA expression in the CD4+ T lymphocyte populations. Although both the CD300a and CD300c genes are expressed by resting CD4+ T lymphocytes, CD300c was expressed at much lower levels relative to control UCE expression. Purified CMRF-35++ CD4+ T lymphocytes expressed high levels of CD300a mRNA, with lower levels expressed in the CMRF-35+ CD4+ T lymphocytes (Fig. 3B) , consistent with the surface antigen density. Activation of CD4+ T lymphocytes with CD3/CD28 beads produced in an initial down-regulation of CMRF-35 binding at 48 h, followed by increased surface staining at 72 h (Fig. 4A ). This was reflected in an initial down-regulation of both CD300a and CD300c gene expression at 24 h followed by re-expression at 48 h (Fig. 4B) . These results indicate that subpopulations of peripheral CD4+ T lymphocytes express the inhibitory molecule CD300a and that activation of these cells almost certainly up-regulated the surface expression of both the CD300a and CD300c gene products.


Figure 4
View larger version (23K):
[in this window]
[in a new window]

  		Figure 4. CMRF-35 mAb binding is up-regulated on CD4+ T lymphocytes following activation with CD3/CD28. (A) Histograms showing the up-regulation of CMRF-35 during an activation time course. (B) Real-time PCR analysis of the regulation of CD300a and CD300c genes at different times after CD3/CD28 activation. Solid bars represent CD300a normalized to UCE, and open bars represent CD300c normalized to UCE expression.

 
Phenotype of resting peripheral blood T lymphocyte defines a new T lymphocyte subset
The CD4+CD45RO+/– T lymphocyte populations were then phenotyped in greater detail (Fig. 5 ). The expression of three chemokine receptors within the CMRF-35-defined populations was analyzed. CMRF-35 detected CD300a/c molecules were identified on only ~50% of the CD4+CD45RO+CCR7+ TCM lymphocytes, whereas most CD4+CD45RO+CCR7– TEM lymphocytes were CMRF-35+. However, there was no correlation of CMRF-35 staining of the CD45RO+CD4+ T lymphocytes with their expression of either CCR7 or CD62L, indicating that the CD300 molecules do not segregate with the currently defined TEM or TCM but they, as markers, instead subdivide this population further into distinct novel subsets. CXCR4+ cells were found within both the CMRF-35+ and CMRF-35++ populations. The chemokine receptor CXCR3 expression was greatest on the CMRF-35++CD4+CD45RO+ population, although the mAb stained a subset within the CMRF-35– population. Similarly, only CMRF-35++CD45RO+ cells bound the CCR5 mAb. All CMRF-35++CD4+ T lymphocytes expressed CD95, whereas most CMRF-35+CD4+ T lymphocytes were CD95–. CMRF-35–CD4+ T lymphocytes included CD95+ and CD95– populations. CD27 is used as a marker to track the maturation of naïve to memory cells. Most CMRF-35–CD4+ T lymphocytes expressed CD27. The CMRF-35++ CD4+ T lymphocytes included both CD27+ and CD27– populations, whereas CMRF-35+CD4+ T lymphocytes were CD27+. CD127+ and CD127– populations were found within each CD4+ T lymphocyte defined by CMRF-35. CMRF-35– CD4+ cells were present in both the CD25+ and CD25– populations, but all CD25++CD4+CD45RO+ cells were CMRF-35–. CD300a and CD300c are expressed on both the CD28+ and CD28– T lymphocyte populations; however, all CMRF-35– T lymphocytes were CD28+ (data not shown). The CMRF-35+ and CMRF-35– T lymphocyte populations are found within the CD38+CD4+ T lymphocytes. Skin homing cells (CLA+) were found in both the CMRF-35+ and CMRF-35– subsets. Overall, this phenotypic analysis suggested that CMRF-35 identified novel subpopulations of CD4+ T lymphocytes, with the CMRF-35++ cells containing a TEM/Th1 subpopulation (CCR7–CXCR3+), whereas the CD4+CD25++ T lymphocytes, which contain many of the Treg, cells were predominantly CMRF-35–.


Figure 5
View larger version (47K):
[in this window]
[in a new window]

  		Figure 5. CMRF-35 mAb detects a novel subpopulation of CD4+ T lymphocytes. Flow cytometry dot plots show the binding of the CMRF-35 mAb to CD4 subpopulations. Cells were gated on the low FSC, CD4+ population to identify CD4+ T lymphocytes from monocytes. The naïve population is represented by dot plots displaying the cells in the CD45RO– gate, and the memory population shows the CD45RO+ gate. The dot plots show the binding of CMRF-35 and CCR7, CXCR4, CXCR3, CCR5, CD95, CD27, CD127, and CD25 (log10 fluoresence units) to the CD4+ population.

 
CMRF-35pos T lymphocytes are less responsive in an allogeneic MLR than the CMRF-35– T lymphocytes
As the CMRF-35 mAb could separate CD4+ T lymphocytes into distinct novel subpopulations, we first looked at potential functional differences between the combined CMRF-35pos and the CMRF-35– T lymphocyte populations. This was assessed by testing the ability of each CD4+ T lymphocyte subpopulation to respond to allogeneic HLA-DR+Lin– stimulators in an MLR. The CMRF-35pos CD3+ cells proliferated less compared with the CMRF-35–CD3+ or unseparated CD3+ T lymphocyte populations (data not shown). The CMRF-35pos CD4+ T lymphocytes also proliferated less compared with the CMRF-35–CD4+ or CD4+ populations of T lymphocytes (P<0.05, Fig. 6A ). CD4+ T lymphocytes labeled with the CMRF-35 mAb but not separated into positive and negative populations were used as a control population to determine any effects the mAb binding might have on the proliferative capacity of CD4+ T lymphocytes. No significant difference in allogeneic responses between labeled and the control unlabeled CD4+ T lymphocytes was observed. When the CMRF-35pos population was further divided into CMRF-35+ and CMRF-35++ populations, the trend remained the same with the CMRF-35++ population showing the less proliferation in an MLR compared with CD4+ T lymphocytes (P<0.05, Fig. 6B )


Figure 6
View larger version (18K):
[in this window]
[in a new window]

  		Figure 6. Proliferative responses of CMRF-35+ subpopulations of CD4+ T lymphocytes. (A) CD4+, CMRF-35– CD4+, and CMRF-35pos CD4+ T lymphocyte populations were incubated with allogeneic HLA–DR+Lin– DC. Proliferation was measured by 3[H]-thymidine. Results from one representative experiment (n=19) are shown as the triplicate values ± SEM. (B) CD4+, CMRF-35–CD4+, CMRF-35+CD4+, and CMRF-35++ CD4+ T lymphocyte populations were incubated with allogeneic DC. Proliferation was measured by 3[H] thymidine. Results from one representative experiment (n=3) are shown as the triplicate values ± SEM. (C) CD4+, CMRF-35–CD4+, CMRF-35+CD4+, and CMRF-35++CD4+ T lymphocyte populations were activated with PMA/ionomycin. Proliferation was measured by 3[H]-thymidine. Results from one representative experiment (n=2) are shown as the triplicate values ± SEM. (D) CD4+, CMRF-35– CD4+ and CMRF-35posCD4+ T lymphocyte populations were activated with PMA/ ionomycin in the absence (open bars) or presence (solid bars) of 100 U exogenous IL-2 and proliferation monitored by 3[H]-thymidine. Results from one representative experiment (n=3) are shown as the triplicate values ± SEM.

 
The CMRF-35pos CD4+ subset is less responsive to in vitro activation signals than the CMRF-35– CD4+ subset
The stimulator cells in the allogeneic MLR (HLA-DR+Lin– blood DC) bind CMRF-35. The potential influence of CMRF-35 expression on the stimulating cell population was therefore excluded by activating the purified T lymphocytes in vitro. Purified CMRF-35–, CMRF-35+, and CMRF-35++ populations of CD4+ T lymphocytes were activated with PMA/ionomycin and compared with unfractionated CD4+ T lymphocytes. The CMRF-35++ subset incorporated less [3H]-thymidine than the other fractions or unseparated cells (Fig. 6C) . Incorporation of [3H]-thymidine by purified CD45RA+ CD4+ T lymphocytes or CD45RA–CD4+ T lymphocytes following in vitro activation was similar to incorporation by the CMRF-35–CD4+ or the unfractionated T lymphocyte samples (data not shown). To confirm these results, we labeled cells with CFSE prior to activation. The percentage of cells undivided is shown in Table 1 . A higher percentage of the CMRF-35++ population of cells failed to enter into division.


View this table:
[in this window]
[in a new window]

  		Table 1. Percentage of CD4+ T Lymphocyte Populations Dividing After Activation With PMA/Ionomycin

 
To ensure that CMRF-35 binding was not delivering a negative signal, we made CMRF-35 Fab fragments, conjugated these to FITC, then labeled and sorted the CMRF-35pos CD4+ T lymphocytes for repeat experiments. CMRF-35pos CD4+ T lymphocytes prepared using the Fab fragments had the same hypoproliferative response in both in vitro activation and recall assays as did the CMRF-35pos CD4+ T lymphocytes prepared using whole IgG antibody (data not shown).

CMRF-35posCD4+ and CMRF-35–CD4+ T lymphocytes were activated in vitro in the presence of exogenous IL-2. The presence of excess IL-2 did not restore the proliferative capacity of the CMRF-35pos CD4+ T lymphocytes to the same level as the CMRF-35–CD4+ T lymphocytes (Fig. 6D) . Thus the lack of CMRF-35pos CD4+ T lymphocyte proliferation observed was not due to lymphokine deprivation.

Activation of the CMRF-35pos and CMRF-35– CD4+ T lymphocyte populations was assessed by following CD25 and CD69 up-regulation. Each population had similar levels of CD69 up-regulation at 24 h after stimulation with PMA/ionomycin or immobilized CD3/CD28, but the up-regulation of CD25 differed significantly between the populations. CD25 was increased earlier on the CMRF-35pos population than on the CMRF-35– population or the control unfractionated CD4+ T lymphocytes.

CMRF-35++ T lymphocytes are more responsive to recall antigen than the CMRF-35– T lymphocytes
The responses of the CMRF-35pos and CMRF-35– CD4+ T lymphocyte populations to the recall antigen, TT, were tested to determine whether the hypoproliferation of CMRF-35pos CD4+ T lymphocytes was due to the increased percentage of CMRF-35pos lymphocytes in the CD4+CD45RO+ memory T lymphocyte subpopulation. In accord with the MLR results, less TT induced proliferation was observed in the CMRF-35pos CD4+ T lymphocyte subpopulation (Fig. 7A ), confirming that the combined CMRF-35pos CD4+ T lymphocyte population did not proliferate to the same extent as the CMRF-35–CD4+ T lymphocyte population. The responder population was then further divided into the CMRF-35++CD4+, CMRF-35+CD4+, and CMRF-35–CD4+ subpopulations and their individual response to TT was tested simultaneously at the same responder:stimulator ratio (Fig. 7B) . The most significant TT-induced [3H]-thymidine incorporation was observed by the CMRF-35++ CD4+ cells (which include predominantly CD45RO+ cells) and the least by the CMRF-35– CD4+ cells, which includes both CD45RO+ and CD45RO– cells. There was significantly more proliferation to TT in the CMRF-35++CD4+ population than either the CMRF-35+CD4+ or CMRF-35–CD4+ populations (P<0.05). Thus the CD45RO+CD4+ population could be divided into subpopulations on the basis of CMRF-35 expression, and this also divided the memory cells into those that respond to TT recall antigen and those that do not.


Figure 7
View larger version (17K):
[in this window]
[in a new window]

  		Figure 7. Memory CD4+ T lymphocytes for TT recall antigen express CMRF-35 molecules (A) CMRF-35– CD4+, CMRF-35pos CD4+, and CD4+ T lymphocyte populations were stimulated with tetanus toxoid presented by irradiated autologous PBMC. Results from one representative experiment (n=3) are shown as the triplicate values ± SEM. (B) CD4+, CMRF-35–CD4+, CMRF-35+ CD4+, and CMRF-35++CD4+ T lymphocyte populations were incubated with autologous T-depleted, irradiated PBMC in the presence of TT. Proliferation was measured by 3[H]-thymidine. Results from one representative experiment (n=3) are shown as the triplicate values ± SEM.

 
Cytokine expression by CMRF-35+ activated lymphocytes
The addition of exogenous IL-2 did not allow recovery of the CMRF-35pos population’s proliferative response to PMA/ionomycin (Fig. 6D) . We next assayed the expression of cytokine mRNA in the MLR and in vitro activated samples by real-time RT-PCR. Following activation by PMA/ionomycin, the combined CMRF-35pos CD4+ T lymphocyte population expressed over three-fold more IL-2 mRNA than the CMRF-35–CD4+ populations. However, when the CMRF-35pos CD4+ population was divided into the CMRF-35++CD4+ and CMRF-35+CD4+ populations, IL-2 mRNA was only expressed by the CMRF-35+CD4+ population with very low amounts expressed by the CMRF-35++CD4+ population. On the other hand, IFN-{gamma} mRNA was predominantly expressed by the CMRF-35++CD4+ population, with very low amounts expressed by the CMRF-35+CD4+ and CMRF-35–CD4+ populations (Fig. 8 ). In addition, more IFN-{gamma} mRNA was produced in the MLR between HLA-DR+Lin– DC and CMRF-35pos T lymphocyte populations than in the MLR between HLA-DR+Lin– DC and CMRF-35– T lymphocyte populations or when unfractionated CD4+ T lymphocytes were used as responders. Very little IL-4 mRNA was produced in these MLR samples, although there was some IL-10 produced (data not shown).


Figure 8
View larger version (8K):
[in this window]
[in a new window]

  		Figure 8. CMRF-35++CD4+ T lymphocytes are the major IFN-{gamma} producing cells in the CD4+ T lymphocyte population and are more susceptible to apoptosis than the CMRF-35+CD4+ and CMRF-35–CD4+ T lymphocyte populations. (A) Expression of IFN-{gamma} (solid bars) and IL-2 (hatched bars) mRNA analyzed by RT-PCR in unfractionated CD4+, CMRF-35–CD4+, CMRF-35+CD4+, and CMRF-35++CD4+ T lymphocyte populations after activation with PMA/ionomycin. (B) Percentage of Annexin V+ cells in the CMRF-35–CD4+, CMRF-35+CD4+, and CMRF-35++CD4+ T lymphocyte populations following 4-h activation with immobilized CD3/CD28 antibodies. Results are from one of five representative experiments.

 
The results of the RT-PCR cytokine assays were confirmed by intracellular labeling. Purified CMRF-35+/++CD4+ and CMRF-35–CD4+ populations of CD4+ T lymphocytes were activated in vitro with PMA/ionomycin and were assayed for intracellular IL-4, IL-10, or IFN-{gamma}. Neither IL-4 nor IL-10 was detected in any in vitro activated population by intracellular labeling (data not shown). Following activation for 4 h with PMA/ionomycin, the CMRF-35–CD4+ population expressed little intracellular IFN-{gamma} but a subpopulation of the CMRF-35posCD4+ T lymphocyte population had readily detectable cytokine (Fig. 8A) .

Proliferation resulted with the CMRF-35–CD4+ population and to a lesser extent in the CMRF-35+CD4+ population but again the CMRF-35++CD4+ population did not proliferate in the absence of recall antigen. These results indicate that the CMRF-35++CD4+T lymphocyte subpopulation contains the effector memory cells that respond with IFN-{gamma} production but do not proliferate, unless exposed to specific antigen.

The CMRF-35++ T lymphocytes undergo apoptosis which is not inhibited by blocking IFN-{gamma}
In vitro activated CMRF-35–, CMRF-35+, and CMRF-35++ CD4+ T lymphocytes were stained with annexin V-EGFP and propidium iodide to assess apoptosis. Following in vitro activation with CD3/CD28, the CMRF-35++CD4+ T lymphocyte population was clearly more susceptible to apoptosis, even after four hours of activation (Fig. 8B) . The CMRF-35++ subpopulation secreted the majority of the IFN-{gamma} within CD4+ T lymphocytes. Others have shown that IFN-{gamma} is implicated in activation-induced cell death [18 ]. To investigate whether the secreted IFN-{gamma} contributed to the apoptosis and lack of proliferation of the CMRF-35++ population, in the absence of recall antigen, we retested the activation of the CMRF-35-defined subpopulations, in the presence of an IFN-{gamma} neutralizing mAb. Rapid cell death was still observed despite the presence of an effective concentration (10 µg/ml) of neutralizing anti-IFN [18 ]{gamma} mAb. Thus, it appears that the IFN-{gamma} produced by the CMRF-35++CD4+ T lymphocyte subpopulation was not responsible; instead it appears that the lack of a specific recall antigenic stimulus allows apoptosis to proceed in these effector memory cells.

The CMRF-35++CD45RO+CD4+ T lymphocyte population is altered in psoriasis
The novel CD4+ T lymphocyte subpopulations defined by CMRF-35 mAb were stable in normal steady state conditions but to examine their potential modification by sustained immune perturbation, we screened a group of patients with the Th1-mediated chronic inflammatory disease, psoriasis. In some, but not all, samples tested (n=36), we found that the profiles of CMRF-35 mAb labeling of CD45RO+ CD4+ T lymphocytes was altered (Fig. 9A ). The analysis of peripheral blood samples from psoriasis patients showed that there was a significant reduction in the binding of CMRF-35 mAb to CD45RO+CD4+ memory T lymphocytes in patients compared with a cohort of normal controls (Fig. 9 , P=0.04). Removal of patients on systemic treatment at the time of donation from the analysis increased the significance of this difference (P=0.014).


Figure 9
View larger version (17K):
[in this window]
[in a new window]

  		Figure 9. Psoriasis patients have lower levels of CMRF-35 binding to CD45RO+CD4+ peripheral T lymphocytes than normal donors. (A) Fresh human peripheral PBMC from psoriasis patients and normal donors were labeled with CD4, CD45RO, and CMRF-35. Flow cytometry dot plot showing the binding of the CMRF-35 and CD45RO mAb on the gated CD4+ T lymphocyte subpopulation of this patient, which differs from normals (Fig. 2). (B) The CMRF-35 MFI staining above background staining with an isotype control ({Delta}MFI) is plotted for 36 psoriasis patients and 24 normal donors.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
We have shown that, in steady-state conditions, cell surface CD300a/c epitopes detected by the mAb CMRF-35 are present on novel subpopulations of CD4+ T lymphocytes. The binding of CMRF-35 to resting CD4+ T lymphocytes corresponds at the mRNA level with the expression of CD300a and not CD300c. Our analysis of the phenotype and function of the CMRF-35pos CD4+ T lymphocytes compared with CMRF-35–CD4+ T lymphocytes indicated that the CMRF-35pos fraction could be further divided into the CMRF-35++CD4+ and CMRF-35+CD4+ subpopulations. The data presented here provide initial evidence that these are novel subpopulations, distinct from the currently defined naïve and memory populations and that they are relevant, both in the steady state, and for further investigation in human disease. Most notably, the CMRF-35++CD4+ T lymphocyte subpopulation expressed IFN-{gamma} mRNA spontaneously and early after activation but only proliferated in response to the recall antigen TT, being hypoproliferative and prone to apoptosis in response to Ag-independent stimuli.

We monitored the expression of CD300a, which has cytoplasmic ITIMs and also CD300c, which is anticipated to partner with an ITAM signaling molecule in CD4+ T lymphocytes from cord blood, adult peripheral blood, and tonsil. Only a low level of CMRF-35 binding to cord blood CD4+ T lymphocytes was noted, and CD300a/c expression was up-regulated on tonsils from children and peripheral blood lymphocytes in adults. The CD300a molecule was present on both the CMRF-35+ and CMRF-35++CD4+ T lymphocyte subpopulations. Furthermore, CD300a mRNA was increased in the CMRF-35++ cells, as predicted by the intensity of surface CMRF-35 mAb labeling. We showed that most of the CMRF-35+ CD4+ T lymphocytes cells are CD45RO– or naïve T lymphocytes, whereas the CMRF-35++ cells are predominantly contained within the CD45RO+ memory population. This suggests that CD300a up-regulation as a potential inhibitory molecule is associated with the differentiation of naïve into memory CD4+ T lymphocytes but, at the same time, provides a potential new marker for subdividing functional cell subpopulations.

By combining CMRF-35 and CD45RO labeling, we divided the CD45RO+ CD4+ memory T lymphocytes further into CMRF-35++ and CMRF-35– populations and showed that the CMRF-35++ population contains most of the steady state Th1 effector memory cells. However, this CMRF-35++ population could be further divided phenotypically on the expression of the same lymph node or tissue homing receptors used to define memory cells, effector functions, proliferative capacity, and responses to homeostatic cytokines [19 ]. TEM (effector memory) cells have down-regulated the CCR7 and CD62L lymph node homing receptors and are primed to respond to antigen stimulation [1 ]. Others have suggested that antigen-specific memory T cells are present in alternatively defined memory subsets, which depend on the nature of the immune response generated [20 ]. In our experiments, we localized the memory response to TT within the CMRF-35++ and not the CMRF-35– CD45RO+ CD4+ T lymphocyte population, allowing further subdivision of memory cell function. Interestingly, these cells did not proliferate in response to antigen-independent (PMA/ionomycin) stimulation, reflecting the different signals involved and the effects of the antigen-presenting cells on CD4 memory responses [21 ].

The differentiation of memory CD4 T cells has been suggested to proceed through stages, allowing three sequential populations to be defined by the CCR7+CD27+, CCR7–CD27+, and finally the CCR7–CD27– phenotypes [22 ]. The majority of memory CD45RO+CD4+ cells are CCR7+CD27+ and 80% of each of the CMRF-35+ CD4+ and CMRF-35++ CD4+ subpopulations were within this group, emphasizing the potential value of CMRF-35 for dissecting T cell memory in more detail. The mature CCR7–CD27– cells generally expressed high levels of CD300a/c, again indicating that this population contains the effector memory cell types.

Classical Treg cells have been commonly identified as CD4+CD25++ cells expressing nuclear Foxp3. We found that most CD4+CD25++ T lymphocytes were found in the CMRF-35- fraction and not the CMRF-35++CD4+ population that had limited proliferative capacity. The absence of CD127 on CD4+ T lymphocytes has been correlated with Treg cells [23 , 24 ], but CD127– cells were present in all the populations we defined by the level of CMRF-35 epitope expression. Analysis of the regulatory function of the CD127– Treg cells after being further subdivided with the CMRF-35 mAb merits investigation.

The decreased proliferative response to antigen-independent stimulation and increased IFN-{gamma} production by the CMRF-35++CD4+ T lymphocyte population, in response to activation was associated with a significant increase in apoptosis, that was not observed with the other populations. The CMRF-35–CD4+ T lymphocyte population showed normal proliferation, little IFN-{gamma} production, less annexin V staining, and less surface Fas ligand (CD95). IFN-{gamma} is required for activation-induced cell death [18 ] and for the induction of CD95 [25 ]. Thus T cell homeostasis is in part controlled by IFN-{gamma}, which limits T cell expansion by reducing survival rather than inhibiting cell cycle progression [18 ]. We have shown here that the CMRF-35 mAb identifies a population of CMRF-35++CD4+ T lymphocytes, which undergoes increased apoptosis and IFN-{gamma} production in response to antigen-independent activation signals. This makes these cells more susceptible to apoptosis in the absence of specific recall antigen exposure. Our data appeared to exclude a contribution from the IFN-{gamma} to this apoptotic process, as neutralizing mAb did not prevent it. We, therefore, favor the view that the IFN-{gamma}-secreting capacity of these cells relates to their capacity to respond rapidly, when exposed to antigen and that it also acts as a protective homeostatic mechanism to control their proliferation in the absence of specific antigen. It is even possible that it is the failure of such mechanisms that contribute to inflammatory/autoimmune diseases, and hence, the reduced presence of this population that we noted in psoriasis, perhaps reflecting their migration to the tissues, is most interesting. This CMRF-35++CD4+ T lymphocyte population that can now be defined in normal human peripheral blood is similar to the population of Th1 lineage cells defined by IFN-{gamma} production described in mice by Wu and colleagues [26 ]. They showed these Th1 cells to include short-lived IFN-{gamma}-secreting cells that, likewise, underwent apoptosis but not via an IFN-{gamma}-dependent mechanism.

It is likely that the clinical relevance of the novel T lymphocyte populations extends to other autoimmune/inflammatory diseases and transplantation interactions. We have not attempted as yet to investigate the possibility that Th1 or Th2 responses may be differentially expressed in these novel populations, given that this depends considerably on the stimulators used. At face value, the CMRF-35++ IFN-{gamma} production population response appear to be Th1 on the basis of their IFN-{gamma} production (and their failure to produce IL-4). Changes in either the function or the frequency of this novel IFN-{gamma} producing CD4+ T lymphocyte population and the other populations defined by CD300a/c expression in other autoimmune diseases is being assessed. In the primary immune response, T cells are activated in an antigen-specific manner and, once activated, nonspecific activation through bystander activity is potentially dangerous. Our experiments appear to have revealed an important functional mechanism, at least for the CMRF-35++ subpopulation of memory cells: these appear to be programmed to die rapidly following nonspecific activation but are able to respond to specific recall antigen with prompt CD25 expression and IL-2 production (given the lack of effect of additional IL-2) and to proliferate.

Discerning the molecular mechanism involved will be complex, but presumably, it relates to the new signaling networks established in naïve cells after their first exposure to specific antigen triggering via an antigen-presenting cell. The CD300a molecule itself may contribute to this by its ITIM motifs down-modulating the threshold for triggering a T lymphocyte response.

In summary, the CMRF-35 mAb defines novel CMRF-35– CD4+, CMRF-35+ CD4+ and CMRF-35++ CD4+ T lymphocyte subpopulations. The latter includes the major IFN-{gamma}-secreting CD4+ cell subset and the cells that respond to the recall antigen TT. This population also has the novel functional capacity to self-regulate its response to nonspecific antigen and induces an apoptotic process that may be designed to avoid inappropriate bystander autoimmune activation. The functional capacities of these new subpopulations will require much more investigation, but our initial data suggesting that these new subpopulations are altered substantially in psoriasis, suggests that the data may have considerable relevance.


   ACKNOWLEDGEMENTS
 
We would like to acknowledge the technical support from Sonya Fitzpatrick and the flow cytometry support from Ken Field, Robert Wadley, and Dahlia Kahill. This work has been supported by the Australian National Health and Medical Research Council.

Received January 17, 2007; revised March 6, 2007; accepted July 17, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sallusto, F., Lenig, D., Forster, R., Lipp, M., Lanzavecchia, A. (1999) Two subsets of memory T lymphocytes with distinct homing potentials and effector functions Nature 401,708-712[CrossRef][Medline]
  2. Green, B. J., Clark, G. J., Hart, D. N. (1998) The CMRF-35 mAb recognizes a second leukocyte membrane molecule with a domain similar to the poly Ig receptor Int. Immunol. 10,891-899[Abstract/Free Full Text]
  3. Jackson, D. G., Hart, D. N. J., Starling, G. C., Bell, J. I. (1992) Molecular cloning of a novel member of the immunoglobulin gene superfamily homologous to the polymeric immunoglobulin receptor Eur. J. Immunol. 22,1157-1163[Medline]
  4. Clark, G., Fitzpatrick, S., Kuo, C., Modra, C., Jamriska, L., Hart, D. (2003) The CMRF-35 family of molecules: a new leukocyte receptor complex on chromosome 17 Current Trends Immunol. 5,55-64
  5. Cantoni, C., Bottino, C., Augugliaro, R., Morelli, L., Marcenaro, E., Castriconi, R., Vitale, M., Pende, D., Sivori, S., Millo, R., et al (1999) Molecular and functional characterization of IRp60, a member of the immunoglobulin superfamily that functions as an inhibitory receptor in human NK cells Eur. J. Immunol. 29,3148-3159[CrossRef][Medline]
  6. Clark, G. J., Green, B. J., Hart, D. N. (2000) The CMRF-35H gene structure predicts for an independently expressed member of an ITIM/ITAM pair of molecules localized to human chromosome 17 Tissue Antigens 55,101-109[CrossRef][Medline]
  7. Clark, G.J., Cooper, B., Fitzpatrick, S. B. G., Hart, D.N.J. (2001) The gene encoding the immunoregulatory signaling molecule CMRF-35A localized to human chromosome 17 in close proximity to other members of the CMRF-35 family Tissue Antigens 57,415-423[CrossRef][Medline]
  8. Speckman, R. A., Wright Daw, J. A., Helms, C., Duan, S., Cao, L., Taillon-Miller, P., Kwok, P. Y., Menter, A., Bowcock, A. M. (2003) Novel immunoglobulin superfamily gene cluster, mapping to a region of human chromosome 17q25, linked to psoriasis susceptibility Hum. Genet. 112,34-41[CrossRef][Medline]
  9. Daish, A., Starling, G. C., McKenzie, J. L., Nimmo, J. C., Jackson, D. G., Hart, D. N. J. (1993) Expression of the CMRF-35 antigen, a new member of the immunoglobulin gene superfamily, is differentially regulated on leucocytes Immunology 79,55-63[Medline]
  10. De Mestre, A. M., Khachigian, L. M., Santiago, F. S., Staykova, M. A., Hulett, M. D. (2003) Regulation of inducible heparanase gene transcription in activated T cells by early growth response 1 J. Biol. Chem. 278,50377-50385[Abstract/Free Full Text]
  11. Osugi, Y., Vuckovic, S., Hart, D. N. (2002) Myeloid blood CD11c(+) dendritic cells and monocyte-derived dendritic cells differ in their ability to stimulate T lymphocytes Blood 100,2858-2866[Abstract/Free Full Text]
  12. Geppert, T. D., Lipsky, P. E. (1991) Immobilized anti-CD3-induced T cell growth: comparison of the frequency of responding cells within various T cell subsets Cell. Immunol. 133,206-218[CrossRef][Medline]
  13. Kruse, N., Moriabadi, N. F., Toyka, K. V., Rieckmann, P. (2001) Characterization of early immunological responses in primary cultures of differentially activated human peripheral mononuclear cells J. Immunol. Methods 247,131-139[CrossRef][Medline]
  14. Yin, J. L., Shackel, N. A., Zekry, A., McGuinness, P. H., Richards, C., Putten, K. V., McCaughan, G. W., Eris, J. M., Bishop, G. A. (2001) Real-time reverse transcriptase-polymerase chain reaction (RT-PCR) for measurement of cytokine and growth factor mRNA expression with fluorogenic probes or SYBR Green I Immunol. Cell Biol. 79,213-221[CrossRef][Medline]
  15. Bonanomi, A., Kojic, D., Giger, B., Rickenbach, Z., Jean-Richard-Dit-Bressel, L., Berger, C., Niggli, F. K., Nadal, D. (2003) Quantitative cytokine gene expression in human tonsils at excision and during histoculture assessed by standardized and calibrated real-time PCR and novel data processing J. Immunol. Methods 283,27-43[CrossRef][Medline]
  16. Flores, M. G., Zhang, S., Ha, A., Holm, B., Reitz, B. A., Morris, R. E., Borie, D. C. (2004) In vitro evaluation of the effects of candidate immunosuppressive drugs: flow cytometry and quantitative real-time PCR as two independent and correlated read-outs J. Immunol. Methods 289,123-135[CrossRef][Medline]
  17. Pfaffl, M. W., Horgan, G. W., Dempfle, L. (2002) Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR Nucleic Acids Res. 30,e36[Abstract/Free Full Text]
  18. Refaeli, Y., Van Parijs, L., Alexander, S. I., Abbas, A. K. (2002) Interferon gamma is required for activation-induced death of T lymphocytes J. Exp. Med. 196,999-1005[Abstract/Free Full Text]
  19. Lanzavecchia, A., Sallusto, F. (2005) Understanding the generation and function of memory T cell subsets Curr. Opin. Immunol. 17,326-332[CrossRef][Medline]
  20. Rivino, L., Messi, M., Jarrossay, D., Lanzavecchia, A., Sallusto, F., Geginat, J. (2004) Chemokine receptor expression identifies Pre-T helper (Th)1, Pre-Th2, and nonpolarized cells among human CD4+ central memory T cells J. Exp. Med. 200,725-735[Abstract/Free Full Text]
  21. McKinlay, A., Radford, K., Kato, M., Field, K., Gardiner, D., Khalil, D., Burnell, F., Hart, D., Vuckovic, S. (2007) Blood monocytes, myeloid dendritic cells and the cytokines interleukin (IL)-7 and IL-15 maintain human CD4+ T memory cells with mixed helper/regulatory function Immunology 120,392-403[CrossRef][Medline]
  22. Fritsch, R. D., Shen, X., Sims, G. P., Hathcock, K. S., Hodes, R. J., Lipsky, P. E. (2005) Stepwise differentiation of CD4 memory T cells defined by expression of CCR7 and CD27 J. Immunol. 175,6489-6497[Abstract/Free Full Text]
  23. Liu, W., Putnam, A. L., Xu-Yu, Z., Szot, G. L., Lee, M. R., Zhu, S., Gottlieb, P. A., Kapranov, P., Gingeras, T. R., Fazekas de St Groth, B., et al (2006) CD127 expression inversely correlates with FoxP3 and suppressive function of human CD4+ T reg cells J. Exp. Med. 203,1701-1711[CrossRef][Medline]
  24. Seddiki, N., Santner-Nanan, B., Martinson, J., Zaunders, J., Sasson, S., Landay, A., Solomon, M., Selby, W., Alexander, S. I., Nanan, R., et al (2006) Expression of interleukin (IL)-2 and IL-7 receptors discriminates between human regulatory and activated T cells J. Exp. Med. 203,1693-1700[Abstract/Free Full Text]
  25. Suda, T., Hashimoto, H., Tanaka, M., Ochi, T., Nagata, S. (1997) Membrane Fas ligand kills human peripheral blood T lymphocytes, and soluble Fas ligand blocks the killing J. Exp. Med. 186,2045-2050[Abstract/Free Full Text]
  26. Wu, C. Y., Kirman, J. R., Rotte, M. J., Davey, D. F., Perfetto, S. P., Rhee, E. G., Freidag, B. L., Hill, B. J., Douek, D. C., Seder, R. A. (2002) Distinct lineages of T(H)1 cells have differential capacities for memory cell generation in vivo Nat. Immunol. 3,852-858[CrossRef][Medline]



This article has been cited by other articles:


Home page
 BloodHome page
X. Ju, M. Zenke, D. N. J. Hart, and G. J. Clark
CD300a/c regulate type I interferon and TNF-{alpha} secretion by human plasmacytoid dendritic cells stimulated with TLR7 and TLR9 ligands
Blood, August 15, 2008; 112(4): 1184 - 1194.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0107035v1
82/5/1126    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Clark, G. J.
Right arrow Articles by Hart, D. N. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Clark, G. J.
Right arrow Articles by Hart, D. N. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS