PeproTech Inc.
Originally published online as doi:10.1189/jlb.0407216 on July 3, 2007

Published online before print July 3, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0407216v1
82/4/934    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sow, F. B.
Right arrow Articles by Lafuse, W. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sow, F. B.
Right arrow Articles by Lafuse, W. P.
(Journal of Leukocyte Biology. 2007;82:934-945.)
© 2007 by Society for Leukocyte Biology

Expression and localization of hepcidin in macrophages: a role in host defense against tuberculosis

Fatoumata B. Sow*,{dagger}, William C. Florence*,{dagger}, Abhay R. Satoskar*,{dagger}, Larry S. Schlesinger{dagger},{ddagger},§, Bruce S. Zwilling*,{dagger} and William P. Lafuse{dagger},{ddagger},1

Departments of
* Microbiology,
{ddagger} Molecular Virology, Immunology and Medical Genetics, and
§ Internal Medicine, Division of Infectious Diseases, and
{dagger} Center for Microbial Interface Biology, The Ohio State University, Columbus, Ohio, USA

1 Correspondence: Department of Molecular Virology, Immunology and Medical Genetics, The Ohio State University, 333 W. 10th Ave., Columbus, OH 43210, USA. E-mail: lafuse.1{at}osu.edu


arrow
ABSTRACT
 
Hepcidin is an antimicrobial peptide produced by the liver in response to inflammatory stimuli and iron overload. Hepcidin regulates iron homeostasis by mediating the degradation of the iron export protein ferroportin 1, thereby inhibiting iron absorption from the small intestine and release of iron from macrophages. Here, we examined the expression of hepcidin in macrophages infected with the intracellular pathogens Mycobacterium avium and Mycobacterium tuberculosis. Stimulation of the mouse RAW264.7 macrophage cell line and mouse bone marrow-derived macrophages with mycobacteria and IFN-{gamma} synergistically induced high levels of hepcidin mRNA and protein. Similar results were obtained using the human THP-1 monocytic cell line. Stimulation of macrophages with the inflammatory cytokines IL-6 and IL-ß did not induce hepcidin mRNA expression. Iron loading inhibited hepcidin mRNA expression induced by IFN-{gamma} and M. avium, and iron chelation increased hepcidin mRNA expression. Intracellular protein levels and secretion of hepcidin were determined by a competitive chemiluminescence ELISA. Stimulation of RAW264.7 cells with IFN-{gamma} and M. tuberculosis induced intracellular expression and secretion of hepcidin. Furthermore, confocal microscopy analyses showed that hepcidin localized to the mycobacteria-containing phagosomes. As hepcidin has been shown to possess direct antimicrobial activity, we investigated its activity against M. tuberculosis. We found that hepcidin inhibited M. tuberculosis growth in vitro and caused structural damage to the mycobacteria. In summary, our data show for the first time that hepcidin localizes to the phagosome of infected, IFN-{gamma}-activated cells and has antimycobacterial activity.

Key Words: innate immunity • cytokines • antimicrobial peptides


arrow
INTRODUCTION
 
Mycobacteria are engulfed by macrophages through phagocytosis and reside within the phagosomes of these cells [1 , 2 ]. Antimycobacterial activity is mediated primarily by CD4+ and CD8+ T cells through the secretion of cytokines, which increase the antimicrobial activity of macrophages [3 , 4 ]. IFN-{gamma} is the major regulator of the immune response to mycobacteria [5 , 6 ]. Activation of macrophages by IFN-{gamma} in mice induces the expression of NO synthase 2 (NOS2), resulting in the production of NO, which leads to killing of the intracellular mycobacteria [7 ]. IFN-{gamma} also promotes the fusion of the mycobacteria-containing phagosome with late endosomal vesicles and lysosomal vesicles [8 , 9 ], resulting in the delivery of lysosomal enzymes to the phagosome and the acidification of the phagosome.

Iron is essential for the growth and survival of mycobacteria, but it is also involved in host macrophage defense by catalyzing the production of toxic hydroxyl radicals via the Haber-Weiss/Fenton reactions [10 , 11 ]. During infection, a competition for iron occurs between the host macrophage and the pathogen. The macrophage attempts to suppress pathogen proliferation by complex, iron-withholding mechanisms. Activation of macrophages by IFN-{gamma} results in a decrease in macrophage iron content, ferritin levels, and expression of the transferrin receptor [12 13 14 15 ]. In response, Mycobacterium tuberculosis, present in activated macrophages, increases the expression of the iron-binding siderophores, mycobactin and carboxymycobactin, which are involved in binding and transporting iron [16 17 18 19 ].

The effectors of innate immunity also include antimicrobial peptides [20 ], which are found in prokaryotes, plants, and animals and have broad activities against bacteria and fungi. Hepcidin, originally identified as a 25-amino acid antimicrobial peptide present in serum and urine [21 , 22 ], is produced from a propeptide precursor by liver hepatocytes during the acute-phase response. Recent studies have shown that hepcidin also acts as a negative regulator of iron absorption by the duodenum [23 , 24 ] and inhibits release of recycled iron by macrophages [25 ]. Studies by Nemeth et al. [26 ] have shown that hepcidin binds to ferroportin 1, which is the sole iron export protein in mammalian cells, and mediates its internalization and degradation, resulting in a decrease in iron release. Thus, knockout of hepcidin gene expression in mice resulted in iron overload resembling hemochromatosis [27 ], and overexpression of hepcidin in transgenic mice resulted in severe iron deficiency anemia and death at birth [28 ].

Expression of hepcidin mRNA is induced in human hepatocytes by IL-6 and LPS [29 , 30 ] and in mouse hepatocytes, by IL-1 and IL-6 [31 ]. In vivo, liver hepcidin mRNA is up-regulated following injection of mice with LPS, turpentine, and CFA [32 33 34 ]. Liver hepcidin mRNA expression is also increased by iron overload [34 ] and decreased by anemia induced by bleeding or hemolysis [33 ]. A recent study [35 ] reported that infection of mouse bone marrow-derived macrophages (BMDM) with the extracellular pathogens Pseudomonas aeruginosa and group A Streptococcus induced hepcidin mRNA expression in macrophages. However, no similar studies have been done with intracellular pathogens of macrophages. The previous study also did not determine if macrophage activation by IFN-{gamma} regulates hepcidin expression or the localization of hepcidin within the macrophage. We investigated the expression of hepcidin mRNA and protein in Mycobacterium avium- and M. tuberculosis-infected macrophages. We demonstrate that mycobacteria infection and IFN-{gamma} stimulation synergistically induce high levels of hepcidin mRNA and protein in the macrophage. We also show that hepcidin is present in the M. tuberculosis-containing phagosomes and that at least in vitro, hepcidin can inhibit M. tuberculosis growth. Thus, these studies indicate that hepcidin production by infected macrophages is an IFN-{gamma}-induced host defense mechanism against infection with mycobacteria.


arrow
MATERIALS AND METHODS
 
Mycobacteria
M. avium strain Mac101 [American Type Culture Collection (ATCC) 70998] and M. tuberculosis H37Rv strain (ATCC 27294) were obtained from ATCC (Manassas, VA, USA). M. avium was cultured in Middlebrook 7H9 media supplemented with oleic acid-albumin-dextrose-catalase (OADC; Difco, Detroit, MI, USA) and stored in 1 ml aliquots in 10% glycerol at –70°C until used. Lyophilized M. tuberculosis H37Rv was reconstituted in pyogen-free water (Sigma Chemical Co., St. Louis, MO, USA), plated on 7H11 agar plates, and incubated at 37°C in 5% CO2 for 14 days, and bacterial suspensions were generated as described [36 ]. {gamma}-Irradiated M. tuberculosis (Colorado State University, Fort Collins, CO, USA; National Institutes of Health Contract NIAID-N01-AI-40091) was resuspended in PBS, briefly sonicated, and centrifuged at 800 rpm for 10 min to eliminate clumped bacteria. The protein concentration in the supernatant was determined by the Bradford protein assay (Bio-Rad, Hercules, CA, USA).

Cell cultures
The RAW264.7 mouse macrophage cell line (TIB-71) was plated at 5 x 106 cells per well in six-well culture plates containing DMEM supplemented with 10% FBS (Atlanta Biologicals, Lawrenceville, GA, USA) and penicillin-streptomycin. The macrophages were allowed to adhere for 4 h at 37°C in 5% CO2 in air. The nonadherent cells were washed away with DMEM without antibiotics, and the macrophage monolayers were infected with M. avium strain Mac101 or with live M. tuberculosis H37RV at a ratio of 10:1, bacterium:macrophage. Macrophage monolayers were also stimulated with 200 U/ml mouse IFN-{gamma} (Roche, Indianapolis, IN, USA), with and without mycobacteria infection. RAW264.7 cells were also stimulated with IFN-{gamma} in combination with 100 µg/ml {gamma}-irradiated M. tuberculosis H37Rv. In other experiments, RAW264.7 cells were also stimulated with the proinflammatory cytokines IL-6, IL-1ß, and TNF-{alpha} at 10 ng/ml (Alpha Diagnostic, San Antonio, TX, USA) in combination with M. avium infection. For iron-loading experiments, RAW264.7 cells were pretreated for 1 h with Fe-nitrilotriacetate (FeNTA; molar ratio 1:4), prepared from FeCl3 and sodium NTA (Sigma Chemical Co.) before stimulation with IFN-{gamma} and {gamma}-irradiated M. tuberculosis. For iron chelation experiments, the RAW264.7 cells were pretreated with the iron chelator desferrioxamine (Sigma Chemical Co.) for 1 h prior to stimulation.

A RAW264.7 cell line, constitutively expressing Flag-tagged hepcidin under control of the CMV promoter, was created by cloning full-length hepcidin cDNA into the pCMV-3Tag 8 expression vector (Stratagene, La Jolla, CA, USA). The sequence of the hepcidin cDNA was confirmed by DNA sequencing. RAW264.7 cells were transfected with the plasmid using Lipofectamine (Invitrogen, Carlsbad, CA, USA). Stable clones were obtained by hygromycin selection and limiting dilution cloning. High expressing clones were identified by confocal microscopy as described below using the M2 anti-Flag mAb (Sigma Chemical Co.) and Alexa 488-coupled F(ab')2 goat anti-mouse IgG antibody (Invitrogen) as the secondary antibody.

The human THP-1 monocytic cell line (ATCC TIB-202) was plated at 5 x 106 cells per well in six-well culture plates containing RPMI 1640, supplemented with 10% heat-inactivated FBS and penicillin-streptomycin at 37°C in 5% CO2 for 2 h. The cells were then infected with live M. tuberculosis H37Rv at a ratio of 20:1, bacterium:macrophage, and stimulated with 200 units/ml human IFN-{gamma} (Roche).

BMDM
Cells were isolated from the marrow of femurs and tibias of C57/BL6J mice. The cells were plated in complete DMEM, supplemented with 10 ng/ml GM-CSF (Peprotech, Rocky Hill, NJ, USA). After 3 and 5 days of culture, 50% and 75% of the medium was removed and replaced with fresh medium, supplemented with GM-CSF, respectively. Mature, adherent BMDM were harvested after 7 days of culture and subjected to stimulation with M. avium, IFN-{gamma}, or a combination of IFN-{gamma} and M. avium for 24 h.

RNA isolation
RAW264.7 macrophages were lysed using Qiagen lysis buffer and 2-ME and homogenized by passing the cell lysates through QiaShredders (Qiagen, Valencia, CA, USA). The RNA was then isolated using the RNeasy mini kit. RNA was isolated from THP-1 and BMDM using the High Pure RNA isolation kit (Roche). Residual DNA was removed during RNA purification by on-column DNase digestion in both procedures.

Quantitative RT-PCR
Total RNA (1 µg) was reverse-transcribed using 100 µM dNTPs, 15 units avian myloblastosis virus reverse transcriptase, and 0.5 µg oligo(dT)15 primer in RT buffer for 1 h at 42°C (Promega, Madison, WI, USA). The expression of mouse hepcidin 1 and GAPDH mRNA was analyzed by real-time RT-PCR in the Roto-gene 2000 real-time cycler (Phenix Research Products, Candler, NC, USA) using FastStart DNA SYBR Green I reaction mix (Roche). The primer sequences are mouse GAPDH: GTGTGAACGGATTTGGCCGTATTGGGCG (sense) and TCGCTCCTGGAAGATGGTGATGGGC (antisense); mouse ß-actin: TACAGCTTCACCACCACAGC (sense) and AAGGAAGGCTGGAAAAGAGC (antisense); mouse hepcidin 1: GCAGAAGAGAAGGAAGAGAGACACC (sense) and TGTAGAGAGGTCAGGATGTGGCTC (antisense); human GAPDH: GAAGGTGAAGGTCGGAGTC (sense) and GAAGATGGTGATGGGATTTC (antisense); human hepcidin: GCACTGAGCTCCCAGATCTG (sense) and CTACGTCTTGCAGCACATCC (antisense). The primers were designed using MacVector primer software (Accelrys, San Diego, CA, USA). Specificity of primers was confirmed by GenBank Blast searches. Mice express two duplicated hepcidin genes, hepc1 and hepc2 [34 ]. hepc2 has only 58% identity with hepc1 and does not appear to be involved in regulating iron metabolism. Primers were designed to amplify hepcidin 1 cDNA and not hepcidin 2 cDNA. The amplification conditions were 95°C for 10 min followed by 40 cycles of 95°C for 15 s, 60°C for 5 s, and 72°C for 20 s. The relative expression of each sample was calculated using mouse GAPDH as a reference and the {Delta}Ct method as described previously [37 ]. GAPDH mRNA levels were used as the reference mRNA in all experiments, except for experiments in which RAW264.7 cells were loaded with iron and treated with the iron chelator desferrioxamine. ß-Actin was used as the reference mRNA in these experiments. Preliminary experiments showed that GAPDH mRNA levels increased when macrophages were treated with desferrioxamine. ß-Actin mRNA levels were not changed by iron-loading or iron chelation.

Hepcidin-competitive chemiluminescence ELISA
RAW264.7 cells in six-well culture plates were stimulated for 24 h with IFN-{gamma} (200 units/ml), 100 µg/ml {gamma}-irradiated M. tuberculosis, and the combination of IFN-{gamma} and {gamma}-irradiated M. tuberculosis in serum-free DMEM. Hepcidin secreted into the culture media and intracellular hepcidin were measured by a competitive chemiluminescence ELISA with biotinylated mouse hepcidin (Alpha Diagnostic). To measure cellular hepcidin expression, the RAW264.7 cells were harvested by scraping and then pelleted by centrifugation. The cells were lysed on ice for 10 min with 1% Triton X-100 in PBS with protease inhibitor cocktail tablets (Roche), and the cell debris was removed by centrifugation for 10 min at 14,000 rpm. Protein concentration of the lysate was determined using the Bradford method (Bio-Rad). The ELISA was performed by coating white ELISA plates overnight at 4°C with 100 µl per well 1 µg/ml affinity-purified rabbit anti-mouse hepcidin IgG (Alpha Diagnostic) in coating buffer (Alpha Diagnostic). The plates were washed three times with washing buffer (PBS, 0.050% Tween-20) and incubated with blocking solution, I-Block (Applied Biosystems, Foster City, CA, USA), in PBS, 0.050% Tween-20, for 1 h at room temperature. Blocking solution was removed, and 50 µl per well samples and standards (0–10 pg/ml hepcidin) diluted in blocking buffer was added to the plate. After 1 h incubation at room temperature, 50 µl 5 ng/ml biotinylated mouse hepcidin (Alpha Diagnostic) in blocking buffer was added to each well, and the plate was incubated for an additional hour at room temperature. The plate was washed three times with washing buffer. To detect the bound, biotinylated hepcidin, 100 µl avidin/biotin-AP solution (ABC Reagent, Vector Laboratories, Burlingame, CA, USA) was added to each well and plate, incubated for 1 h at room temperature. The plate was washed four times in washing buffer and once in 1x assay buffer. The substrate (CDP-Star with Sapphire II enhancer, Applied Biosytems), 50 µl/well, was added to the plate and incubated for 10 min at room temperature. The plate was then read using a microplate luminometer (Packard, Meriden, CT, USA). The concentration of hepcidin in the samples was determined by regression analysis of the standard curve.

Confocal microscopy
RAW264.7 cells were plated on coverslips in 24-well plates at 5.0 x 105 cells/well and stimulated with IFN-{gamma} and M. tuberculosis at 2:1, bacteria:macrophage. The cells were fixed in 4% paraformaldehyde in PBS for 20 min, washed twice with PBS, and then permeabilized with 0.1% Triton X-100 in PBS for 10 min and washed twice with PBS. Monolayers were incubated in blocking solution (1% BSA, 10% heat-inactivated goat serum, in PBS) for 3 h at room temperature. To detect hepcidin, affinity-purified rabbit anti-mouse hepcidin (20–25 hepc; Alpha Diagnostic), raised against the C terminus of the mature, 25 amino acid hepcidin, was used. Residual M. tuberculosis-reactive antibodies were removed by two rounds of absorption with {gamma}-irradiated M. tuberculosis for 1 h at 4°C prior to use. Antibodies were added at 1:200 in blocking solution for 3 h at room temperature, followed by extensive washing with 0.5% BSA in PBS and detection with Alexa 488-coupled F(ab')2 goat anti-rabbit IgG antibody (Invitrogen). To detect mycobacteria in infected RAW264.7 cells, coverslips were stained with auramine-rhodamine (Difco), counterstained with 5% potassium permanganate as described by Ferguson et al. [38 ], and followed by detection of hepcidin by immunofluorescence as described above. The exclusion of primary antibody was used as a negative control. A second negative control consisted of the hepcidin antibody preabsorbed with the mature, 25-amino acid peptide. Coverslips were removed from 24-well plates and mounted on slides with Prolong mounting medium (Invitrogen). Fluorescence was visualized by cross-sectional confocal microscopy using a Zeiss LSM 510 confocal microcscope. The percentage of phagosomes positive for hepcidin was determined by counting 25–50 phagosomes. Intensity of the green immunofluorescence was measured from images using Sigma ScanPro image analysis software (SPSS Science, Chicago, IL, USA).

To determine the localization of hepcidin to the phagosome in RAW264.7 cells constitutively expressing hepcidin, the RAW-264.7-hepcidin-Flag cell line was plated onto coverslips and infected with live M. tuberculosis for 2 h. The coverslips were then processed for confocal microscopy as described above. M. tuberculosis was detected by auramine-rhodamine staining and Flag-tagged hepcidin with the M2 anti-Flag mAb (1:500; Sigma Chemical Co.) and Alexa 488-coupled F(ab')2 goat anti-mouse IgG antibody (Invitrogen) as the secondary antibody.

Antimicrobial assay for hepcidin
The 25-amino acid form of hepcidin (Alpha Diagnostics) was tested for antimicrobial activity against M. tuberculosis by incubating various concentrations of this peptide (20, 50, 100, and 200 µg/ml) with 1 x 104 M. tuberculosis H37Rv at 37°C in 100 µl 7H9 broth. At 6 and 72 h, viable bacteria were assessed by culturing serial dilutions onto Middle-brook 7H11 agar plates (Becton Dickinson, San Jose, CA, USA), supplemented with OADC (Becton Dickinson). Colonies were counted after 21 days at 37°C.

Transmission electron microscopy (TEM)
M. tuberculosis H37Rv bacteria were plated at 1 x 108 in 100 µl 7H9 broth, with or without hepcidin (200 µg/ml), in 24-well culture plates. After 24 h, the cell suspensions were centrifuged at 10,000 g for 15 min, washed with PBS, and resuspended in fixative (3% glutaraldehyde and 4% paraformaldehyde in 0.1 M cacodylate buffer at pH 7.2) overnight at 4°C. The next day, the cells were washed three times in sodium cacodylate buffer, postfixed in 1% osmium tetroxide, and en bloc-stained in 1% uranyl acetate for 90 min. The cells were then dehydrated in gradient ethanol (45 min at 50%, 45 min at 70%, 50 min at 80%, 1 h at 95%, and 90 min with three changes at 100%), followed by treatment with propylene oxide and covering with polybed and propylene oxide (2:1) overnight. The samples were then embedded in polybed resin for 20 h at 60°C, followed by thin sectioning at 70 nm using a Leica EM UC6 ultramicrotome and staining in 2% uranyl acetate and Reynold's lead citrate. The samples were then observed and photographed in a FEI Technai Spirit TEM at 80 kV.

Statistics
Results were analyzed by one-way ANOVA with Tukey's test and t-test using SigmaSTAT (SPSS Science).


arrow
RESULTS
 
Induction of macrophage hepcidin mRNA expression by mycobacteria and IFN-{gamma}
We examined the mRNA expression of hepcidin in macrophages infected with M. avium and M. tuberculosis. Figure 1 shows that IFN-{gamma} and M. avium strain Mac101 synergistically induced production of hepcidin mRNA in RAW264.7 macrophages (Fig. 1A) . The increase in hepcidin mRNA expression was apparent at 12 h after stimulation with IFN-{gamma} and M. avium. A 100-fold increase in hepcidin mRNA was observed at 24 h. Infection with M. avium alone induced low levels of hepcidin mRNA (threefold increase at 24 h), and treatment with IFN-{gamma} alone did not induce any significant changes in the expression of hepcidin mRNA. The synergistic effect observed was dependent on the IFN-{gamma} concentration and the M. avium dose used. Maximal effect was reached at a dose of 200 units/ml (Fig. 1B) and a M. avium ratio of 20:1 (Fig. 1C) . Heat-killed M. avium was as effective as live bacteria in inducing hepcidin mRNA expression, and phagocytosis of latex beads had no effect (data not shown).


Figure 1
View larger version (16K):
[in this window]
[in a new window]

 
Figure 1. IFN-{gamma} and M. avium synergistically induce hepcidin mRNA expression. (A) Time-course experiment in which RAW264.7 macrophages were stimulated with IFN-{gamma} (200 U/ml), M. avium infection (10:1 ratio), and IFN-{gamma} + M. avium. (B) IFN-{gamma} dose-response experiment. RAW264.7 macrophages were stimulated with M. avium (10:1) and the indicated doses of IFN-{gamma} for 24 h. (C) M. avium dose experiment. RAW264.7 macrophages were stimulated with IFN-{gamma} and M. avium for 24 h. (D) BMDM were isolated from C57BL/6J mice as described in Materials and Methods and stimulated with IFN-{gamma} (200 U/ml), M. avium infection (30:1 ratio), and IFN-{gamma} + M. avium (M.a). Total RNA was extracted, and hepcidin mRNA was detected by real-time RT-PCR. The hepcidin mRNA expression levels were normalized to GAPDH mRNA levels and expressed as fold induction relative to untreated RAW264.7 cells. The data represent the mean ± SD of three separate experiments.

The results in Figure 1D show that IFN-{gamma} and M. avium also synergistically produced hepcidin mRNA in mouse BMDM. The combination of IFN-{gamma} and M. avium induced a 40-fold increase in hepcidin mRNA.

Live M. tuberculosis H37Rv and IFN-{gamma} also synergistically induced hepcidin mRNA expression in RAW264.7 macrophages (Fig. 2 A and 2B ). The results in Figure 2A show the level of hepcidin mRNA expression after 24 h, and those in Figure 2B show the effect of increasing doses of M. tuberculosis. Overall, M. tuberculosis induced high levels of hepcidin mRNA expression. M. tuberculosis alone induced a hepcidin mRNA level, which was 25–50 times higher than control cells. The combination of IFN-{gamma} and M. tuberculosis increased the levels to 250–500 times greater than control cells. Synergy was also observed in RAW264.7 cells stimulated with IFN-{gamma} and {gamma}-irradiated M. tuberculosis (Fig. 2C and 2D) . We also observed similar synergy in the induction of hepcidin by {gamma}-irradiated M. tuberculosis and IFN-{gamma} using the mouse macrophage cell line J774A.1 and mouse BMDM (not shown). To determine if M. tuberculosis and IFN-{gamma} induce hepcidin mRNA in human cells, we examined the expression of hepcidin mRNA in the human monocytic cell line THP1. As shown in Figure 2E , live M. tuberculosis and IFN-{gamma} induced hepcidin mRNA in THP1 cells.


Figure 2
View larger version (14K):
[in this window]
[in a new window]

 
Figure 2. IFN-{gamma} and M. tuberculosis synergistically induce hepcidin mRNA expression. (A) RAW264.7 macrophages were infected with M. tuberculosis (M.tb; 10:1) and stimulated with IFN-{gamma} (200 U/ml) for 24 h. (B) M. tuberculosis dose response. RAW264.7 macrophages were infected with M. tuberculosis and stimulated with IFN-{gamma} for 24 h. (C) Time-course experiment using {gamma}-irradiated M. tuberculosis. RAW264.7 macrophages were stimulated with {gamma}-irradiated (irra.) M. tuberculosis (100 µg protein/ml) and IFN-{gamma} (200 U/ml). (D) Dose response using {gamma}-irradiated M. tuberculosis at the indicated protein concentrations. RAW264.7 macrophages were stimulated with {gamma}-irradiated M. tuberculosis and IFN-{gamma} for 24 h. (E) Induction of hepcidin mRNA in human THP1 cells, which were infected with M. tuberculosis (20:1) and 200 units/ml human IFN-{gamma} for 24 h. (A–D) Total RNA was extracted, and hepcidin mRNA was detected by real-time RT-PCR using primers specific for mouse hepcidin and GAPDH. Mean ± SD of three separate experiments. (E) Primers specific for human hepcidin and GAPDH were used. The hepcidin mRNA expression levels were normalized to GAPDH mRNA levels and expressed as fold induction relative to untreated cells.

Hepcidin mRNA in macrophages is not induced by proinflammatory cytokines or iron overload
As hepcidin mRNA expression is induced in human hepatocytes by IL-6 and LPS [29 , 30 ] and in mouse hepatocytes by IL-1 and IL-6 [31 ], we determined if these proinflammatory cytokines induce hepcidin mRNA in mouse macrophages. The results in Figure 3 show that IL-1ß and IL-6 do not induce hepcidin mRNA in RAW264.7 macrophages. Hepcidin mRNA was also not induced by TNF-{alpha}. IL-1ß and IL-6 did significantly increase hepcidin mRNA induced by M. avium. However, the effect of these cytokines on hepcidin mRNA in M. avium-infected macrophages was much less than observed with IFN-{gamma} (Fig. 1) .


Figure 3
View larger version (13K):
[in this window]
[in a new window]

 
Figure 3. Induction of hepcidin in macrophages by cytokines. RAW264.7 macrophages were stimulated with 10 ng/ml IL-1ß, IL-6, TNF-{alpha}, and M. avium infection (10:1 ratio) and a combination of cytokines and M. avium for 24 h. Total RNA was extracted, and hepcidin mRNA was detected by real-time RT-PCR. The hepcidin mRNA expression levels were normalized to GAPDH mRNA levels and expressed as fold-induction relative to untreated RAW264.7 cells. The data represent the mean ± SD of three separate experiments. *, IL-1ß and IL-6 significantly increased hepcidin mRNA levels induced by M. avium; P < 0.05 by ANOVA when compared with M. avium.

We observed that the addition of iron in RAW264.7 macrophages inhibited the induction of hepcidin mRNA by M. tuberculosis + IFN-{gamma}, and iron chelation increased hepcidin mRNA expression (Fig. 4 ). These effects of iron and iron chelation occurred only in M. tuberculosis + IFN-{gamma}-treated RAW264.7 cells. Addition of iron alone or the iron chelator desferrioxamine alone to RAW264.7 cells had no effect on hepcidin mRNA expression (not shown).


Figure 4
View larger version (13K):
[in this window]
[in a new window]

 
Figure 4. Addition of iron to IFN-{gamma} + M. tuberculosis-stimulated macrophages inhibits hepcidin mRNA expression, and iron chelation increases expression. RAW264.7 macrophages were incubated with FeNTA and the iron chelator desferrioxamine for 1 h prior to stimulation with IFN-{gamma} (200 U/ml) and {gamma}-irradiated M. tuberculosis (100 µg/ml) for 24 h. Total RNA was extracted, and hepcidin mRNA was detected by real-time RT-PCR. The hepcidin mRNA expression levels were normalized to ß-actin mRNA levels and expressed as fold induction relative to untreated RAW264.7 cells. The data represent the mean ± SD of three separate experiments. Addition of iron decreased hepcidin mRNA expression significantly; P < 0.001 by ANOVA. Iron chelation increased hepcidin mRNA expression significantly; P < 0.001 by ANOVA.

Detection of hepcidin protein in activated macrophages by a competitive ELISA
We determined if IFN-{gamma} and mycobacteria induced the appearance of hepcidin protein in macrophages using a competitive chemiluminescence ELISA. The antibody used to detect hepcidin is an affinity-purified rabbit anti-mouse hepcidin produced by immunization with a 13-amino acid peptide located in the C terminus of the mature, 25-amino acid form of mouse hepcidin. In the competitive ELISA, the antibody was coated onto the wells of a 96-well plate, and hepcidin levels were determined by competition of standards and samples with biotinylated hepcidin; hepcidin protein expression was increased in cell lysates of RAW264.7 cells stimulated with {gamma}-irradiated M. tuberculosis (Fig. 5A ). The highest level of hepcidin protein expression (>160 pg hepcidin/mg protein) was observed in RAW264.7 cells stimulated with {gamma}-irradiated M. tuberculosis and IFN-{gamma}. Stimulation with {gamma}-irradiated M. tuberculosis and IFN-{gamma} also resulted in the secretion of up to 50 pg/ml hepcidin by the macrophage (Fig. 5B) .


Figure 5
View larger version (15K):
[in this window]
[in a new window]

 
Figure 5. Effect of M. tuberculosis and IFN-{gamma} on hepcidin protein expression by RAW264.7 cells, which in serum-free media, were stimulated for 24 h with IFN-{gamma} (200 units/ml) and {gamma}-irradiated M. tuberculosis (100 µg/ml). Hepcidin was detected in cell lysates (A) and culture media (B) by a competitive chemiluminescent ELISA. Results are the mean ± SD of two experiments. Hepcidin levels in cell lysates were increased significantly in RAW264.7 cells stimulated with M. tuberculosis (*, P<0.001, t-test) and the combination of M. tuberculosis and IFN-{gamma} (*, P<0.001, t-test) compared with control cells. Hepcidin, secreted into the culture media, was increased significantly by treatment with M. tuberculosis and IFN-{gamma} (*, P<0.05, t-test) compared with control cells.

Hepcidin is present in mycobacteria-containing phagosomes
The expression of hepcidin was examined in RAW264.7 cells infected with M. tuberculosis by cross-sectional, confocal microscopy (Fig. 6 ). As CFA was used in the production of the antihepcidin rabbit antibody (Alpha Diagnostic, personal communication), the antibody was absorbed with {gamma}-irradiated M. tuberculosis to remove any M. tuberculosis-reactive antibodies, which may have remained after affinity purification. The absorbed antibody was negative against M. tuberculosis by Western blot analysis with M. tuberculosis SDS lysates and negative by immunofluorescence of M. tuberculosis adhered to coverslips (data not shown). Hepcidin was not detected in untreated cells (Fig. 6A) or in cells treated with IFN-{gamma} alone (Fig. 6B) . Figure 6C shows the results when macrophages were stimulated with live M. tuberculosis alone. In Figure 6D , the macrophages were stimulated with M. tuberculosis and IFN-{gamma}. M. tuberculosis was detected by staining the coverslips with auramine-rhodamine [38 ] prior to detection of hepcidin by immunofluorescence. Hepcidin was highly localized to the phagosome. In the RAW264.7 cells stimulated with M. tuberculosis and IFN-{gamma}, punctate staining was also observed outside of the phagosome (Fig. 6D) . The intensity of green immunofluorescence in the phagosome was significantly higher in cells stimulated with M. tuberculosis and IFN-{gamma} (Fig. 6D) compared with cells stimulated with M. tuberculosis alone (Fig. 6C) . The fluorescence intensity of phagosomes in macrophages stimulated with M. tuberculosis + IFN-{gamma} was 3.47 ± 0.33 x 104 green fluorescence intensity units/phagosome compared with 1.44 ± 0.12 x 104 green fluorescence intensity units/phagosome for phagosomes in macrophages infected with M. tuberculosis alone (P<0.001). Pretreatment of the hepcidin antibody with the 25-amino acid hepcidin peptide blocked the fluorescence detection of hepcidin (Fig. 6E) . There was also no green fluorescence detected in control experiments in which RAW264.7 cells treated with M. tuberculosis + IFN-{gamma} were incubated with the secondary antibody only (not shown).


Figure 6
View larger version (47K):
[in this window]
[in a new window]

 
Figure 6. Localization of hepcidin to the M. tuberculosis phagosome. RAW264.7 cells were infected with M. tuberculosis and stimulated with 200 units/ml IFN-{gamma} for 24 h. Representative confocal microscopy images of control, untreated RAW264.7 cells (A), RAW264.7 cells stimulated with IFN-{gamma} alone (B), RAW264.7 cells infected with M. tuberculosis alone (C), and RAW264.7 cells infected with M. tuberculosis and stimulated with IFN-{gamma} (D). Hepcidin was detected in permeablized cells with rabbit anti-mouse hepcidin antibody. M. tuberculosis was detected by staining with auramine-rhodamine prior to immunofluorescence detection. The secondary antibody was Alexa 488-conjugated F(ab')2 goat anti-rabbit IgG. (E) Control experiment in which the rabbit anti-mouse hepcidin was absorbed with the mature, 25-amino acid hepcidin peptide prior to fluorescence microscopy. Results are representative of three experiments.

Localization of hepcidin to M. tuberculosis phagosomes was also examined in time-course experiments. RAW264.7 were infected with M. tuberculosis and IFN-{gamma} for 0, 4, 8, 16, and 24 h, and hepcidin expression was examined by confocal microscopy (Fig. 7A ). Hepcidin begins to localize to the phagosome by 4 h (Fig. 7B) . Approximately 80% of the phagosomes were positive for hepcidin by 8 h after infection. Hepcidin expression was quantified by measuring the green immunofluorescence intensity of hepcidin-positive phagosomes (Fig. 7C) . The intensity increased with infection. Peak levels were obtained at 16 and 24 h, consistent with the increase in hepcidin mRNA levels at these time-points.


Figure 7
View larger version (36K):
[in this window]
[in a new window]

 
Figure 7. Time course of the localization of hepcidin to the M. tuberculosis phagosome. RAW264.7 cells were infected with M. tuberculosis and stimulated with 200 units/ml IFN-{gamma} for 0, 4, 8, 16, and 24 h. (A) Representative confocal images. Hepcidin was detected with rabbit anti-mouse hepcidin antibody and Alexa 488-conjugated F(ab')2 goat anti-rabbit IgG secondary antibody. M. tuberculosis was detected by staining with auramine-rhodamine prior to immunofluorescence detection. (B) Quantitative analysis of the percentage of M. tuberculosis phagosomes containing hepcidin. Results are the pooled data from two independent experiments. (C) Quantitative analysis of the green fluorescence intensity of hepcidin localized to the M. tuberculosis phagosome. The increase in fluorescence intensity with time was statistically significant by one-way ANOVA; P < 0.01.

To establish further that hepcidin localizes to the phagosome following infection with M. tuberculosis, hepcidin epitope tagged with Flag at the C terminus was stably expressed in RAW264.7 cells. Expression of the hepcidin in the transfected cells was examined by confocal microscopy using mouse anti-Flag mAb. The cells constitutively express high levels of hepcidin-Flag in intracellular vesicles (Fig. 8A ). After infection with M. tuberculosis, the hepcidin-Flag localized to the phagosome (Fig. 8B) . Thus, our studies indicate that hepcidin redistributes to the phagosome during infection.


Figure 8
View larger version (41K):
[in this window]
[in a new window]

 
Figure 8. Hepcidin localizes to the M. tuberculosis phagosome in RAW264.7 cells, constitutively expressing high levels of Flag epitope-tagged hepcidin. RAW-hepcidin-Flag cells were infected with live M. tuberculosis for 2 h. Hepcidin-Flag was detected with anti-Flag mAb and Alexa 488-conjugated F(ab')2 goat anti-mouse IgG secondary antibody. M. tuberculosis was detected by staining with auramine-rhodamine prior to immunofluorescence detection. (A) Representative confocal images of hepcidin-Flag expression in unstimulated cells. (B) Representative images of hepcidin-Flag in M. tuberculosis-infected cells. Results are representative of two experiments.

Hepcidin has direct, antibacterial activity against M. tuberculosis
As hepcidin has antibacterial activity against a number of microorganisms [21 , 22 ], we determined if hepcidin has antibacterial against M. tuberculosis in vitro. The 25-amino acid hepcidin peptide was incubated with M. tuberculosis in 7H9 broth. At 6 and 72 h, the effect of hepcidin on M. tuberculosis viability was determined by CFU. As shown in Table 1 , treatment of M. tuberculosis with hepcidin for 6 h reduced CFUs, and CFUs of M. tuberculosis were reduced by 50% compared with control, untreated M. tuberculosis at the highest concentration of hepcidin used. The effect of hepcidin on M. tuberculosis was also observed after 72 h. M. tuberculosis CFUs at 72 h of the hepcidin treatment were comparable with CFUs at 6 h. In contrast, CFUs of the control cultures of M. tuberculosis at 72 h increased by 30% compared with the number of CFUs at 6 h. To determine if hepcidin also damaged the mycobacteria structurally, we examined M. tuberculosis by TEM. We examined 481 control M. tuberculosis bacteria incubated in media only and 416 M. tuberculosis bacteria incubated with hepcidin for 24 h. In the hepcidin-treated M. tuberculosis, 39% of the mycobacteria visualized had lost their normal architecture (disruption of membrane and loss of cytosol) compared with only 7.9% in the control. Representative TEM photographs are shown in Figure 9 .


View this table:
[in this window]
[in a new window]

 
Table 1. Hepcidin Antimicrobial Assaya


Figure 9
View larger version (75K):
[in this window]
[in a new window]

 
Figure 9. Hepcidin causes lysis of M. tuberculosis, which was incubated for 24 h in 7H9 broth (Control M. tuberculosis) or 7H9 broth with 200 µg/ml hepcidin (Hepcidin treated M. tuberculosis). (A) Representative TEM photograph of intact M. tuberculosis from the control culture. (B) Representative TEM photograph of M. tuberculosis from the hepcidin-treated culture. Present in B are intact M. tuberculosis and M. tuberculosis, which have lost normal architecture as a result of disruption of membrane and loss of cytosol.


arrow
DISCUSSION
 
Hepcidin acts as a hormone to maintain iron homeostasis by inhibiting intestinal iron absorption [22 , 33 ] and the macrophage release of iron [25 , 39 ]. Hepcidin is produced rapidly by the liver in mice in response to inflammatory stimuli, LPS, Freund adjuvant, and turpentine [29 , 32 , 33 , 40 ]. Hepcidin is also produced by the liver following in vivo iron loading, and anemia and hypoxia lead to a decrease in production [30 , 33 ]. Bacterial induction of hepcidin expression in mouse macrophages and neutrophils following infection with P. aeruginosa and group A Streptococcus has been reported recently by Peyssonnaux et al. [35 ]. Other studies showed that LPS induced hepcidin mRNA in mouse macrophages [41 , 42 ]. However, these studies focused on extracellular pathogens of macrophages and LPS and did not examine effects of IFN-{gamma} on hepcidin production induced by bacterial infection. Here, we report that hepcidin is also produced in mouse macrophages infected with intracellular mycobacteria. Furthermore, we found that high levels of hepcidin mRNA and protein are induced in the RAW264.7 mouse macrophage cell line and BMDM infected with M. avium or M. tuberculosis and stimulated with IFN-{gamma}. Mycobacteria and IFN-{gamma} acted synergistically to induce hepcidin mRNA expression. We also observed that M. tuberculosis and IFN-{gamma} synergistically induced hepcidin mRNA expression in the human monocytic THP1 cell line, indicating that hepcidin mRNA can also be induced in human cells. Heat-killed M. avium and {gamma}-irradiated M. tuberculosis were as effective as live mycobacteria in inducing expression. However, phagocytosis of latex beads in combination with IFN-{gamma} did not induce expression of hepcidin mRNA. Thus, our data suggest that a component(s) of mycobacteria, rather than just phagocytosis itself, induces hepcidin mRNA.

Hepcidin production in mouse hepatocytes is induced by IL-1ß and IL-6 [31 ]. However, we found that IL-1ß and IL-6 had no effect on hepcidin mRNA expression in RAW264.7 macrophages. We did observe an increase in hepcidin mRNA when IL-1ß or IL-6 was added to RAW264.7 cells with M. avium infection. However, the effect of IL-1ß and IL-6 was much less than that observed with IFN-{gamma}. Conditioned media from macrophages stimulated with LPS have been shown to induce hepcidin expression in hepatocytes [29 , 30 ]. However, we have found that conditioned media from RAW264.7 macrophages treated with M. avium and IFN-{gamma} did not induce hepcidin mRNA in fresh RAW264.7 cells (data not shown). This suggests that cytokines released from the activated macrophages are not responsible for induction of hepcidin mRNA expression in mouse macrophages. These results also suggest that expression of hepcidin mRNA is differentially regulated in macrophages and hepatocytes.

Expression of hepcidin mRNA is also differentially regulated following iron loading. Previous studies have shown that liver hepcidin mRNA is increased by iron loading [34 ]. However, we have found that iron has an opposite effect on macrophage hepcidin mRNA expression. Incubation of RAW264.7 cells with iron decreased hepcidin mRNA expression induced by IFN-{gamma} and M. tuberculosis, and iron chelation increased hepcidin mRNA expression. A similar effect of iron on mouse macrophage inducible NOS promoter activity has been reported [43 ]. Thus, the effects of iron on hepcidin expression in macrophages and hepatocytes may reflect differences in promoter activity. The increased hepcidin mRNA in response to iron chelation in macrophages is consistent with studies, which show iron chelation inhibits M. tuberculosis growth [44 ].

The ELISA and immunofluorescence studies show that hepcidin protein is also induced by IFN-{gamma} and mycobacterial infection. Intracellular hepcidin was detected by ELISA in RAW264.7 cells treated with irradiated M. tuberculosis. The highest levels of hepcidin protein were detected in RAW264.7 cells, which were also stimulated with IFN-{gamma}. Hepcidin is also secreted by RAW264.7 cells stimulated with M. tuberculosis and IFN-{gamma}. Hepcidin protein was also observed in RAW264.7 cells infected with live M. tuberculosis alone and in RAW264.7 cells treated with M. tuberculosis and IFN-{gamma}; the latter condition demonstrated greater fluorescence intensity. In these experiments, we found hepcidin to highly localize to the phagosome. Hepcidin was present in the phagosome beginning at 4 h after infection. Fluorescence intensity increased with time after infection and stimulation with IFN-{gamma}. This increase in hepcidin protein paralleled the increase in hepcidin mRNA expression. To our knowledge, this is the first report that indicates that hepcidin trafficks to the phagosome.

Hepcidin is synthesized as a propeptide precursor, which is then processed into the 25-amino acid, mature form [22 , 45 ]. The hepcidin antibody used in these studies was raised with a peptide from the C terminus of the mature form of hepcidin. Absorption with the 25 amino acid hepcidin peptide removed the immunofluorescence activity of the antibody, indicating the antibody is reactive with the mature hepcidin peptide. However, the antibody could also potentially react with the propeptide precursor. Our immunofluorescence microscopy studies show a low level of punctate staining throughout the cell, consistent with hepcidin being present in intracellular vesicles. Thus, our studies suggest that hepcidin has two pathways of trafficking within macrophages: fusion of intracellular vesicles with phagosomes, resulting in localization of hepcidin within the phagosome, and trafficking to the cell surface, resulting in secretion. At present, we do not know at what step in the trafficking the hepcidin propeptide precursor is processed into the mature form.

In macrophages, mycobacteria acquire iron from extracellular sources, including iron bound to transferrin, lactoferrin, and low molecular weight chelates, and from the intracellular labile iron pool [46 , 47 ]. IFN-{gamma} is critical in restricting the growth of mycobacteria [5 , 6 ]. One of the antimicrobial mechanisms of IFN-{gamma} is its ability to decrease macrophage iron levels. Decreased macrophage iron is thought to result from decreased transferrin receptor and ferritin expression induced by IFN-{gamma} [12 13 14 15 , 46 ]. Our observations, that IFN-{gamma} regulates expression of hepcidin, raise the question of whether this protein has a role in the antimicrobial activity of the IFN-{gamma}-activated macrophage. Hepcidin was identified, first as an antimicrobial peptide [21 , 22 ]. To determine if hepcidin has antibacterial activity against M. tuberculosis, in this study, we incubated M. tuberculosis with hepcidin in vitro. We observed growth inhibition of M. tuberculosis at 6 and 72 h. Examination of M. tuberculosis by electron microscopy showed that hepcidin caused lysis of M. tuberculosis, suggesting that hepcidin acts by causing loss of membrane integrity. This could occur by opening pores in the cell membrane of M. tuberculosis through the insertion of hepcidin into the cell membrane or by hepcidin interacting with transport proteins present in the cell membrane. The maximal growth inhibition hepcidin observed at earlier times-points was no greater than 50%. This observation suggests that M. tuberculosis can repair some of the damage caused by hepcidin or is able to partially degrade or inactivate hepcidin. The concentration of hepcidin required to maximally inhibit M. tuberculsosis growth in the in vitro assay is also high (100–200 µg/ml). Whether this concentration is reached in the phagosome is unknown. However, in the macrophage, hepcidin may act in concert with other IFN-{gamma}-induced antimicrobial mechanisms and thus, may be more effective at lower concentrations. Also, the conditions in the phagosome are likely to be more optimal for killing M. tuberculosis than the in vitro conditions.

During infection, hepcidin is released into the blood by liver hepatocytes and is believed to be responsible for the anemia associated with chronic disease and inflammation [48 , 49 ]. Tuberculosis is a chronic disease, and anemia is a common complication of pulmonary tuberculosis [50 ]. Dietary iron overload has been shown to support the growth of M. tuberculosis and is a risk factor for active tuberculosis [51 , 52 ]. These studies would suggest that hepcidin production is likely to be a factor in the anemia associated with tuberculosis. How much hepcidin secreted by mycobacteria-infected macrophages contributes to levels of hepcidin in the blood is not known. It is more likely that the effect of hepcidin production by infected macrophages would be local, mediating antimicrobial activity and inhibiting iron recycling from dead cells by surrounding macrophages.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by grant RO1DK-57667 from the National Institutes of Health. We thank Dr. Georg Pongratz, Dr. Travis McCarthy, Gail Alvarez, and Steve Oghumu for technical help, Dr.Virginia Sanders for equipment use, and Jane Dudek from Roche Applied Science for help with real-time RT-PCR assays.

Received April 10, 2007; revised June 6, 2007; accepted June 7, 2007.


arrow
REFERENCES
 
    1
  1. Schlesinger, L. S. (2004) Phagocytosis and Toll-like receptors in tuberculosis Rom, W. M. Garay, S. M. eds. Tuberculosis 2nd edition ,203-204 Lippincott, Williams, and Wilkins Philadelphia, PA, USA.
  2. 2
  3. Fenton, M. J., Riley, L. W., Schlesinger, L. S. (2004) Receptor-mediated recognition of Mycobacterium tuberculosis by host cells Cole, S. T. Eisenach, K. D. McMurray, D. N. Jacobs, W R. eds. Tuberculosis and Tubercle Bacillus ,405-426 American Society for Microbiology Herndon, VA, USA.
  4. 3
  5. Flynn, J. L., Chan, J. (2001) Immunology of tuberculosis Annu. Rev. Immunol. 19,93-119[CrossRef][Medline]
  6. 4
  7. Collins, H. L., Kaufmann, S. H. E. (2001) The many faces of host response to tuberculosis Immunology 103,1-9[CrossRef][Medline]
  8. 5
  9. Flynn, J. L., Chan, J., Triebold, K. J., Dalton, D. K., Stewart, T. A., Bloom, B. R. (1993) An essential role for interferon {gamma} in resistance in Mycobacterium tuberculosis infection J. Exp. Med. 178,2249-2254[Abstract/Free Full Text]
  10. 6
  11. Cooper, A. M., Dalton, D. K., Stewart, T. A., Griffin, J. P., Russell, D. G., Orme, I. M. (1993) Disseminated tuberculosis in interferon {gamma} disrupted mice J. Exp. Med. 178,2243-2247[Abstract/Free Full Text]
  12. 7
  13. MacMicking, J., Xie, Q-W., Nathan, C. (1997) Nitric oxide and macrophage function Annu. Rev. Immunol. 15,323-350[CrossRef][Medline]
  14. 8
  15. Schaible, U. E., Strugill-Koszycki, S., Schlesinger, P. H., Russell, D. G. (1998) Cytokine activation leads to acidification and increases maturation of Mycobacterim avium-containing phagosomes in murine macrophages J. Immunol. 160,1290-1296[Abstract/Free Full Text]
  16. 9
  17. Via, L. E., Fratti, R. A., McFalone, M., Pagen-Ramos, E., Deretic, D., Deretic, V. (1998) Effects of cytokines on mycobacterial phagosome maturation J. Cell Sci. 111,897-905[Abstract]
  18. 10
  19. Crichton, R. R., Wilmet, S., Legssyer, R., Ward, R. J. (2002) Molecular and cellular mechanisms of iron homeostasis and toxicity in mammalian cells J. Inorg. Biochem. 91,9-18[CrossRef][Medline]
  20. 11
  21. Kuhn, D. E., Baker, B. D., Lafuse, W. P., Zwilling, B. S. (1999) Differential iron transport into phagosomes isolated from the RAW264.7 macrophage cell lines transfected with Nramp1Gly169 or Nramp1Asp169 J. Leukoc. Biol. 66,113-119[Abstract]
  22. 12
  23. Taetle, R., Honeysett, J. M. (1988) {gamma}-Interferon modulates human monocyte/macrophage transferrin receptor expression Blood 71,1590-1595[Abstract/Free Full Text]
  24. 13
  25. Byrd, T. F., Horwitz, M. A. (1993) Regulation of transferrin receptor expression and ferritin content in human mononuclear phagocytes. Coordinate upregulation by iron transferrin and downregulation by interferon-{gamma} J. Clin. Invest. 91,969-976[Medline]
  26. 14
  27. Mulero, V., Block, J. H. (1999) Regulation of iron metabolism in murine J774 macrophages: role of nitric oxide-dependent and -independent pathways following activation with {gamma} interferon and lipopolysaccharide Blood 94,2383-2389[Abstract/Free Full Text]
  28. 15
  29. Zhong, W., Lafuse, W. P., Zwilling, B. S. (2001) Infection with Mycobacterium avium differentially regulates the expression of iron transport protein mRNA in murine peritoneal macrophages Infect. Immun. 69,6618-6624[Abstract/Free Full Text]
  30. 16
  31. Gold, B., Rodriguez, G. M., Marras, M. P., Pentecost, M., Smith, I. (2001) The Mycobacterium tuberculosis IdeR is a dual functional regulator and controls transcription of genes involved in iron acquisition, iron storage, and survival in macrophages Mol. Microbiol. 42,851-865[CrossRef][Medline]
  32. 17
  33. De Voss, J. J., Rutter, K., Schroeder, B. G., Barry, C. E., III (1999) Iron acquisition and metabolism by mycobacteria J. Bacteriol. 181,4443-4451[Free Full Text]
  34. 18
  35. Schnappinger, D., Ehrt, S., Voskuil, M. I., Liu, Y., Mangan, J. A., Monahan, I. M., Dolganov, G., Efron, B., Butcher, P. D., Nathan, C., Schoolnik, G. K. (2003) Transcriptional adaptation of Mycobacterium tuberculosis within macrophages: insights into the phagosomal environment J. Exp. Med. 198,693-704[Abstract/Free Full Text]
  36. 19
  37. Timm, J., Post, F. A., Bekker, L. G., Walther, G. B., Wainwright, C. H., Manganelli, R., Chan, W. T., Tsenova, L., Gold, B., Smith, I., Kaplan, G., McKinney, J. D. (2003) Differential expression of iron-, carbon-, and oxygen-responsive mycobacterial genes in the lungs of chronicle infected mice and tuberculosis patients Proc. Natl. Acad. Sci. USA 100,14321-14326[Abstract/Free Full Text]
  38. 20
  39. Hancock, R. E., Diamond, G. (2000) The role of cationic antimicrobial peptides in innate host defences Trends Microbiol. 8,402-410[CrossRef][Medline]
  40. 21
  41. Krause, A., Neitz, S., Magert, H. J., Schulz, A., Forssmann, W. G., Schulz-Knappe, P., Adermann, K. (2000) LEAP-1, a novel highly disulfide-bonded human peptide, exhibits antimicrobial activity FEBS Lett. 480,147-150[CrossRef][Medline]
  42. 22
  43. Park, C. H., Valore, E. V., Waring, A. J., Ganz, T. (2001) Hepcidin: a urinary antimicrobial peptide synthesized in the liver J. Biol. Chem. 276,7806-7810[Abstract/Free Full Text]
  44. 23
  45. Laftah, A. H., Ramesh, B., Simpson, R. J., Solanky, N., Bahram, S., Schumann, K., Debnam, E. S., Srai, S. K. S. (2004) Effect of hepcidin on intestinal iron absorption in mice Blood 103,3940-3944[Abstract/Free Full Text]
  46. 24
  47. Yamaji, S., Sharp, P., Ramesh, B., Srai, S. K. S. (2004) Inhibition of iron transport across human intestinal epithelial cells by hepcidin Blood 104,2178-2180[Abstract/Free Full Text]
  48. 25
  49. Knutson, M. D., Oukka, M., Koss, L. M., Aydemir, F., Wessling-Resnick, M. (2005) Iron release from macrophages after erythrophagocytosis is up-regulated by ferroportin 1 overexpression and down-regulated by hepcidin Proc. Natl. Acad. Sci. USA 102,1324-1328[Abstract/Free Full Text]
  50. 26
  51. Nemeth, E., Tuttle, M. S., Powelson, J., Vaughn, M. B., Donovan, A., McVey Ward, D., Gantz, T., Kaplan, J. (2004) Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization Science 306,2090-2093[Abstract/Free Full Text]
  52. 27
  53. Nicolas, G., Bennoun, M., Devaux, I., Beaumont, C., Grandchamp, B., Kahn, A., Vaulont, S. (2001) Lack of hepcidin gene expression and severe tissue iron overload in upstream stimulatory factor 2 (USF2) knockout mice Proc. Natl. Acad. Sci. USA 98,8780-8785[Abstract/Free Full Text]
  54. 28
  55. Nicolas, G., Bennoun, M., Porteu, A., Mativet, S., Beaumont, C., Grandchamp, B., Sirito, M., Sawadogo, M., Kahn, A., Vaulont, S. (2002) Severe iron deficiency anemia in transgenic mice expressing liver hepcidin Proc. Natl. Acad. Sci. USA 99,4596-4601[Abstract/Free Full Text]
  56. 29
  57. Nemeth, E., Rivera, S., Gabayan, V., Keller, C., Taudorf, S., Pedersen, B. K., Ganz, T. (2004) IL-6 mediates hypoferremia of inflammation by inducing the synthesis of the iron regulatory hormone hepcidin J. Clin. Invest. 113,1271-1276[CrossRef][Medline]
  58. 30
  59. Nemeth, E., Valore, E. V., Territo, M., Schiller, G., Lichtenstein, A., Ganz, T. (2003) Hepcidin, a putative mediator of anemia of inflammation, is a type II acute-phase protein Blood 101,2461-2463[Abstract/Free Full Text]
  60. 31
  61. Lee, P., Peng, H., Gelbart, T., Wang, L., Beutler, E. (2005) Regulation of hepcidin transcription by interleukin-1 and interleukin-6 Proc. Natl. Acad. Sci. USA 102,1906-1910[Abstract/Free Full Text]
  62. 32
  63. Anderson, G. J., Frazer, D. M., Wilkins, S. J., Becker, E. M., Millard, K. N., Murphy, T. L., McKie, A. T., Vulpe, C. D. (2002) Relationship between intestinal iron-transporter expression, hepatic hepcidin levels and the control of iron absorption Biochem. Soc. Trans. 30,724-726[CrossRef][Medline]
  64. 33
  65. Nicolas, G., Ghauvet, C., Viatte, L., Danan, J. L., Biggard, X., Devaux, I., Beaumont, C., Kahn, A., Vaulont, S. (2002) The gene that codes for hepcidin, an iron regulatory hormone, is regulated by anemia, hypoxia, and inflammation J. Clin. Invest. 110,1037-1044[CrossRef][Medline]
  66. 34
  67. Pigeon, C., Ilyin, G., Courselaud, B., Leroyer, P., Turlin, B., Brissot, P., Loreal, O. (2001) A new mouse liver-specific gene, encoding a protein homologous to human antimicrobial peptide hepcidin, is overexpressed during iron overload J. Biol. Chem. 276,7811-7819[Abstract/Free Full Text]
  68. 35
  69. Peyssonnaux, C., Zinkernagel, A. S., Datta, V., Lauth, X., Johnson, R. S., Nizet, V. (2006) TLR-4 dependent hepcidin expression by myeloid cells in response to bacterial pathogens Blood 107,3727-3732[Abstract/Free Full Text]
  70. 36
  71. Schlesinger, L. S. (1993) Macrophage phagocytosis of virulent but not attenuated strains is mediated by mannose receptors in addition to complement receptors J. Immunol. 150,2920-2930[Abstract]
  72. 37
  73. Livak, K. J., Schmittgen, D. T. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2{Delta}{Delta}Ct method Methods 25,402-408[CrossRef][Medline]
  74. 38
  75. Ferguson, J. S., Voelker, D. R., Ufnar, J. A., Dawson, A. J., Schlesinger, L. S. (2002) Surfactant protein D inhibition of human macrophage uptake of Mycobacterium tuberculosis is independent of bacterial agglutination J. Immunol. 168,1309-1314[Abstract/Free Full Text]
  76. 39
  77. Fleming, R. E., Sly, W. S. (2001) Hepcidin: a putative iron regulatory hormone relative to hereditary hemochromatosis and the anemia of chronic disease Proc. Natl. Acad. Sci. USA 98,8160-8162[Free Full Text]
  78. 40
  79. Roy, C. N., Custodio, A. O., deGraaf, J., Schneider, S., Akpan, I., Montross, L. K., Sanchez, M., Gaudino, A., Hentze, M. W., Andrews, N. C., Muckenthaler, M. U. (2004) An Hfe-dependent pathway mediates hyposidermia in response to lipopolysaccharide-induced inflammation in mice Nat. Genet. 36,481-485[CrossRef][Medline]
  80. 41
  81. Liu, X. B., Nguyen, N. H., Marquess, K. D., Yang, F., Haile, D. J. (2005) Regulation of hepcidin and ferroportin expression by lipopolysaccharide in splenic macrophages Blood Cells Mol. Dis. 35,47-56[CrossRef][Medline]
  82. 42
  83. Nguyen, N-B., Callaghan, K. D., Ghio, A. J., Haile, D. J., Yang, F. (2006) Hepcidin expression and iron transport in alveolar macrophages Am. J. Physiol. Lung Cell. Mol. Physiol. 291,L417-L425[Abstract/Free Full Text]
  84. 43
  85. Dlaska, M., Weiss, G. (1999) Central role of transcription factor NF-IL6 for cytokines and iron-mediated regulation of murine inducible nitric oxide synthase expression J. Immunol. 162,6171-6177[Abstract/Free Full Text]
  86. 44
  87. Boelaert, J. R., Vandecasteele, S. J., Appelberg, R., Gordeuk, V. R. (2007) The effect of the host's iron status on tuberculosis J. Infect. Dis. 195,1745-1753[CrossRef][Medline]
  88. 45
  89. Nicolas, G., Viatte, L., Bennoun, M., Beaumont, C., Kahn, A., Vaulont, S. (2002) Hepcidin, a new iron regulatory peptide Blood Cells Mol. Dis. 29,327-335[CrossRef][Medline]
  90. 46
  91. Olakanmi, O., Schlesinger, L. S., Ahmed, A., Britigan, B. E. (2002) Intraphagosomal Mycobacterium tuberculosis acquires iron from both extracellular transferrin and intracellular iron pools. Impact of interferon-{gamma} and hemochromatosis J. Biol. Chem. 277,49727-49734[Abstract/Free Full Text]
  92. 47
  93. Olakanmi, O., Schlesinger, L. S., Ahmed, A., Britigan, B. E. (2004) The nature of extracellular iron influences iron acquisition by Mycobacterium tuberculosis Infect. Immun. 72,2022-2028[Abstract/Free Full Text]
  94. 48
  95. Ganz, T. (2003) Hepcidin, a key regulator of iron metabolism and mediator of anemia of inflammation Blood 102,783-788[Abstract/Free Full Text]
  96. 49
  97. Weinstein, D. A., Roy, C. N., Fleming, M. D., Loda, M. F., Wolfsdorf, J. I., Andrews, N. C. (2002) Inappropriate expression of hepcidin is associated with iron refractory anemia: implications for the anemia of chronic disease Blood 100,3776-3781[Abstract/Free Full Text]
  98. 50
  99. Goldenberg, A. S. (1996) Haematological abnormalities and mycobacterial infections Rome, W. N. Garay, S. eds. Tuberculosis ,645-652 Little Brown and Company Boston, MA, USA.
  100. 51
  101. Gangaidzo, I. T., Moyo, V. M., Mvundura, E., Aggrey, G., Murphree, N. L., Khumalo, H., Saungweme, T., Kasvosve, I., Gomo, Z. A. R., Rouault, T., Boelaert, J. R., Gordeuk, V. R. (2001) Association of pulmonary tuberculosis with increased dietary iron J. Infect. Dis. 184,936-939[CrossRef][Medline]
  102. 52
  103. Lounis, N., Truffot-Pernot, C., Grosset, J., Grodeuk, V. R., Boelaert, J. R. (2001) Iron and Mycobacterium tuberculosis infection J. Clin. Virol. 20,123-126[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Nutr.Home page
J. F. Collins, M. Wessling-Resnick, and M. D. Knutson
Hepcidin Regulation of Iron Transport
J. Nutr., November 1, 2008; 138(11): 2284 - 2288.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. E. Van Zandt, F. B. Sow, W. C. Florence, B. S. Zwilling, A. R. Satoskar, L. S. Schlesinger, and W. P. Lafuse
The iron export protein ferroportin 1 is differentially expressed in mouse macrophage populations and is present in the mycobacterial-containing phagosome
J. Leukoc. Biol., September 1, 2008; 84(3): 689 - 700.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. N. Paradkar, I. De Domenico, N. Durchfort, I. Zohn, J. Kaplan, and D. M. Ward
Iron depletion limits intracellular bacterial growth in macrophages
Blood, August 1, 2008; 112(3): 866 - 874.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
I. Theurl, M. Theurl, M. Seifert, S. Mair, M. Nairz, H. Rumpold, H. Zoller, R. Bellmann-Weiler, H. Niederegger, H. Talasz, et al.
Autocrine formation of hepcidin induces iron retention in human monocytes
Blood, February 15, 2008; 111(4): 2392 - 2399.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0407216v1
82/4/934    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sow, F. B.
Right arrow Articles by Lafuse, W. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sow, F. B.
Right arrow Articles by Lafuse, W. P.