Journal of Leukocyte Biology Myeloid cells, immune suppression, tumor immunology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published online as doi:10.1189/jlb.0107042 on June 18, 2007

Published online before print June 18, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0107042v1
82/3/630    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leite, D. F. P.
Right arrow Articles by Rumjanek, V. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leite, D. F. P.
Right arrow Articles by Rumjanek, V. M.
(Journal of Leukocyte Biology. 2007;82:630-637.)
© 2007 by Society for Leukocyte Biology

ABCC transporter inhibition reduces zymosan-induced peritonitis

Daniela F. P. Leite*,{dagger},{ddagger}, Juliana Echevarria-Lima§, Samira Cardoso Ferreira||, João B. Calixto{ddagger} and Vivian M. Rumjanek*,1

* Institutos de Bioquímica Médica and
{dagger} Biofísica Carlos Chagas Filho and
§ Departamento de Imunologia, Instituto de Microbiologia Paulo Góes, Universidade Federal do Rio de Janeiro (UFRJ), Rio de Janeiro, Brazil; and
{ddagger} Departamento de Farmacologia and
|| Hospital Universitário, Universidade Federal de Santa Catarina (UFSC), Florianópolis, Brazil

1 Correspondence: Laboratório de Imunologia Tumoral, sala H2003, Instituto de Bioquímica Médica, Centro de Ciências da Saúde, Universidade Federal do Rio de Janeiro, Cidade Universitária, Rio de Janeiro, Brazil. E-mail: vivian{at}bioqmed.ufrj.br


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Inflammatory mediators are released from injured tissues being responsible for the first steps of inflammatory processes. Multidrug efflux transporters, members of the ATP-binding cassette (ABC) family, are ubiquitously expressed. ABCC molecules transport several endogenous substances, including leukotriene C4 (LTC4) and PGE2, which are involved in zymosan-induced inflammation. The present study investigated the role played by ABCC transporters on zymosan-induced peritonitis in mice. Most of the resident peritoneal cells were macrophages, based on their morphology and membrane-activated complex 3 expression. RT-PCR demonstrated that these cells expressed ABCC, and ABCC activity was analyzed in vivo via the s.c. injection of ABCC inhibitors [probenecid (PROB) 200 mg/kg or MK571 20 mg/kg], followed by an i.v. injection of carboxyfluorescein diacetate (CFDA), an ABCC fluorescent substrate. Both inhibitors increased CFDA accumulation, suggesting ABCC impairment. Moreover, ABCC reversors decreased zymosan-induced plasma exudation by 86.6 ± 7.4 and 97.6 ± 2.3%, a feature related to a diminished secretion of LTC4 (65.1±11 and 47.8±9.9%) and PGE2 (under basal levels). Cell migration was inhibited similarly. Furthermore, PROB and MK571 inhibited IL-1ß by 83.4 ± 13 and 71.2 ± 13.4% and TNF-{alpha} content by 47 ± 4.5 and 28.9 ± 0.8%, respectively. NO metabolites and reactive oxygen species production were also reduced. The present results suggest that ABCC molecules have a relevant role in the acute inflammatory response produced by zymosan in mice.

Key Words: LTC4 • NOx • ROS • macrophages • MK571 • probenecid • PGE2 • TNF-{alpha} • IL-1ß


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Peritonitis induced by zymosan A in mice is a well-characterized and largely used model of inflammation [1 ]. Zymosan A is an insoluble polysaccharide component of the cell wall from the yeast Sacharomyces cerevisae. Among other actions, zymosan induces mast cell degranulation and activates macrophages. When administered in the mouse peritoneal cavity, zymosan induces an increased vascular extravasation, one of the primary signs of inflammation. This is a key step in the inflammatory exudate formation and is followed by a time-dependent recruitment of migratory cells, especially neutrophils [1 ].

There are many mediators that coordinate the initial events of acute inflammation such as vasoactive amines, lipid-derived eicosanoids, chemokines, reactive oxygen species (ROS), NO, and cytokines. Edema is a result of plasma protein extravasation induced by vasoactive amines and eicosanoids. Vasodilatation is mediated primarily by NO and vasodilatory PGs. Proinflammatory cytokines, such as TNF-{alpha} and IL-1ß, activate signaling pathways in endothelial cells, which regulate the expression of adhesion molecules to initiate the recruitment of circulating leukocytes and partially activate (prime) migratory cells [2 3 4 ].

It is well recognized that peritoneal resident cells, such as mesothelial cells, lymphocytes, mast cells, and macrophages, play a promoter role in the zymosan-induced peritonitis. It has been demonstrated recently in this model that histamine and PGE2 released by mast cells contribute to the increased plasma protein extravasation [5 ]. However, the central cell type that mediates this process is the resident macrophage, which produces PGE2 and especially cysteinyl leukotrienes (LTs) [6 ].

LTs and PGs are mediators derived from the metabolism of arachidonic acid (AA) by 5-lipooxygenase and cyclooxygenase (COX), respectively. Two subclasses of LTs are found: the cysteinyl LTs (LTC4, LTD4, and LTE4) and the LTB4. These mediators are synthesized from a common intermediate LTA4, originating LTC4 through LTC4 synthethase or originating LTB4 through LTA4 hydrolase action [7 ]. Conversely, many prostanoids are produced by the COX pathway, among them PGs, such as cyclopentane PGs and PGE2.

Another component of cysteinyl LTs and the PGE2 pathway, which is rarely studied, is the secretion of these mediators from the cell. Their extrusion is mediated in an ATP-dependent manner by ATP-binding cassette (ABC) transporters, belonging to the ABCC family [8 9 10 11 ]. It is possible, therefore, that substances capable of regulating ABCC transport may modulate an inflammatory process. In fact, abcc1 knockout mice show a diminished response to a nonspecific, inflammatory stimulus [12 ]. In a model of pneumonia induced by Streptococcus pneumoniae, abcc1–/– mice demonstrated a reduced influx of granulocytes in the bronchoalveolar lavage fluid and a reduced production of protective cytokines and chemokines in lung homogenates, such as IL-6, MIP-2, and CXCL1, when compared with wild-type mice [13 ]. Therefore, by modifying one step of the inflammatory process, this action may affect further steps as a result of a cascade effect.

The present work aimed at investigating the role of ABCC transport further in an in vivo inflammatory model, namely zymosan-induced peritonitis in mice. For this, the systemic effects of well-known ABCC inhibitors [probenecid (PROB) and MK571] were studied with regard to several parameters characteristic of acute inflammation: the mediators produced, plasma protein extravasation, and cell migration into the inflammatory site.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals
Nonfasted Swiss male mice (25–35 g) were bred in the Pharmacology Department, Universidade Federal de Santa Catarina (UFSC; Florianópolis, Brazil), under a 12:12-h, light–dark cycle and with access to food and water ad libitum. The local ethics committee of UFSC had approved all protocols used.

Animal treatment
Animals were injected s.c. 30 min before zymosan injection (unless otherwise stated) with the COX inhibitor diclofenac (Sigma-Aldrich, St. Louis, MO, USA; 10 mg/kg) or the inhibitor of LT synthesis, MK886 (Cayman Chemical Co., Ann Arbor, MI, USA; 5 mg/kg), or one of the following ABCC inhibitors: PROB (200 or 400 mg/kg, Sigma-Aldrich) or MK571 (generously donated by Merck, Kirkland, Quebec, Canada; 20 mg/kg). Animals were injected i.v. with 10 mg/kg carboxyfluorescein diacetate (CFDA; Molecular Probes, Eugene, OR, USA).

Induction of peritonitis
Peritoneal inflammation was induced according to Doherty et al. [1 ]. Zymosan A (Sigma-Aldrich) was prepared freshly (2 mg/ml) in sterile, 0.9% w/v saline, and 0.5 ml was injected i.p. Animals were killed by cervical dislocation. The peritoneal cavity was washed with 1.5 ml cold PBS, and after 30 s of gentle manual massage, the exudate was retrieved, and the volume was measured. Exudates were centrifuged at 1500 g for 10 min and frozen at –70°C. In another set of experiments, the peritoneal cavity was washed twice with 7.5 ml each time of cold PBS to recover peritoneal cells; the exudate was collected and used freshly for cell counts and cytospin preparations.

Cell counts
Total cell count was performed with a Neubauer chamber, and differential cell counts were carried out, double-blind, on May-Grunwald Giemsa (Doles Reagentes, Goiás, Brazil)-stained cytospin preparations. Differential cell counts included macrophages and lymphocytes or neutrophils and eosinophils, which were expressed as a percentage of total leukocytes.

ABCC expression
RT-PCR was done as described in ref. [14 ]. Briefly, total RNA was extracted from resident peritoneal cells by using the Trizol reagent (Invitrogen, Scotland, UK) protocol. To eliminate passenger DNA, samples (5 µg total RNA) were treated with RNAse-free DNAse I amplification grade (Invitrogen) using the kit protocol. The RT was performed using the RT Moloney murine leukemia virus (M-MLV; 200 U, Invitrogen). This reaction was performed using the following: treated RNA (5 µg), 0.5 ng oligo dT (Promega, Madison, WI, USA), 0.5 mM dNTP mix (Invitrogen), 40 U RNAse OUT (Invitrogen), 0.01 mM DTT (Invitrogen), and M-MLV buffer reaction. The cDNA was prepared as described in the RT M-MLV (Invitrogen) protocol in a total of 20 µl. cDNAs were stored at 4°C until the PCR reaction was done. The amplification reaction was realized as described in the AccuprimeTM Pfx SuperMix protocol. Briefly 1.5 µl cDNA (0.375 µg) was added to 11.25 µl AccuprimeTM Pfx SuperMix. To this mixture, 0.25 µl antisense prime (10 µM) for ABCC1 (5'-CGCAGGTTGTGCAGGCCGAT-3'), ABCC2 (5'-TTTGTCCTTTCACTACTTC-3'), ABCC3 (5'-CGCTCTCAGCTCACCATCAT-3'), or ß-actin (CGTCTCCGGAGTCCATCACA); 0.25 µl sense prime (10 µM) for ABCC1 (5'-GTAGAGTTCCGGGATTAC-3'), ABCC2 (5'-TGGCTGAGATCGGAGAG-3'), ABCC3 (5'-CGCTCTCAGCTCACCATCAT-3'), or ß-actin (TCCTTCGTTGCCGGTCCACA); and 0.5 µl MgCl2 (25 mM, Qbiogene, Irvine, CA, USA) were added. The PCR was performed in a DNA thermal cycler (Eppendorf Mastercycler personal, Hamburg, Germany), and the conditions for PCR were 5 min at 95 °C, followed by 33 cycles of 15 s at 95°C, 30 s at 50°C, and 1 min at 68°C. The PCR products were size-fractionated in 1.8% agarose gels stained with 1 µl GoldViewTM. The DNA band sizes were confirmed by using the 50 pb DNA Ladder (Invitrogen).

Membrane-activated complex 3 (MAC-3) expression
For the detection of the MAC-3 molecule, cells from untreated mice were isolated as described above, and 5 x 105 peritoneal cells were washed and incubated with anti-MAC-3 (FITC; Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 30 min on ice. After this period, cells were washed in PBS and analyzed by flow cytometry using a FACSCalibur. Results were analyzed by WinMID software.

ABCC activity in vivo
To analyze ABCC-related activity in vivo, mice were treated s.c. with PROB (200 or 400 mg/kg) or MK571 (20 mg/kg), and 30 min later, CFDA (10 mg/kg) was injected i.v. in a final volume of 5 µl/g, as described before [15 ]. One hour later, mice were sacrificed, and peritoneal cells were recovered, washed, and put on ice until analysis by flow cytometry.

Vascular permeability
Vascular permeability was analyzed 30 min after zymosan injection, as described in ref. [6 ]. Results are expressed in µg/cavity Evans blue or the difference between peritoneal exudate volumes of treated mice minus that of control mice ({Delta} of volume increase in ml).

Measurement of paw edema
To test the ability of PROB to interfere with mast cell degranulation, mice were treated with PROB (200 or 400 mg/kg, s.c.) 30 min before compound 48/80 (Sigma-Aldrich; C48/80)-induced paw edema. The ability of ABCC inhibitors (PROB and MK571) to alter zymosan-induced paw edema was also tested. Mice were pretreated s.c. with ABCC inhibitors, followed by a s.c. injection in the plantar surface of the right hindpaw of C48/80 (12 µg in 50 µl, Sigma-Aldrich) or zymosan (500 µg in 50 µl). The contralateral paw received the same volume of PBS. Paw volume below the ankle joint was measured using a plethysmometer (Ugo Basile, Milan, Italy) at several time-points (10–120 min for C48/80-induced edema or 1–6 h for zymosan-induced edema) after the agent injection. Paw edema was expressed in µl as the difference between the volumes of right and left paws. Each point represents the mean ± SEM of at least four animals.

Cytokine and eicosanoid content
The peritoneal exudate contents of mouse TNF-{alpha} and IL-1ß were measured by DuoSet ELISA (R&D Systems, Minneapolis, MN, USA), according to the recommendations of the supplier. The peritoneal exudate contents of LTC4 and PGE2 were measured by enzyme immunosorbent assay, as recommended by Cayman Chemical Co. The LT kit detects manly LTC4 and LTC5.

NO metabolites (NOx) content
The nitrite concentration in the exudate was determined 30 min after zymosan injection. This was done by reducing nitrate enzymatically, using the enzyme nitrate reductase expressed in Escherichia coli grown anaerobically, as described before [16 ]. Nitrite levels were determined by the Griess method [17 ]. Values are expressed as nmol/cavity NOx.

Oxidative burst chemiluminescence (CL)
Mice were injected s.c. with PROB (200 mg/kg) or MK571 (20 mg/kg), and 30 min later, cells from the peritoneal cavity were harvested with 2.5 ml Hanks’ and placed in vials (in a total final volume of 2 ml). Luminol (50 µM) was introduced to the reaction vials, which were then allowed to equilibrate for 10 min to quantify the background CL generated by untreated phagocytes. Cells were stimulated with 150 µg/vial zymosan. After 10, 20, and 30 min following stimulant addition, vials were placed in a liquid scintillation counter (Packard Tri-Carb 1900 CA liquid scintillation analyzer) set for single photon counting and a 0.5-min counting interval per vial. After the assay, cells were counted in a Neubauer chamber. Cell counts in the peritoneal cavity were similar among saline, PROB, or MK571 s.c. treatment. Results are provided as average cpm for each 0.5 min counting interval per 105 cells. All CL experiments were performed in duplicate.

Statistical analysis
All results are presented as the mean ± SEM. Statistical comparison of the data was performed using ANOVA one-way analysis of variance, followed by Neuman Keuls multiple comparison test. P values less than 0.05 were considered to be significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Characterization of resident cells present in the exudates
Resident cells harvested in peritoneum lavage were composed mainly by macrophages, lymphocytes, and a small numbers of mast cells (Fig. 1A ). In fact, most of these cells expressed MAC-3 (Fig. 1B) , suggesting that the majority of the cells analyzed was macrophages. To verify the expression of ABCC molecules on these cells, the exudate was collected; the mRNA was extracted and quantified, and the RT-PCR reaction was performed (Fig. 1C) . The resident peritoneal cells expressed abcc1 and abcc3 but not abcc2. Thus, the activity of these ABCC molecules was evaluated in resident peritoneal cells. Mice were treated s.c. with PROB (400 or 200 mg/kg) or MK571 (20 mg/kg), and 30 min later, the animals were injected with saline or CFDA (10 mg/kg), a fluorescent dye transported by ABCC. As observed in Figure 1D , the autofluorescence value is 2.32 ± 0.18, and although the accumulation of CFDA in resident cells was small (mean fluorescence intensity 3.9 ± 0.5), treatment with the classical ABCC inhibitors, MK571 (20 mg/kg) or PROB (200 or 400 mg/kg), increased CFDA intensity to 10.42 ± 2.92, 10.94 ± 2.28, or 34.2 ± 16.27, respectively (Fig. 1D) , implying that ABCCs were active in resident cells and that MK571 (20 mg/kg) and PROB (200 mg/kg) were able to inhibit this activity in the same level. Moreover, these results show that PROB produced a dose-dependent inhibition.


Figure 1
View larger version (40K):
[in this window]
[in a new window]

 
Figure 1. Characterization of peritoneal resident cell. Morphological features of cells obtained in the peritoneal lavage; more than 95% are mononuclear cells (A). Expression of MAC-3 on peritoneal resident cells. Shaded histogram, cells without antibody (autofluorescence); empty histogram, cells incubated with anti-MAC-3 antibody (B). Expression of the mRNA of abcc1 (224 kb), abcc2 (596 kb), abcc3 (310 kb), and ß-actin (509 kb), as analyzed by agarose gel electrophoresis (1.8% gel). RT-PCR-amplified fragments were obtained from peritoneal resident cells. Lane MW, RNA ladder. Lane 1, abcc1; Lane 2, abcc2; Lane 3, abcc3; Lane 4, ß-actin (C). To analyze ABCC-related activity in vivo, mice were treated s.c. with PROB (200 or 400 mg/kg) or MK571 (20 mg/kg), and 30 min later, these mice received CFDA (10 mg/kg) i.v. One hour after the CFDA administration, animals were sacrificed. ABCC activity displayed by resident cells. AUTO, Autofluorescence of cells from injected animals. CFDA, Mean fluorescence intensity of cells from animals injected only with CFDA (D). Data are representative of at least three animals. * , P < 0.05 different from CFDA alone.

 
ABCC reversors decrease plasma extravasation induced by zymosan by inhibiting eicosanoid secretion
It has been demonstrated that cysteinyl LTs of macrophage origin are important mediators of vascular permeability at the early stages of zymosan-induced peritonitis [6 ]. As ABCC1 and ABCC3 are LTC4 transporters, we analyzed the relationship between LTC4 transport and the vascular permeability increase induced by zymosan treatment. Animal treatment with PROB (200 and 400 mg/kg, s.c.) as well as with MK571 (20 mg/kg, s.c.) 30 min prior to peritonitis induction was able to inhibit protein extravasation significantly (58±0.8, 86.6±7.4, and 97.6±2.3%, respectively; Fig. 2A ), as well as to decrease the volume of plasma exudation (Fig. 2B) . PROB (400 mg/kg), administered 3 h before peritonitis induction, was less effective, decreasing protein extravasation by 42 ± 1.3%. As PGE2 and LTC4 are known to be produced in zymosan-induced peritonitis [1 , 5 , 6 ], the effects of ABCC inhibitors on eicosanoids secretion were analyzed by us. As expected, the ABCC inhibitors, PROB (200 mg/kg) and MK571 (20 mg/kg), were able to diminish the amount of the ABCC1 and ABCC3 substrate, LTC4, in peritoneal exudates by 65.1 ± 11 and 47.8 ± 9.9%, and the positive control, the inhibitor of LT synthesis MK886, abolished its production (Fig. 2C) . A similar effect was observed on PGE2 content. As shown in Figure 2D , PROB (200 mg/kg) and MK571 (20 mg/kg) as well as the positive-control diclofenac, inhibited the content of PGE2 completely in peritoneal exudates: basal values (19.7±3.7), zymosan (50±4), PROB (16.6±6.8), MK571 (6.6±3), diclofenac (11.3±2.8) ng/cavity.


Figure 2
View larger version (27K):
[in this window]
[in a new window]

 
Figure 2. ABCC reversors decrease plasma extravasation induced by zymosan by inhibiting eicosanoid secretion. Thirty minutes after zymosan-induced peritonitis, peritoneal lavage was performed with 1.5 ml PBS. Cells were removed by centrifugation, and wash fluid was quantified and analyzed for Evans blue dye extravasation, LTC4, and PGE2 content. To analyze if ABCC inhibition could decrease these parameters, PROB (200 or 400 mg/kg) or MK571 (20 mg/kg) was given s.c. 30 min before the injection of zymosan. Paw edema was also induced by zymosan. Pretreatment with PROB as well as with MK571 was able to inhibit plasma extravasation (A), exudate volume (B), and the secretion of LTC4 (C) and PGE2 (D) stimulated by zymosan-induced peritonitis. As a positive control, diclofenac (10 mg/kg, s.c) or MK886 (5 mg/kg) was used to inhibit PGE2 and LTC4, respectively. Pretreatment with PROB and MK571 inhibited paw edema, expressed as differences between volumes (µl) of vehicle-injected (50 µl saline) and zymosan-injected (500 µg in 50 µl) paws (E), but PROB did not inhibit 48/80-induced (12 µg in 50 µl) paw edema (F). Data represent mean ± SEM from at least five animals. ***, P < 0.001, different from basal values; #, P < 0.05; ##, P < 0.01; ###, P < 0.001, different from zymosan. n.d, Not detected.

 
Another form of analyzing plasma extravasation is the paw edema model. ABCC inhibitors were able to decrease zymosan-induced paw edema (Fig. 2E) Furthermore, this reduction does not seem to be a direct inhibition of mast cell degranulation, as PROB (400 or 200 mg/kg) did not affect edema formation induced by 48/80 (Fig. 2F) .

ABCC inhibitors decrease zymosan-induced cell migration
No increase in cell numbers was observed in the peritoneal cavity, when cell counts were performed 30 min after zymosan injection (4.8±0.7x106 in animals injected with saline; 3.1±0.5x106 in animals injected with zymosan). Furthermore, as observed before, the majority of these cells was mononuclear cells (91±1.0% control mice; 87±2.5% zymosan-injected mice). The total cell number in the peritoneal cavity went up to 20 x 106 cells 4 h after zymosan treatment and reached a plateau up to 24 h, still high at 48 h.

PROB inhibited cell migration in a dose-dependent manner in the first 6 h (Fig. 3A ). The number of granulocytes, mainly neutrophils, was enhanced significantly 2 h after zymosan injection, reaching a peak at 4 h, still high at 24 h (Fig. 3B) . Granulocyte migration up to 6 h after zymosan injection was reduced significantly by PROB (400 mg/kg) pretreatment (Fig. 3B) . However, 24 h after peritonitis induction, the pretreatment with PROB increased neutrophil cell numbers (Fig. 3B) . This increase is probably a reflection of the fact that PROB, given only once, might be delaying the inflammatory process. Monocyte cell numbers were only enhanced significantly 24 h after zymosan injection; at this time-point, PROB (400 mg/kg) pretreatment was not able to inhibit migration (Fig. 3C) . However, in the first 2 h, zymosan induced a decrease in mononuclear cell numbers, independent of PROB treatment, probably as result of the macrophage disappearance reaction [18 ]. Macrophage numbers increased with time, and PROB treatment inhibited the recovery process at 4 h and 6 h (Fig. 3C) . Treatment with MK571 was able to inhibit zymosan-induced cell migration significantly, as observed at the peak of migration 4 h after peritonitis induction (Fig. 3D) , which is represented mainly by neutrophils (Fig. 3E) .


Figure 3
View larger version (30K):
[in this window]
[in a new window]

 
Figure 3. Effect of ABCC on cell migration. Mice were killed at time-points of 2, 4, 6, 24, and 48 h after zymosan-induced peritonitis. Total cell migration was counted using a Neubauer chamber (A). Cells were cytocentrifuged and stained with May-Grunwald to carry out the differential cell counts (B and C). PROB inhibited neutrophil migration (B) and diminished mononuclear cell accumulation until 6 h (C). Mice pretreated with MK571 were killed 4 h after zymosan injection. MK571 treatment was able to inhibit total cell migration (D), mainly neutrophils (E). Data represent mean ± SEM from at least six animals. *, P < 0.05; **, P < 0.01; ***, P < 0.001, different from basal values; #, P < 0.05; ##, P < 0.01; ###, P < 0.001, different from zymosan.

 
Different inflammatory mediators induced by zymosan are inhibited by ABCC reversors
As the cytokines TNF-{alpha} and IL-1ß are involved in cell migration [19 ], the present work analyzed if the ABCC inhibitors, PROB and MK571, modulated their secretion. The maximal production of TNF-{alpha} and IL-1ß induced by zymosan was achieved 2 h after peritonitis induction (data not shown). At this time-point, PROB and MK571 were able to inhibit TNF-{alpha} secretion by 51.8 ± 4.5 and 33.7 ± 0.8%, respectively (Fig. 4A ), and IL-1ß by 83.4 ± 13% and 71.2 ± 13.4% (Fig. 4B) .


Figure 4
View larger version (17K):
[in this window]
[in a new window]

 
Figure 4. Different inflammatory mediators induced by zymosan are inhibited by ABCC reversors. Pretreatment with PROB (200 mg/kg, s.c.) as well as with MK571 (20 mg/kg, s.c.) was able to decrease TNF-{alpha} (A), IL-1ß (B), and NOx (C) content in peritoneal exudate at 2 h (for TNF-{alpha} and IL-1ß) and 30 min (for NOx) after zymosan-induced peritonitis. Peritoneal cells, from animals pretreated with ABCC inhibitors, were stimulated with zymosan (150 µg) in vitro, and the luminol CL was analyzed at different time-points. Pretreatment was able to inhibit ROS production induced by zymosan (D). Data represent mean ± SEM from at least five animals. ***, P < 0.001, different from basal values; #, P < 0.05; ##, P < 0.01; ###, P < 0.001, different from zymosan.

 
The in vivo treatment with ABCC inhibitors was able to reduce different features of inflammation. The possibility that these effects were related to the inhibition of other mediators, which are produced early after zymosan activation, such as ROS and NO, was therefore investigated. The maximal levels of NOx production were archived at 30 min after zymosan injection and decreased rapidly; in 1 h, the NOx content almost returned to basal levels (data not shown). At 30 min after peritonitis induction, no migration of polymorphonuclear cells was observed, suggesting that this NOx was not produced by neutrophils but by resident peritoneal cells. As shown in Figure 4C , PROB (200 mg/kg) and MK571 (20 mg/kg) were able to reduce NOx production at 30 min by 62 ± 9.6 and 49.6 ± 13.5%, respectively. To analyze if ABCC inhibitors affected ROS production, mice were treated with PROB (200 mg/kg) or with MK571 (20 mg/kg), and 30 min later, peritoneal cells were harvested in Hanks’ solution and activated in vitro with 150 µg zymosan. As shown in Figure 4D , the in vivo treatment with ABCC inhibitors was able to reduce ROS production, analyzed by means of CL, at different times. ROS production achieved maximal values 20 min after zymosan activation (501.2±110.4 cpm/105 cells), and at this time-point, PROB and MK571 inhibited ROS production by 65.4 ± 7.4 and 80.6 ± 6.1%, respectively.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Murine resident macrophages, present in the peritoneal cavity, express ABCC1 and ABCC3. The present study identified ABCC transporter activity as an important factor for the initial steps of inflammation induced by zymosan in mice peritoneum. PROB is an organic anion transport inhibitor, capable of inhibiting ABCC1 and ABCC3 [20 , 21 ]. MK571 is a preferential inhibitor of ABCC1 [22 ], but it has been described that this compound also inhibits ABCC4 and ABCC5 [23 ]. The inhibition of ABCC activity reduced the increased vascular permeability and cell migration induced by zymosan, and this was accompanied by a diminished content of inflammatory mediators in the peritoneal cavity.

The expression and/or activity of ABCC molecules in macrophages have been described already [24 25 26 ]. In the present work, it was observed that the ABCC inhibitors PROB and MK571 reduced the increase in vascular permeability induced by zymosan. Our results are in agreement with those obtained by Wijnholds and collaborators [12 ], who observed that ear swelling induced by topical application of AA was reduced in abcc1–/– mice. The reduction in increased vascular permeability observed by us did not appear to depend on a direct effect on mast cell degranulation, as PROB did not inhibit plasma protein extravasation induced by the compound 48/80. However, it did not discard the involvement of mast cells in zymosan-induced peritonitis, as these cells can secrete many mediators, independent of their degranulation.

The reduction on increased vascular permeability could be associated to the reduced levels of LTC4 and PGE2, observed in the present study, as both inflammatory mediators are involved in plasma protein extravasation [1 , 6 , 27 ]. Moreover, ABCC1 and ABCC3 transport LTC4 [10 , 11 ], and recently, it has been demonstrated that ABCC1, ABCC2, and ABCC4 are involved in PGE2 secretion [9 , 28 ]. Therefore, the inhibition of ABCCs present in macrophages may be related directly to the diminished levels of LTC4 and PGE2 in peritoneal exudates.

Soon after zymosan injection, the recovery of peritoneal macrophages was diminished. The decrease in macrophage numbers might be a result of macrophage activation and increased adherence to the peritoneal cavity, a phenomenon known as macrophage disappearance reaction [18 ]. This increased adherence seemed to be compensated by the arrival of mononuclear cells into the cavity, and similar to what was observed with polymorphonuclear neutrophil (PMN), mononuclear cell migration appeared to be impaired by PROB, as no increase in mononuclear cells was observed up to 6 h after the stimulus. Another possibility is that activated cells detach after 2 h, and PROB affected this process somehow.

The recruitment of leukocytes to the inflammatory site involves cytokines such as TNF-{alpha} and IL-1ß [19 ]. It has also been suggested that LTC4 and PGE2 participate in the influx of PMN cells in the peritonitis model induced by zymosan [29 , 30 ]. Furthermore, Shultz et al. [13 ] demonstrated that abcc1–/– mice inoculated with S. pneumoniae presented a reduction in neutrophil influx as well as in TNF-{alpha} content. Therefore, the reduction on cellular migration observed by us may be a result of the decreased levels in peritoneal cavity of cytokines and lipid mediators involved in cell migration. Moreover, it is known that cytokines such as TNF-{alpha} [31 ] and IL-1ß [32 ] can be secreted from cells through ABC transporters such as ABCB1 and ABCA1, respectively. Therefore, the possibility that ABCC inhibitors could decrease TNF-{alpha} or IL-1ß secretion mediated by an ABC transporter from resident cells and/or polymorphonuclear cells cannot be discarded.

Another hallmark of inflammation, NO production, was also decreased by both ABCC inhibitors. These results are in accordance with previous results from our group [25 ], which demonstrated that PROB, indomethacin, and MK571 were capable in vitro of inhibiting NO secretion and inducible NO synthase expression by RAW macrophages activated with LPS by a post-transcriptional mechanism. Our present results demonstrated that the highest levels of NOx occurred 30 min after zymosan injection, suggesting that resident cells are involved in NO production and that this mediator might come from a constitutive enzyme. In fact, it has been shown that zymosan has a direct effect on peritoneal mesothelial cells, which are able to generate NO [33 ]. Beside these cells, endothelial cells and macrophages may also be responsible for this NO production. Moreover, the LTC4 receptor is present in these cells, and it has been shown by Hui and collaborators [34 ] in transgenic mice overexpressing CysLTR2 that stimulation of this receptor induced an increased Ca mobilization and NO production within 30 min. Therefore, it is possible that NO reduction could be an indirect effect of LTC4-reduced levels in the peritoneal cavity. However, it is worth taking into account that ROS production, induced by zymosan, was also inhibited. In a process that depends on a cascade effect, it is difficult to pinpoint the fundamental event being affected and what represents the consequences of the primary event.

We concluded that ABCC is important in the acute phase of zymosan-induced inflammation. In accordance with our data, it has been shown that abcc1–/– mice displayed a reduced, acute phase of the inflammatory response to S. pneumoniae and Mycobacterium tuberculosis [13 , 35 ]. Therefore, ABCC proteins represent an important target for studying the inflammatory process.


    ACKNOWLEDGEMENTS
 
This work was supported by Programa de Apoio aos Núcleos de Excelência (PRONEX; Brazil), Conselho Nacional de Pesquisa e Desenvolvimento Cientifíco (CNPq; Brazil), and Fundação de Apoio a Pesquisa do Estado de Santa Catarina (FAPESC; Brazil). D. F. P. L. is a recipient of a Ph.D. fellowship from CNPq. We are grateful to Dr. Maria Claudia Santos-Silva and Jamil Assreuy for laboratory facilities.

Received January 19, 2007; revised May 4, 2007; accepted May 17, 2007.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Doherty, N. X., Poubelle, P., Borgeat, P., Beaver, T. H., Westrich, G. L., Schrader, N. L. (1985) Intraperitoneal injection of zymosan in mice induces pain, inflammation and the synthesis of peptidoleukotrienes and prostaglandin E2 Prostaglandins 30,769-789[CrossRef][Medline]
  2. Lawrence, T., Willoughby, D. A., Gilroy, D. W. (2002) Anti-inflammatory lipid mediators and insights into the resolution of inflammation Nat. Rev. Immunol. 2,787-795[CrossRef][Medline]
  3. Nathan, C. (2002) Points of control in inflammation Nature 420,846-852[CrossRef][Medline]
  4. Sherwood, E. R., Toliver-Kinsky, T. (2004) Mechanisms of the inflammatory response Best Pract. Res. Clin. Anaesthesiol. 18,385-405[CrossRef][Medline]
  5. Kolaczkowska, E., Seljelid, R., Plytycz, B. (2001) Role of mast cells in zymosan-induced peritoneal inflammation in Balb/c and mast cell-deficient WBB6F1 mice J. Leukoc. Biol. 69,33-42[Abstract/Free Full Text]
  6. Kolaczkowska, E., Shahzidi, S., Seljelid, R., van Rooijen, N., Plytycz, B. (2002) Early vascular permeability in murine experimental peritonitis is co-mediated by resident peritoneal macrophages and mast cells: crucial involvement of macrophage-derived cysteinyl-leukotrienes Inflammation 26,61-71[CrossRef][Medline]
  7. Yopp, A. C., Randolph, G. J., Bromberg, J. S. (2003) Leukotrienes, sphingolipids, and leukocyte trafficking J. Immunol. 171,5-10[Free Full Text]
  8. Chen, Z. S., Guo, Y., Belinsky, M. G., Kotova, E., Kruh, G. D. (2005) Transport of bile acids, sulfated steroids, estradiol 17-ß-D-glucuronide, and leukotriene C4 by human multidrug resistance protein 8 (ABCC11) Mol. Pharmacol. 67,545-557[Abstract/Free Full Text]
  9. De Waart, D. R., Paulusma, C. C., Kunne, C., Oude Elferink, R. P. (2006) Multidrug resistance associated protein 2 mediates transport of prostaglandin E2 Liver Int. 26,362-368[CrossRef][Medline]
  10. Leier, I., Jedlitschky, G., Buchholz, U., Cole, S. P., Deeley, R. G., Keppler, D. (1994) The MRP gene encodes an ATP-dependent export pump for leukotriene C4 and structurally related conjugates J. Biol. Chem. 269,27807-27810[Abstract/Free Full Text]
  11. Zeng, H., Liu, G., Rea, P. A., Kruh, G. D. (2000) Transport of amphipathic anions by human multidrug resistance protein 3 Cancer Res. 60,4779-4784[Abstract/Free Full Text]
  12. Wijnholds, J., Evers, R., van Leusden, M. R., Mol, C. A., Zaman, G. J., Mayer, U., Beijnen, J. H., van der Valk, M., Krimpenfort, P., Borst, P. (1997) Increased sensitivity to anticancer drugs and decreased inflammatory response in mice lacking the multidrug resistance-associated protein Nat. Med. 3,1275-1279[CrossRef][Medline]
  13. Schultz, M. J., Wijnholds, J., Peppelenbosch, M. P., Vervoordeldonk, M. J., Speelman, P., van Deventer, S. J., Borst, P., van der Poll, T. (2001) Mice lacking the multidrug resistance protein 1 are resistant to Streptococcus pneumoniae-induced pneumonia J. Immunol. 166,4059-4064[Abstract/Free Full Text]
  14. Echevarria-Lima, J., Kyle-Cezar, F., Leite, D. F. P., Capella, L., Capella, M. A., Rumjanek, V. M. (2005) Expression and activity of multidrug resistance protein 1 in a murine thymoma cell line Immunology 114,468-475[CrossRef][Medline]
  15. Leite, D. F., Echevarria-Lima, J., Salgado, L. T., Capella, M. A., Calixto, J. B., Rumjanek, V. M. (2006) In vivo and in vitro modulation of MDR molecules in murine thymocytes Int. Immunopharmacol. 6,204-215[CrossRef][Medline]
  16. Granger, D. L., Hibbs, J. B., Jr, Perfect, J. R., Durack, D. T. (1990) Metabolic fate of L-arginine in relation to microbiostatic capability of murine macrophages J. Clin. Invest. 85,264-273[Medline]
  17. Green, L. C., Wagner, D. A., Glogowski, J., Skipper, P. L., Wishnok, J. S., Tannenbaum, S. R. (1982) Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids Anal. Biochem. 126,131-138[CrossRef][Medline]
  18. Barth, M. W., Hendrzak, J. A., Melnicoff, M. J., Morahan, P. S. (1995) Review of the macrophage disappearance reaction J. Leukoc. Biol. 57,361-367[Abstract]
  19. Issekutz, A. C., Issekutz, T. B. (1993) Quantitation and kinetics of blood monocyte migration to acute inflammatory reactions, and IL-1 {alpha}, tumor necrosis factor-{alpha}, and IFN-{gamma} J. Immunol. 151,2105-2115[Abstract]
  20. Bakos, E., Evers, R., Sinko, E., Varadi, A., Borst, P., Sarkadi, B. (2000) Interactions of the human multidrug resistance proteins MRP1 and MRP2 with organic anions Mol. Pharmacol. 57,760-768[Abstract/Free Full Text]
  21. Zelcer, N., Saeki, T., Reid, G., Beijnen, J. H., Borst, P. (2001) Characterization of drug transport by the human multidrug resistance protein 3 (ABCC3) J. Biol. Chem. 276,46400-46407[Abstract/Free Full Text]
  22. Gekeler, V., Ise, W., Sanders, K. H., Ulrich, W. R., Beck, J. (1995) The leukotriene LTD4 receptor antagonist MK571 specifically modulates MRP associated multidrug resistance Biochem. Biophys. Res. Commun. 208,345-352[CrossRef][Medline]
  23. Reid, G., Wielinga, P., Zelcer, N., De Haas, M., Van Deemter, L., Wijnholds, J., Balzarini, J., Borst, P. (2003) Characterization of the transport of nucleoside analog drugs by the human multidrug resistance proteins MRP4 and MRP5 Mol. Pharmacol. 63,1094-1103[Abstract/Free Full Text]
  24. De Bittencourt Junior, P. I., Senna, S. M., Vidor, A. C., Miyasaka, C. K., Curi, R., Williams, J. F. (1998) Glutathione metabolism and glutathione S-conjugate export ATPase (MRP1/GS-X pump) activity in cancer. II. Cell-to-cell variability, relation with cellular activation state and functional absence of GS-X pump in lymphocytes Biochem. Mol. Biol. Int. 45,1243-1254[Medline]
  25. Leite, D. F., Echevarria-Lima, J., Calixto, J. B., Rumjanek, V. M. (2007) Multidrug resistance related protein (ABCC1) and its role on nitrite production by the murine macrophage cell line RAW 264.7 Biochem. Pharmacol. 73,665-674[CrossRef][Medline]
  26. Leslie, E. M., Deeley, R. G., Cole, S. P. (2001) Toxicological relevance of the multidrug resistance protein 1, MRP1 (ABCC1) and related transporters Toxicology 167,3-23[CrossRef][Medline]
  27. Kolaczkowska, E. (2002) Shedding light on vascular permeability during peritonitis: role of mast cell histamine versus macrophage cysteinyl leukotrienes Inflamm. Res. 51,519-521[CrossRef][Medline]
  28. Reid, G., Wielinga, P., Zelcer, N., van der Heijden, I., Kuil, A., de Haas, M., Wijnholds, J., Borst, P. (2003) The human multidrug resistance protein MRP4 functions as a prostaglandin efflux transporter and is inhibited by nonsteroidal antiinflammatory drugs Proc. Natl. Acad. Sci. USA 100,9244-9249[Abstract/Free Full Text]
  29. Byrum, R. S., Goulet, J. L., Snouwaert, J. N., Griffiths, R. J., Koller, B. H. (1999) Determination of the contribution of cysteinyl leukotrienes and leukotriene B4 in acute inflammatory responses using 5-lipoxygenase- and leukotriene A4 hydrolase-deficient mice J. Immunol. 163,6810-6819[Abstract/Free Full Text]
  30. Rao, T. S., Currie, J. L., Shaffer, A. F., Isakson, P. C. (1994) In vivo characterization of zymosan-induced mouse peritoneal inflammation J. Pharmacol. Exp. Ther. 269,917-925[Abstract/Free Full Text]
  31. Pawlik, A., Baskiewicz-Masiuk, M., Machalinski, B., Safranow, K., Gawronska-Szklarz, B. (2005) Involvement of P-glycoprotein in the release of cytokines from peripheral blood mononuclear cells treated with methotrexate and dexamethasone J. Pharm. Pharmacol. 57,1421-1425[CrossRef][Medline]
  32. Hamon, Y., Luciani, M. F., Becq, F., Verrier, B., Rubartelli, A., Chimini, G. (1997) Interleukin-1ß secretion is impaired by inhibitors of the ATP binding cassette transporter, ABC1 Blood 90,2911-2915[Abstract/Free Full Text]
  33. Yao, V., McCauley, R., Cooper, D., Platell, C., Hall, J. C. (2004) Zymosan induces nitric oxide production by peritoneal mesothelial cells ANZ J. Surg. 74,266-269[CrossRef][Medline]
  34. Hui, Y., Cheng, Y., Smalera, I., Jian, W., Goldhahn, L., Fitzgerald, G. A., Funk, C. D. (2004) Directed vascular expression of human cysteinyl leukotriene 2 receptor modulates endothelial permeability and systemic blood pressure Circulation 110,3360-3366[Abstract/Free Full Text]
  35. Verbon, A., Leemans, J. C., Weijer, S., Florquin, S., Van Der Poll, T. (2002) Mice lacking the multidrug resistance protein 1 have a transiently impaired immune response during tuberculosis Clin. Exp. Immunol. 130,32-36[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0107042v1
82/3/630    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leite, D. F. P.
Right arrow Articles by Rumjanek, V. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leite, D. F. P.
Right arrow Articles by Rumjanek, V. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS