HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

Published online before print June 22, 2007

This Article Abstract Full Text (PDF) All Versions of this Article: jlb.0207100v1 82/3/509    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Merlo, A. Articles by Balsari, A. Search for Related Content PubMed PubMed Citation Articles by Merlo, A. Articles by Balsari, A.

(Journal of Leukocyte Biology. 2007;82:509-518.)
© 2007 by Society for Leukocyte Biology

Cross-talk between Toll-like receptors 5 and 9 on activation of human immune responses

Andrea Merlo^*,1, Claudia Calcaterra, Sylvie Mènard^* and Andrea Balsari

^* Molecular Targeting Unit, Department of Experimental Oncology, Istituto Nazionale Tumori, Milan, Italy; and
Institute of Pathology, University of Milan, Milan, Italy

¹ Correspondence: Molecular Targeting Unit, Department of Experimental Oncology, Istituto Nazionale Tumori, Via Venezian 1, 20133 Milan, Italy. E-mail: andrea.merlo{at}istitutotumori.mi.it

ABSTRACT

The recognition of pathogen-associated molecular patterns by TLRs triggers the activation of innate and adaptive immune responses. Flagellin, the agonist of TLR5, is expressed by prokaryotes and eukaryotes, and DNA sequences containing unmethylated CpG dinucleotides, agonists of TLR9, are present essentially in prokaryotes. To test the potential modulating effects of simultaneous activation of different TLRs on the immune response, we compared the outcomes in different immune cell compartments induced by triggering TLR5 and TLR9 individually and in combination. PBMCs, monocytes, and monocyte-derived DC (MoDC) secreted high levels of IL-10 in response to flagellin, whereas oligodeoxynucleotides (ODN) containing the CpG sequence (CpG-ODN), synthetic ligands of TLR9, did not induce IL-10 secretion in any of the three cell types but synergized with flagellin in this induction. In contrast, PBMC production of IFN- induced by CpG-ODN was strongly inhibited by flagellin. Conversely, CpG-ODN did not enhance the up-regulation of activation markers in MoDC induced to mature in the presence of flagellin. Flagellin-matured, but not CpG-ODN-matured, MoDC stimulated the expansion of allogeneic CD4⁺CD25⁺ T cells, and the extent of expansion induced by MoDC, matured in the presence of flagellin and CpG-ODN, was similar to that induced by flagellin-matured MoDC. Moreover, flagellin and CpG-ODN differentially affected NK-mediated cytotoxicity, and flagellin completely abrogated the NK-mediated immune response induced by CpG-ODN stimulation. Together, these results suggest that flagellin inhibits the TLR9-induced cell activation and cytokine production, which favor Th1-type immune responses, possibly because the signals evoked by flagellin to indicate the presence of extracellular pathogens must favor a Th2-polarized response. Thus, TLR5 and TLR9, alerted by the presence of microorganisms, influence each other to mount the more efficient and appropriate immune response to contain the infection of a specific pathogen.

Key Words: flagellin • CpG-DNA • ligands

INTRODUCTION

Cells of the immune system have germ-encoded receptor molecules, which enable them to recognize structural components conserved among classes of microorganisms, called pathogen-associated molecular patterns (PAMPs) [¹ ]. This recognition alerts the immune system to the presence of pathogens so that an immediate response can be mounted to contain the infection. Thereafter, the recognition events establish the acquired immunity and provide information regarding the nature of the invading microorganism, helping to determine whether differentiation of Th cells follows a Th1 pathway, which promotes cell-mediated immunity to protect against an intracellular microorganism or a Th2 response, which favors humoral responses to counter extracellular pathogens efficiently.

The ability of the immune system to recognize and respond to microbial components is largely attributed to the TLRs [² ], members of the IL-1R superfamily, which share significant homology in their cytoplasmic regions, e.g., the Toll/IL-1R domain [³ ]. Despite divergent PAMP ligands, all TLRs, with the exception of TLR3 and TLR4, share a common signaling pathway via the adaptor molecule, MyD88 [³ ], and the MyD88-dependent pathway leads to early activation of NF-B and MAPKs and to the transcription of immunologically relevant genes and production of cytokines such as TNF [⁴ ]. TLR4 is unique in that it activates the MyD88-dependent and the MyD88-independent. TLR3 recognizes viral dsRNA and induces inflammatory cytokines such as TNF and IL-6, exclusively through the MyD88-independent. Protozoa, helminths, viruses, bacteria, and fungi can activate TLR signaling, and the ligation of a TLR by its ligand typically results in the stimulation of proinflammatory activity, which can protect the host from microbial invasion. Accumulating evidence [⁵ ] indicates that TLRs can induce distinct responses in different immune cell compartments and that different TLRs are not functionally equivalent, suggesting that different signals might emanate from distinct receptors.

In the present study, we focused on TLR5 and TLR9. TLR5 binds flagellin [⁶ ], the major protein constituent of bacterial flagella, which are involved in bacterial locomotion and critically important for bacterial survival [⁷ ]. Expression of TLR5 on monocytes, dendritic cells (DC), T lymphocytes, NK cells, and epithelial cells provides a strategy for the host to respond to flagellated bacteria. TLR9 recognizes bacterial DNA, which contains a high frequency of unmethylated CpG motifs, but not eukaryotic DNA. Synthetic oligodeoxynucleotides (ODN) containing CpG dinucleotides (CpG-ODN) also act as agonists of TLR9. Expression of TLR9 on human plasmacytoid DC (pDC) and B lymphocytes allows the immune system to distinguish microbial from eukaryotic DNA [⁸ ]. Although TLR5 activation has been reported to favor development of a Th2-polarized response [⁹ ], TLR9 stimulation has been found to bias the immune response to a Th1-like pattern [¹⁰ ]. Here, we analyzed the effects of contemporaneous activation of these two TLRs, using flagellin and CpG-ODN separately and in combination, on different cell immune compartments.

MATERIALS AND METHODS

Antibodies and reagents
The following antibodies were used: anti-CD1a-FITC (HI149), anti-CD3-FITC (UCHT1), anti-CD3-PE (UCHT1), anti-CD3-PerCP (UCHT1), purified anti-CD3 (UCHT1), anti-CD4-PerCP (L3T4), anti-CD8-FITC (HITa), anti-CD14-FITC (M5E2), anti-CD16-FITC (3G8), anti-CD25-PE (M-A251), purified anti-CD28 (CD28.2), anti-CD45RA-FITC (H100), anti-CD56-PE (B159), anti-CD80-FITC (BB1), anti-CD83-FITC (HB15e), anti-CD86-FITC (2331), anti-DR-FITC (G46-6), anti-CD56-PE, anti-IFN--FITC. All of the antibodies were purchased from BD PharMingen (San Diego, CA, USA).

Human IL-4, GM-CSF, and anti-human-IL-10 neutralizing antibody were purchased from PeproTech (Rocky Hill, NJ, USA). The following CpG-containing ODN were used: CpG 2336 (GGGGACGACGTCGTGGGGGGG) and CpG 2006 (TCGTCGTTTTGTCGTTTTGTCGTT). A non-CpG-containing ODN (2243) was used as a control (GGGGGAGCATGCTGGGGGGG). All of the ODN were synthesized under endotoxin-free conditions by Coley-Pharmaceutical Group (Ottawa, Canada). Endotoxin-free, purified flagellin from Salmonella typhimurium was obtained from InvivoGen (San Diego, CA, USA). LPS and brefeldin A were obtained from Sigma-Aldrich (St. Louis, MO, USA).

Almost all of the experiments conducted were performed using CpG-ODN 2336 and CpG-ODN 2006. As no significant differences were observed, only results obtained with the CpG-ODN 2336 are shown.

Preparation, isolation, and culture of cells
All cell isolation kits and microbeads were from Miltenyi Biotec (Bergish Gladbach, Germany) and used according to the manufacturer’s instructions. All cells were maintained in RPMI 1640 supplemented with 10% FCS (v/v; Sigma Chemical Co., St. Louis, MO, USA) and 1% (v/v) L-glutamine (Cambrex Bio Science, Verviers, Belgium), 0.5 mM sodium pyruvate, 0.1 mM MEM nonessential amino acids, and antibiotics.

Human PBMCs were isolated by Ficoll-Paque density gradient centrifugation of buffy coats obtained from healthy volunteers (INT, Milan). CD14⁺ monocytes were selected positively using anti-CD14⁺ microbeads. Monocytes were induced to differentiate to immature monocyte-derived DC (MoDC) in 5- to 6-day culture in RPMI-1640 complete medium supplemented with 50 ng/ml GM-CSF and 50 ng/ml IL-4. Purity of monocytes and MoDC, routinely checked by flow cytometric analysis, was more than 90%. Immature DC were treated for 24 h with flagellin, CPG-ODN, and LPS to induce maturation of MoDC and stained with FITC-conjugated mAb, specific for CD83, CD80, CD86, and MHC Class II antigens.

CD4⁺ T cells and CD8⁺ T cells were purified from PBMCs by negative selection using an untouched CD4⁺ and CD8⁺ T cell isolation kit and by positive selection using anti-CD4⁺ and anti-CD8⁺ microbeads. Purity of CD4⁺ and CD8⁺ T cells was assessed by flow cytometry and was higher than 98%, with no contaminating APC.

Naïve CD4⁺ T cells were isolated from PBMCs using an untouched CD4⁺ T cell isolation kit and by positive selection using anti-CD45RA⁺ microbeads. Purity of naïve CD4⁺T cells was >95% for CD4⁺CD45RA⁺ expression and <0.5% for CD25 bright expression.

NK cells were obtained from PBMCs by negative selection using anti-CD3⁺ microbeads following positive selection on anti-CD56⁺ microbeads. NK purity was higher than 98%.

Dr. Aldo Scarpa (University of Verona, Italy) kindly supplied the GER human pancreatic carcinoma cell line.

In vitro priming of naïve CD4⁺ T cells
Purified CD4⁺CD45RA⁺ T cells were incubated with allogeneic, immature MoDC or flagellin/CpG-ODN-treated MoDC at a 10:1 ratio in 24-well plates in complete medium. As controls, naïve CD4⁺ T cells were cultured in complete medium alone. After 6–7 days, primed T cells were harvested, washed extensively in PBS-5% FCS, and analyzed for their cell surface phenotype.

Flow cytometry analysis
For analysis of surface molecule expression, cells were stained with FITC, PerCP, or PE-conjugated antibody or the appropriate isotype control antibody on ice for 30 min, followed by three washes in PBS/1% BSA and analyzed by flow cytometry (FACSCalibur, BD Biosciences, San Jose, CA, USA). Data were analyzed using CELLQUEST software (BD Biosciences).

Detection of cytokines by ELISA and intracellular staining
IL-10, IL-12 (p40/p70), IL-4, IFN-, and IFN- levels in the cell-free supernatants collected after 18 h of activation were assessed in duplicate using ELISA kits (Biosource, Fleurus, Belgium), according to the manufacturer’s instructions. The kit for IL-12 detection measures "total" IL-12, which includes the p40 monomer, the p40 homodimer, and the p70 heterodimer.

For intracellular cytokine secretion detection, PBMCs were stimulated in the absence or presence of TLR agonists at the indicated dose during 16 h. Brefeldin A (10 µg/ml) was added 4 h after the beginning of the incubation. After incubation, cells were stained with anti-CD56 mAb and anti-CD3 mAb for 20 min at 4°C and fixed using formaldehyde, permeabilized with saponin (0.1% in PBS and 5% FCS), stained with anti-IFN- mAb, and analyzed by flow cytometry. Data analysis was performed using CELLQUEST software (BD Biosciences).

A minimum of 20,000 events was gathered from each sample.

Cytolytic activity
PBMCs and fresh, purified NK cells were incubated overnight in medium alone or supplemented with flagellin and/or CpG-ODN, washed extensively in PBS-5% FCS, and used as effector cells in ⁵¹Cr-release assay. GER cells used as targets were labeled with 100 µl ⁵¹Cr for 1 h at 37°C, washed three times with PBS-5% FCS, and coincubated with PBMCs or purified NK cells at an effectors:target ratio of 50:1 in 200 µl RPMI-1640 medium in triplicate, 96-well, U-bottomed plates for 4 h at 37°C. Radioactivity in the supernatant (80 µl) was measured with a -counter. Percent specific lysis was calculated according to the formula: % specific lysis = 100 x [(experimental cpm–spontaneous cpm)/(maximum cpm–spontaneous cpm)].

Statistical analysis
All analyses were performed using the Student’s paired t-test. Differences were considered significant at P < 0.05.

RESULTS

Human PBMC cytokine secretion in response to stimulation by flagellin, CpG-ODN, or both
IL-4, IL-10, IL-12, IFN-, and IFN- levels were evaluated in supernatants of freshly obtained human PBMCs stimulated with flagellin, CpG-ODN, or both (Fig. 1A ). Flagellin-stimulated PBMCs consistently produced high amounts of IL-10, which exceeded levels of IFN- and IL-12, whereas no IFN-, IL-10, or IL-12 secretion was detectable in supernatants of PBMCs stimulated with CpG; neither flagellin nor CpG-ODN alone induced detectable IL-4 secretion. CpG-ODN induced high amounts IFN-. The combination of CpG-ODN and flagellin increased the secretion of IL-10 and IFN-, with a greater increase in the latter, over that observed with flagellin alone, whereas IL-12 and IFN- production was inhibited; again, no IL-4 was detected. These results indicate that CpG-ODN, although unable to induce secretion of detectable amounts of IL-10 or IFN- alone, can increase the flagellin-induced production of these cytokines and that the costimulation with TLR5/TLR9 ligands inhibited CpG-ODN-induced IFN- production massively.

View larger version (32K): [in this window] [in a new window]   Figure 1. Cytokine production by human PBMCs after treatment with flagellin, CpG-ODN, or both. (A) Human PBMCs from 10 healthy donors were stimulated with flagellin (5 µg/ml), CpG-ODN (5 µg/ml), or both as indicated. IFN-, IL-10, IL-12, IFN-, and IL-4 secretion was measured in the 18-h culture supernatants by ELISA. Data are shown as mean ± SEM of 10 independent experiments. *, P < 0.05. (B) Human PBMCs were cultured for 4 h in medium alone or supplemented with flagellin (5 µg/ml), CpG-ODN (5 µg/ml), or both. Subsequently, brefeldin A (10 µg/ml) was added, and cultures were incubated for an additional 12 h. Cells were harvested, washed, stained with anti-CD56-PE and anti-CD3-PerCP mAb, fixed using formaldehyde, permeabilized with saponin, stained with anti-IFN- FITC mAb, and analyzed by flow cytometry. Data are from one of three independent experiments with superimposable results.

In these and in subsequent experiments of this study, the stimulation and costimulation with a control ODN lacking CpG motifs resulted in neither cytokine secretion nor in activation of treated cells (data not shown).

CpG-ODN-induced increase in secretion of IL-10 by flagellin-stimulated monocytes
Monocytes purified from human PBMCs were stimulated with a different amount of flagellin and CpG-ODN, alone or in combination (Fig. 2A ). Flagellin-stimulated monocytes produced high levels of IL-10 and moderate levels of IL-12, whereas CpG-ODN failed to induce IL-10 or IL-12 secretion directly. Monocytes treated with the combination of flagellin and CpG-ODN showed an increased production of IL-10 but no change in IL-12 secretion. Thus, although CpG-ODN alone does not stimulate monocytes directly, it appears to synergize with flagellin in inducing IL-10 production.

View larger version (26K): [in this window] [in a new window]   Figure 2. Cytokine production by human monocytes and MoDC after treatment with flagellin, CpG-ODN, or both. (A) Human-purified monocytes were treated with flagellin (0.1, 1, 10 µg/ml), CpG-ODN (0.1, 1, 10 µg/ml), or both, and secretion of IL-10 and IL-12 was tested after 18 h in the supernatant by ELISA. Results are expressed as mean ± SEM (n=4). *, P < 0.05. (B) Human MoDC were untreated or stimulated with flagellin (0.1, 1, 10 µg/ml), CpG-ODN (0.1, 1, 10 µg/ml), or both and assessed for IL-10 and IL-12 secretion in the 18-h culture supernatants by ELISA. Results are expressed as mean ± SEM (n=4). *, P < 0.05.

Flow cytometry to assess surface expression of activation and maturation marker, such as CD83, and costimulatory molecules, such as CD80, CD86, and MHC Class II (DR; Fig. 3 ) revealed increased levels of these markers in flagellin-stimulated MoDC but not in CpG-ODN-stimulated MoDC; the concomitant treatment of MoDC with flagellin and CpG-ODN did not further enhance the up-regulation of these molecules over that observed in cells stimulated with flagellin alone. Superimposable expression levels of activation markers were observed stimulating MoDC with flagellin (10 µg/ml) and LPS used as internal positive control.

View larger version (42K): [in this window] [in a new window]   Figure 3. Surface antigen phenotype of MoDC after treatment with flagellin, CpG-ODN, or both. Immature MoDC were stimulated with flagellin (0.1, 1, 10 µg/ml), CpG-ODN (0.1, 1, 10 µg/ml), or both and with LPS (1 µg/ml), used as internal control for 24 h. Surface marker expression was analyzed by FACSCalibur flow cytometry. Data are from one of three independent experiments with superimposable results.

View larger version (36K): [in this window] [in a new window]   Figure 4. Three-color immunophenotyping of human T naive cells cultured in medium alone or with immature MoDC or matured by different stimuli. Purified, naïve CD4+ T cells, after 6 days of culture alone or coculture with MoDC, stimulated or not to mature by exposure to flagellin and CpG-ODN, were harvested and stained with anti-CD4-PerCP, anti-CD25-PE, and CD45RA-FITC mAb. The cells were gathered on the CD4+ T cells, and the percentages of CD4+CD25+ and CD4+CD45RA+CD25+ lymphocytes are indicated. Data are from one of three independent experiments with superimposable results.

View larger version (17K): [in this window] [in a new window]   Figure 5. Cytolytic activity of PMBCs treated with flagellin, CpG-ODN, or both. (A) Human PBMCs were cultured overnight in medium alone or supplemented with flagellin (0.01, 0.1, 1, 10 µg/ml), CpG-ODN (0.01, 0.1, 1, 10 µg/ml), or both. PBMCs were harvested, washed, and analyzed for cytotoxicity against GER cells at an E:T ratio of 50:1 in 51Cr-release assay. Results are expressed as mean ± SEM (n=4). *, P < 0.05. (B) Human PBMCs were cultured overnight in medium alone or supplemented with flagellin (5 µg/ml), CpG-ODN (5 µg/ml), or both. The neutralizing anti-IL10 mAb, added simultaneously with the agonists to the cultures, was used at 10 µg/ml. PBMCs were harvested, washed, and analyzed for cytotoxicity against GER cells at an E:T ratio of 50:1 in 51Cr-release assay. Results are expressed as mean ± SEM (n=6). *, P < 0.05.

CD4⁺ T cells, but not CD8⁺ T cells, are directly sensitive to flagellin
Highly purified CD4⁺ and CD8⁺ T cells stimulated with CpG-ODN and flagellin were evaluated for the release of IL-10, IFN-, and IL-4. Neither TLR agonist alone or in combination induced cytokine release from CD8⁺ T cells. In the CD4⁺ population, CpG-ODN again failed to induce detectable cytokine production, and flagellin-stimulated CD4⁺ T cells produced IFN- (Fig. 6 ) and at lower levels, IL-10 (Fig. 6) . No IL-4 production was detected (data not shown). When CD4⁺ T cells were stimulated with both TLR agonists, the profile of flagellin-induced cytokine production remained essentially unchanged. CD4⁺ and CD8⁺ T cells were also tested for expression of the T cell activation marker CD25 after 48 h treatment with the TLR agonists. Flagellin, but not CpG-ODN, induced up-regulation of CD25 cell surface expression on CD4⁺ T cells (Fig. 7 ), and no detectable up-regulation of CD25 was observed on CD8⁺ T cells, even after treatment of the combination of the two agonists (not shown). CpG-ODN, used in combination with flagellin, did not synergize in up-regulation of CD25 expression. Moreover, flagellin synergized with IL-2, a TCR-independent stimulus, in up-regulating CD25 surface expression on CD4⁺ T cells (Fig. 7) .

View larger version (20K): [in this window] [in a new window]   Figure 6. Cytokine production by human CD4+ and CD8+ T cells after treatment with flagellin, CpG-ODN, or both. Human CD4+ and CD8+ T cells were purified from PBMCs and stimulated with flagellin (5 µg/ml), CpG-ODN (5 µg/ml), or both. IFN-, IL-10, and IL-4 levels in the 18-h supernatants were tested by ELISA. No IL-4 release was observed in supernatant from any donors (not shown). Data are expressed as mean ± SEM (n=4).

View larger version (14K): [in this window] [in a new window]   Figure 7. Expression of activation marker CD25 on purified CD4+ T cells stimulated with flagellin, CpG-ODN, or both in the presence or absence of IL-2. CD25 expression, given as mean fluorescence intensity (MFI), was determined by flow cytometric analysis after 48 h of treatment. Flagellin and CpG-ODN were used at concentrations of 5 µg/ml and IL-2 at 100 U/ml. Data are mean ± SEM of three independent experiments. *, P < 0.05.

View larger version (18K): [in this window] [in a new window]   Figure 8. Cytokine production by human CD4+ T cells after treatment with flagellin, CpG-ODN, or both in the presence or absence of anti-CD3 plus anti-CD28 mAb. Highly purified, human CD4+ T cells were stimulated with flagellin (5 µg/ml), CpG-ODN (5 µg/ml), or both in the presence or absence of immobilized anti-CD3 mAb (1 µg/ml) and soluble anti-CD28 mAb (1 µg/ml). Levels of IFN-, IL-10, and IL-4 were determined by ELISA after 18 h stimulation. Data are mean ± SEM of four independent experiments. *, P < 0.05.

In the present study, we examined the effects of flagellin and CpG-ODN on the activation and modulation of different cell immune compartments.

Flagellin was found to induce secretion of IL-10 at high levels and of IFN- and IL-12 at lower levels in PBMCs, consistent with recent data [¹¹ ]. Intracellular cytokine staining showed that NK cells and T lymphocytes were involved in secreting IFN- in response to flagellin.

CpG-ODN was unable to induce secretion of these cytokines, but it induced production of a high level of IFN-, synergized with flagellin in stimulating IFN- and IL-10 secretion and inhibited flagellin-induced IL-12 secretion. Flagellin inhibited CpG-ODN-induced IFN- production and alone or in combination with CpG-ODN, was not able to mediate production of IL-4. Using surface markers and intracellular cytokine staining, we identified NK cells and T lymphocytes as the cell populations secreting IFN- in response to flagellin with a higher percentage of IFN--positive cells in the NK cell subset. We found an increase of the percentage of the cells secreting IFN- in NK cells and in T lymphocytes during the TLR5/TLR9 costimulation compared with TLR5 mono-stimulation.

Human monocytes were found to be sensitive to flagellin stimulation, consistent with previous studies demonstrating TLR5 expression in human monocytes by Northern blot and RT-PCR analysis [¹² ]. Indeed, when purified monocytes were stimulated with flagellin, robust production of IL-10 and to a lesser extent, of IL-12 was observed. It is interesting that CpG-ODN did not activate monocytes directly but synergized with flagellin in stimulating IL-10 secretion. Because of their high frequency (4–6% of blood leukocytes), monocytes represent a major source of cytokines, which modulate innate and adaptive immune responses. Thus, monocytes are the likely, primary source of the massive IL-10 production observed for PBMCs in response to flagellin. Like monocytes, MoDC showed no detectable response when cultured with CpG-ODN alone but were activated consistently by flagellin, as indicated by secretion of cytokines, CpG-ODN, and flagellin, also synergized in their induction of IL-10 secretion by MoDC. The combination of CpG-ODN and flagellin inhibited the IL-12 secretion in PBMCs compared with flagellin mono-stimulation, and we observed the lack of this inhibition in monocytes and MoDC. This phenomenon led us to the hypothesis that TLR5 and TLR9 triggering provides different cytokine interactions in the whole PBMCs compared with purified monocytes and MoDC, suggesting that PBMCs, monocytes, and MoDC react differentially to TLR5/TLR9 costimulation, depending on the cytokine milieu they encounter. DC maturation involves enhanced expression of MHC Class II and costimulatory molecules such as CD83, CD80, and CD86 [¹³ ]. Flagellin induced up-regulation of these molecules on MoDC, consistent with previous results [¹² ], but CpG-ODN did not synergize with flagellin in this up-regulation. Thus, CpG-ODN failed to enhance the up-regulation of activation and maturation markers in MoDC treated with the two agonists but synergized with flagellin in inducing IL-10 secretion. Among human DC subsets, so far, only the pDC are known to be activated directly by CpG-ODN. Here, we show that concomitant challenge with flagellin and CpG-ODN stimulates IL-10 secretion by MoDC synergistically.

As DC are key effectors in host innate immunity and orchestrate the adaptive immune response, we analyzed the effect of the two TLR agonists on human DC-mediated T cell activation, as reflected in the ability of MoDC to induce expansion of allogenic CD4⁺CD25⁺ T cells from naïve T cells. Our results demonstrated that flagellin-matured MoDC, but not CpG-ODN-matured MoDC, stimulated expansion of CD4⁺CD25⁺ T cells and that the use of flagellin together with CpG-ODN as maturational stimuli did not increase the MoDC-induced expansion of this T cell subset as compared with that observed after flagellin stimulation only.

Based on the reported ability of CpG-ODN to activate NK cells [¹⁴ ], we investigated the effect of flagellin and CpG-ODN alone or in combination on NK activation. Whereas neither flagellin nor CpG-ODN nor the combination of the two agonists activated purified NK cells, CpG-ODN stimulated high NK cell lytic activity in unseparated PBMCs, which was nonetheless decreased significantly when flagellin was also present. The neutralizing anti-IL-10 mAb added to the cultures was unable to restore the compromised cytotoxicity mediated by flagellin. Thus, the TLR5 agonist flagellin appears to revert the enhancement of NK cell cytotoxicity cells induced by the TLR9 agonist CpG-ODN in an IL-10-independent manner. The increased NK cell activation in PBMCs treated with CpG-ODN could be mediated by IFN-, as high amounts of this cytokine were detected in PBMC supernatants treated with CpG-ODN. The release of IFN- was decreased strongly in the presence of flagellin, suggesting that this PAMP agonist could abrogate CpG-ODN-NK cell activation through suppression of IFN- production.

Recent results have suggested that CD4⁺ cells are stimulated directly via TLR5 [¹⁵ ]. Indeed, our present data show that flagellin-stimulated CD4⁺ T cells produce IFN- and at lower levels, IL-10, as shown previously [¹⁶ ], but that neither CD4⁺ nor CD8⁺ T cells exhibit any direct response to the TLR9 ligand CpG-ODN. We also demonstrated that flagellin is able to up-regulate expression of CD25 on CD4⁺ T cells after 48 h of treatment. Thus, CD4⁺ T cells were activated directly in the absence of APC by flagellin. Moreover, flagellin synergized with anti-CD3 and anti-CD28 mAb in stimulating IL-10 and IFN- secretion and with IL-2 in up-regulating CD25 expression. The further exposure of CD4⁺ T cells to CpG-ODN did not synergize with flagellin plus anti-CD3 and anti-CD28 mAb treatment in IL-10 and IFN- production. Our results are in agreement with data of Caron and colleagues [¹⁶ ], who observed that the production of cytokines and cell proliferation was enhancement in the presence of suboptimal concentrations of anti-CD3 mAb, anti-CD2 mAb, and IL-2.

In this study, we found that unseparated PBMCs, monocytes, and MoDC preferentially produce IL-10 as compared with IL-12 in response to flagellin stimulation. The orchestrated interplay of pro- and anti-inflammatory cytokines is crucial for an effective host defense and for limiting tissue damage. A potential danger is posed by excessive, proinflammatory signaling, and TLR5 seems particularly at risk for this potential, as it is expressed on epithelial cells in general and on intestinal epithelium in particular, where cells normally exist amidst a large population of commensal bacteria, including flagellated bacteria [¹⁷ ]. The anti-inflammatory cytokine IL-10 can modulate the outcome of sepsis, and its expression levels have been shown to be a valid indicator of the severity of sepsis, and increased levels associate with septic shock [¹⁸ ]. In addition, it has been shown that DC-derived IL-10 is required for proper development of T regulatory cells (Treg) involved in the regulation of effector T lymphocytes [¹⁹ ]. Thus, IL-10 secreted after TLR5 and TLR9 ligation might modulate the adaptive response through stimulation of Treg functions. TLR5 and TLR9 seem to play an important role in mediating gut inflammation associated with infection by enteric pathogens and in inflammatory bowel disease.

Human monocytes and MoDC reportedly do not express TLR9 and are not activated by CpG-ODN [²⁰ ]. Nevertheless, our data indicate that CpG-ODN is able to affect the cytokine secretion induced by flagellin in these cells. In addition, CpG-ODN enhances the natural cytotoxicity of NK cells greatly in the presence of APC, and flagellin reverses this enhancement completely. Thus, depending on the type of infection, the immune system mounts a cell-mediated response needed to eradicate infections with intracellular microorganisms or a humoral immune response to fight extracellular pathogens. We speculate that the immune system response to extracellular pathogen infection, as indicated by the presence of flagellin, is skewed toward a Type 2 pathway, whereas a Type 1 immune response ensues when the CpG motifs present in extracellular and intracellular DNA pathogens are detected; however, when flagellin alerts the immune system to the presence of an extracellular pathogen, CpG cooperates with flagellin in tailoring the appropriate immune response to these types of microorganisms. The outcome of the immune response will reflect the sum of the TLRs, which are stimulated.

ACKNOWLEDGEMENTS

This work was supported by Associazione Italiana per la Ricerca sul Cancro.

Received February 9, 2007; revised May 31, 2007; accepted May 31, 2007.

REFERENCES

1. Medzhitov, R., Janeway, C. A., Jr (2000) How does the immune system distinguish self from nonself? Semin. Immunol. 12,185-188[CrossRef][Medline]
2. Medzhitov, R., Preston-Hurlburt, P., Janeway, C. A., Jr (1997) A human homologue of the Drosophila Toll protein signals activation of adaptive immunity Nature 388,394-397[CrossRef][Medline]
3. Hemmi, H., Kaisho, T., Takeuchi, O., Sato, S., Sanjo, H., Hoshino, K., Horiuchi, T., Tomizawa, H., Takeda, K., Akira, S. (2002) Small anti-viral compounds activate immune cells via the TLR7 MyD88-dependent signaling pathway Nat. Immunol. 3,196-200[CrossRef][Medline]
4. Akira, S., Hemmi, H. (2003) Recognition of pathogen-associated molecular patterns by TLR family Immunol. Lett. 85,85-95[CrossRef][Medline]
5. Re, F., Strominger, J. L. (2001) Toll-like receptor 2 (TLR2) and TLR4 differentially activate human dendritic cells J. Biol. Chem. 276,37692-37699[Abstract/Free Full Text]
6. Hayashi, F., Smith, K. D., Ozinsky, A., Hawn, T. R., Yi, E. C., Goodlett, D. R., Eng, J. K., Akira, S., Underhill, D. M., Aderem, A. (2001) The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5 Nature 410,1099-1103[CrossRef][Medline]
7. Macnab, R. M. (1992) Genetics and biogenesis of bacterial flagella Annu. Rev. Genet. 26,131-158[CrossRef][Medline]
8. Krieg, A. M. (2002) CpG motifs in bacterial DNA and their immune effects Annu. Rev. Immunol. 20,709-760[CrossRef][Medline]
9. Marshall, N. A., Christie, L. E., Munro, L. R., Culligan, D. J., Johnston, P. W., Barker, R. N., Vickers, M. A. (2004) Immunosuppressive regulatory T cells are abundant in the reactive lymphocytes of Hodgkin lymphoma Blood 103,1755-1762[Abstract/Free Full Text]
10. Davis, H. L., Weeratna, R., Waldschmidt, T. J., Tygrett, L., Schorr, J., Krieg, A. M. (1998) CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen J. Immunol. 160,870-876[Abstract/Free Full Text]
11. Bachmann, M., Horn, K., Poleganov, M. A., Paulukat, J., Nold, M., Pfeilschifter, J., Muhl, H. (2006) Interleukin-18 secretion and Th1-like cytokine responses in human peripheral blood mononuclear cells under the influence of the Toll-like receptor-5 ligand flagellin Cell. Microbiol. 8,289-300[CrossRef][Medline]
12. Means, T. K., Hayashi, F., Smith, K. D., Aderem, A., Luster, A. D. (2003) The Toll-like receptor 5 stimulus bacterial flagellin induces maturation and chemokine production in human dendritic cells J. Immunol. 170,5165-5175[Abstract/Free Full Text]
13. Banchereau, J., Briere, F., Caux, C., Davoust, J., Lebecque, S., Liu, Y. J., Pulendran, B., Palucka, K. (2000) Immunobiology of dendritic cells Annu. Rev. Immunol. 18,767-811[CrossRef][Medline]
14. Sivori, S., Carlomagno, S., Moretta, L., Moretta, A. (2006) Comparison of different CpG oligodeoxynucleotide classes for their capability to stimulate human NK cells Eur. J. Immunol. 36,961-967[CrossRef][Medline]
15. Crellin, N. K., Garcia, R. V., Hadisfar, O., Allan, S. E., Steiner, T. S., Levings, M. K. (2005) Human CD4+ T cells express TLR5 and its ligand flagellin enhances the suppressive capacity and expression of FOXP3 in CD4+CD25+ T regulatory cells J. Immunol. 175,8051-8059[Abstract/Free Full Text]
16. Caron, G., Duluc, D., Fremaux, I., Jeannin, P., David, C., Gascan, H., Delneste, Y. (2005) Direct stimulation of human T cells via TLR5 and TLR7/8: flagellin and R-848 up-regulate proliferation and IFN- production by memory CD4+ T cells J. Immunol. 175,1551-1557[Abstract/Free Full Text]
17. Gewirtz, A. T., Navas, T. A., Lyons, S., Godowski, P. J., Madara, J. L. (2001) Cutting edge: bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression J. Immunol. 167,1882-1885[Abstract/Free Full Text]
18. Marchant, A., Deviere, J., Byl, B., De Groote, D., Vincent, J. L., Goldman, M. (1994) Interleukin-10 production during septicaemia Lancet 343,707-708[CrossRef][Medline]
19. Montagnoli, C., Bacci, A., Bozza, S., Gaziano, R., Mosci, P., Sharpe, A. H., Romani, L. (2002) B7/CD28-dependent CD4+CD25+ regulatory T cells are essential components of the memory-protective immunity to Candida albicans J. Immunol. 169,6298-6308[Abstract/Free Full Text]
20. Kadowaki, N., Ho, S., Antonenko, S., Malefyt, R. W., Kastelein, R. A., Bazan, F., Liu, Y. J. (2001) Subsets of human dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens J. Exp. Med. 194,863-869[Abstract/Free Full Text]

This article has been cited by other articles:

				E Rodriguez, J Guevara, A Paez, E Zapata, M. Collados, T. Fortoul, R Lopez-Marure, F Masso, and L. Montano The altered expression of inflammation-related molecules and secretion of IL-6 and IL-8 by HUVEC from newborns with maternal inactive systemic lupus erythematosus is modified by estrogens Lupus, December 1, 2008; 17(12): 1086 - 1095. [Abstract] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: jlb.0207100v1 82/3/509    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Merlo, A. Articles by Balsari, A. Search for Related Content PubMed PubMed Citation Articles by Merlo, A. Articles by Balsari, A.