Published online before print May 18, 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
B activity is required for Stat6 DNA binding
,
,
,


,

,
,
,1
Departments of Pediatrics and
* Microbiology and Immunology,
Wells Center for Pediatric Research and
Walther Oncology Center, Indiana University School of Medicine, and the Walther Cancer Institute, Indianapolis, Indiana, USA
1 Correspondence: Department of Pediatrics and Microbiology and Immunology, Wells Center for Pediatric Research, 702 Barnhill Drive, RI 2600, Indiana University School of Medicine, Indianapolis, IN 46202, USA. E-mail: mkaplan2{at}iupui.edu
|
|
|---|
B p100 processing to NF-
B p52 in B cells but not in T cells or macrophages. IL-4 induced NF-
B p52 production requires PI-3K activity and correlates with I
B kinase phosphorylation and TNF receptor-associated factor 3 degradation. Blocking NF-
B activity eliminates IL-4-stimulated gene expression in B cells by reducing IL-4-induced DNA binding but not phosphorylation or nuclear localization of Stat6. These results describe a novel role for NF-
B in IL-4-induced signaling and gene expression.
Key Words: cytokines gene regulation transcription factors p100 processing
|
|
|---|
IL-4 stimulates several intracellular signaling pathways including the recruitment of Stat6 to the IL-4R
, where it is phosphorylated on tyrosine 641 by Jak kinases [1
, 3
]. The phosphorylated Stat6 (p-Stat6) forms dimers and translocates to the nucleus to bind DNA and activate transcription [13
14
15
]. IL-4 is unable to promote isotype switching or induce gene expression in Stat6-deficient B cells, demonstrating the requirement for Stat6 in IL-4 responses [16
17
18
]. IL-4 also stimulates the recruitment of insulin substrate-2 to the IL-4R
and the activation of PI-3K and its downstream target Akt, although the roles of these pathways in IL-4-induced gene expression are still unclear [19
20
21
].
Like the Jak-STAT pathway, NF-
B is activated by ligand triggering of surface receptors. In resting cells, NF-
B dimers are sequestered in the cytoplasm by a family of I
B inhibitors. NF-
B activation can be classified into two major pathways: the canonical and noncanonical NF-
B pathways, which are distinguished by inducible I
B degradation and p100 processing to p52, respectively [22
, 23
]. The canonical NF-
B pathway is induced rapidly and transiently by mitogens, cytokines, and microbial components, which activate the I
B kinase (IKK) complex, phosphorylating I
B molecules on serine residues and resulting in ubiquitination and proteosome-mediated degradation [24
, 25
]. Activation of the noncanonical NF-
B pathway only occurs in response to a restricted set of factors including lymphotoxin β, B cell-activating factor (BAFF), and CD40 ligand (CD40L) [26
27
28
29
30
31
32
]. These stimulants activate the NF-
B-inducible kinase, which is required for the phosphorylation and activation of IKK
[33
34
35
36
]. Once activated, IKK
phosphorylates serine residues on p100, leading to processing of the inhibitory domain [36
37
38
]. The degradation of these I
B inhibitors frees NF-
B to enter the nucleus, binds DNA, and induces transcription of target genes [22
, 39
]. Whether IL-4 stimulates NF-
B activation in primary cells has not been examined carefully.
Although IL-4 induces gene expression in B cells, the detailed molecular requirements remain unknown. In this study, we demonstrate that IL-4 induces RelB/p52-binding activity through a PI-3K-dependent pathway. Moreover, NF-
B activity is required for IL-4-induced MHCII and CD86 expression by increasing the ability of Stat6 to bind DNA. Thus, Stat6 and NF-
B activities downstream of IL-4 signaling are required for gene induction in B cells.
|
|
|---|
Inhibitors and antibodies
The source of reagents is as follows; PI-3K inhibitor LY294002, IKK-2 inhibitor IV, NF-
B inhibitor parthenolide, and anti-actin (Calbiochem, San Diego, CA, USA); wortmannin (Sigma Chemical Co., St. Louis, MO, USA); PE- or FITC-conjugated anti-CD45R, anti-MHCII, or anti-CD86 (eBiosciences, San Diego, CA, USA); anti-p-I
B
and anti-I
B
(Cell Signaling Technology, Danvers, MA, USA); anti-RelB, anti-RelA, anti-p50, anti-p52, anti-cRel, anti-TNF receptor (TNFR)-associated factor 3 (Traf3), and anti-p-IKK
/β (Santa Cruz Biotechnology, Santa Cruz, CA, USA); anti-poly (ADP-ribose) polymerase (Parp; BD PharMingen, San Diego, CA, USA); anti-p-Stat6 (Imgenex, San Diego, CA, USA); and anti-Stat6 (BD Transduction Laboratories, Lexington, KY, USA).
Transient transfection and luciferase assay
To test E
promoter activity, 4 x 105 M12.4.1 cells were transfected using Lipofectamine or Lipofectamine plus reagents (Life Technologies, Gaithersburg, MD, USA) using 1 µg reporter vector. The cells were then left in culture or stimulated with 1 µg anti-CD40 or 10 ng IL-4 for 22 h. The cells were then lysed, and luciferase assays were performed.
Isolation of B cell and macrophage populations
Spleens were dispersed into a single-cell suspension, which was treated with RBC lysis solution (Sigma Chemical Co.) for 5 min. The remaining cells were washed in supplemented RPMI 1640 as described previously [40
]. B220+ splenocytes were purified with rat anti-mouse B220 microbeads (Miltenyi Biotec, Auburn, CA, USA), according to the manufacturers protocol. The purity of selected cells was greater than 95%, as analyzed by flow cytometry (FACScan, Becton Dickinson, Franklin Lakes, NJ, USA).
Bone marrow-derived macrophages (BMDM) were derived from BM precursors, which were harvested from femur marrow of mice. Collected cells were cultured in bacterial-grade dishes with complete DMEM (Life Technologies) containing 10% heat-inactivated FBS and 20% heat-inactivated horse serum (Life Technologies) and supplemented as above. After 24 h of culture, M-CSF (Peprotech, Rocky Hill, NJ, USA) was added at 10 ng/ml, and the cells were incubated for another 7 days. At the end of the culture period, nonadherent cells were removed, and the remaining cells were used as BMDM for further experiments. The remaining adherent cells were 97% positive for macrophage surface marker CD11b by flow cytometry. For isolation of peritoneal macrophages, the peritoneal cavity was washed with 5 ml complete DMEM. The cells were then cultured for 2 h, and nonadherent cells were removed. The remaining cells were 97% CD11b+ by flow cytometry and used for further experiments.
EMSA
Nuclear extracts from unactivated or activated, purified B220+ cells were prepared using the Nuclear and Cytoplasmic Extraction Kit (Pierce Biotechnology, Rockford, IL, USA). EMSA was performed by incubating 5 µg of the nuclear extract with binding buffer (Promega, Madison, WI, USA) and the 32P-labeled probe at room temperature for 20 min (Promega). Samples were loaded onto a 4% nondenaturing polyacrylamide gel and electrophoresed in Tris borate-EDTA (TBE). Gels were dried for 1 h and visualized by autoradiography. Probes for EMSA were end-labeled with [
-32P]ATP (PerkinElmer, Wellesley, MA, USA) and T4 polynucleotide kinase (Promega), according to a protocol adapted from Promega. Briefly, 3.5 pmol probe was incubated with T4 polynucleotide kinase buffer, 10 units T4 polynucleotide kinase, and 10 µCi [
-32P]ATP at 37°C for 10 min. The reaction was stopped by adding 0.5 M EDTA and Tris-EDTA (TE) buffer. Unincorporated [
-32P]ATP was removed using a G-25 spin column equilibrated in TE buffer (Roche, Indianapolis, IN, USA).
Western blot
For Western blot analysis, nuclear and cytoplasmic extracts were separated on 4–12% gradient SDS-PAGE gel (Life Technologies) and transferred onto a Nytran membrane (Schleicher and Schuell BioSciences, Keene, NH, USA). The blots were blocked in 5% dry nonfat milk in TBST for 1 h, probed with the indicated antibodies, and detected with Western Lightning Chemiluminescence Reagent Plus (PerkinElmer).
DNA oligonucleotide affinity purification assay (DAPA)
B220+ B cells were treated with the indicated stimulus, and total cell extracts were isolated. Biotinylated Stat6 consensus sequence oligonucleotide (TGTAATTCGTGTGAATTATG) coupled to streptavidin beads or a NF-
B consensus oligonucleotide conjugated to beads (Santa Cruz Biotechnology) was incubated with 500 µg total cell extract overnight at 4°C. The complex was washed with lysis buffer, separated on SDS-PAGE gel, transferred to Nytran membrane, and Western blotted for the indicated proteins.
Surface staining and flow cytometry
Purified, splenic B220+ cells, peritoneal macrophages, or BMDM at 1–4 x 106 cells/ml were left untreated or treated with 5 µM parthenolide at 37°C for 2 h. The cells were then stimulated with 10 ng/ml IL-4 (Peprotech) or 2 µg/ml anti-CD40 Clone 3/23 (BD PharMingen) for 24 h. Cells were washed and stained in PBS with 2% BSA and 0.1% NaN3 (FACS buffer). Cells were first incubated with anti-Fc
R antibodies Clone 2.4G2 (BD PharMingen) for 10 min. Samples were then stained with antibodies conjugated directly to FITC or PE MHCII, and CD86 was incubated for 15 min at 4°C. Cells were then washed, fixed, and analyzed by flow cytometry using a FACScalibur (Becton Dickinson). Results were analyzed by WinMDI.
Analysis of gene expression
Purified B220+ cells were stimulated with IL-4 for the indicated times, and total RNA was isolated with TRIzol reagent (Life Technologies). RT reactions were done using the SuperScript First-Strand cDNA synthesis system (Life Technologies). Quantitative RT-PCR (qRT-PCR) was performed by the comparative threshold cycle method and normalized to GAPDH or β2-microglobulin. The primers used were: for GAPDH, 5'-CCAGGTTGTCTCCTGCGACT-3' and 5'-ATACCAGGAAATGAGCTTGACAAAGT-3'; for E
, 5'-TGTGTAGAACGCCGACAAG-3' and 5'-TCCGCTGAGATGAACAACTG-3'; and for A
, 5-CTGTCTGGATGCTTCCTGAGTTT-3' and 5'-AGCTATGTTTTGCAGTCCACC-3'. Semi-qRT-PCR was done for Aβ and normalized to GAPDH. The primers used for Aβ were 5'-TACATCTACAACCGGGAGGAGTACG-3'and 5'-ATTCCTGAACCAGGCACTTTGATC-3'. Taqman primers for CD86 and β2-microglobulin were from Applied Biosystems (Foster City, CA, USA).
|
|
|---|
, Aβ, E
, and CD86 mRNA (Fig. 1B)
. To confirm that IL-4 induced transcriptional activation, we tested reporter activity in M12.4.1 B cells transfected with an E
promoter. As shown in Figure 1C
, luciferase activity was enhanced four-fold and two-fold upon anti-CD40 or IL-4 treatment, respectively. Collectively, these data demonstrate that IL-4 induces gene expression of MHCII structural genes and CD86.
![]() View larger version (17K): [in a new window] |
Figure 1. IL-4 induces MHCII and CD86 expression in primary B cells. (A) Splenic B cells, splenic macrophages, peritoneal macrophages, or BMDM were left untreated or treated with 10 ng/ml IL-4 for 22 h. Cells were stained with PE-anti-MHCII or PE-anti-CD86. Splenic B cells and macrophages were also stained for B220 and CD11b, respectively. Surface expression of MHCII or CD86 was then analyzed by flow cytometry. (B) Purified B220+ cells were treated with 10 ng/ml IL-4 for the indicated times. RNA was isolated and analyzed for A , Aβ, E , or CD86 by real-time RT-PCR (A , E , and CD86) or qRT-PCR (Aβ). The results were normalized to GAPDH or β2-microglobulin (CD86) and are represented as percent of expression in unactivated cells. (C) M12.4.1 B cells were transiently transfected with a luciferase reporter driven by the E promoter, followed by stimulation with media, anti-CD40, or IL-4. Luciferase activity was determined and normalized over protein concentration. All transfection experiments were performed in triplicates. Values are expressed as the mean with SD of two independent experiments.
|
B activity in B cells
B-binding activity from B cells examined directly ex vivo, compared with B cells from wild-type mice (Fig. 2A
). This was dependent on the presence of endogenous IL-4, as B cells from Il4–/– Stat6VT transgenic mice did not have elevated NF-
B-binding activity (Fig. 2A)
.
![]() View larger version (22K): [in a new window] |
Figure 2. IL-4 induces NF- B activity specifically in primary mouse B cells. (A) B220+ B cells were purified from wild-type (WT), Stat6VT transgenic (Tg), IL-4 knockout (KO), and IL-4KO Stat6VT Tg (TgKO) mice. Nuclear extracts were prepared, and NF- B DNA-binding activity was determined by EMSA using NF- B consensus-binding sequences. PARP was used as a loading control. (B) Purified B220+ B cells, CD4+ T cells, or BMDM were treated with IL-4 for 4 h. NF- B EMSA was performed from nuclear extracts as in A. (C) Purified B220+ cells were treated with 10 ng/ml IL-4 for the indicated time. Nuclear extract was isolated, and NF- B EMSA was performed. The numbers below the blot represent the fold induction of NF- B binding to DNA normalizing over loading control compared with unactivated cells from two to three independent experiments with SD.
|
B activity in B cells. To test this directly, we treated primary mouse B220+ B cells with IL-4 for 4 h, and nuclear extracts were analyzed by EMSA. IL-4 increased total NF-
B activity in stimulated B cells compared with unstimulated B cells (Fig. 2B)
. IL-4-induced NF-
B activity in B cells was observed at 2 h after IL-4 exposure, peaked at 4 h, and decreased to basal level by 22 h (Fig. 2C)
. As IL-4 stimulates T cell and macrophage function, we wanted to determine if IL-4-induced NF-
B activity is cell type-specific or a general feature of IL-4 signaling. IL-4 did not induce NF-
B activity in CD4+ T cells or BMDM (Fig. 2B)
. The cell type-specific activation of NF-
B by IL-4 correlates with the ability of IL-4 to induce MHCII and CD86 (Fig. 1A)
.
IL-4 preferentially induces NF-
B p100 processing in B cells
To define the NF-
B pathway activated by IL-4, cytoplasmic and nuclear extracts from unactivated or
-CD40- or IL-4-activated B cells were analyzed by Western blot for molecules, which are part of the NF-
B canonical or noncanonical pathways. Phosphorylation of I
B
and its degradation is a hallmark for the NF-
B canonical pathway, and p100 processing to p52 is a characteristic of the noncanonical pathway [42
]. As shown in Figures 3A
and 3B
, and consistent with previous reports, anti-CD40 stimulation induced I
B
phosphorylation and degradation, as well as increasing NF-
B p52 levels [31
, 32
]. IL-4 stimulation did not have any effect on the phosphorylation or degradation of I
B
but did induce p52 and RelB levels in the nucleus (Fig. 3A
and 3B)
. Although CD40 stimulation decreased p100 levels in the cytoplasm, IL-4 stimulation did not affect p100 levels significantly (Fig. 3A
and 3B)
. The maintenance of p100 levels following IL-4 stimulation could be a result of a modest, IL-4-induced increase in p100 transcript (data not shown). To examine kinetic induction of specific NF-
B proteins, we measured the level of nuclear p52 and the p52-binding partner RelB following IL-4 induction. We observed an increase in nuclear p52 and RelB at 2 h after IL-4 stimulation, with levels falling gradually thereafter (Fig. 3C)
. The increase of nuclear p52 and RelB upon IL-4 is specific, as the same stimulation had minimal effect on the nuclear localization of RelA, p50, or c-Rel to the nucleus. To further confirm the ability of IL-4 to trigger the NF-
B noncanonical pathway in B cells, we performed a NF-
B consensus DAPA with whole cell extracts prepared from B cells cultured with anti-CD40, IL-4, or in the absence of stimulation. DNA-binding complexes were separated on SDS-PAGE gels and analyzed by Western blot for the levels of NF-
B factors, including p52 and RelB. As seen in Figure 3D
,
-CD40 treatment led to enhanced RelB and p52 binding to the NF-
B consensus oligonucleotides. IL-4 stimulation also resulted in increased RelB and p52 binding. In contrast, BMDM stimulated with IL-4 led to phosphorylation of Stat6 but no induction of nuclear RelB (Fig. 3E)
. There was no detectable nuclear p52 in basal or stimulated conditions, and LPS induced I
B degradation and RelA nuclear localization (Fig. 3E
and data not shown). Thus, IL-4 stimulation in B cells can induce the noncanonical NF-
B pathway to generate a p52/RelB DNA-binding complex.
![]() View larger version (19K): [in a new window] |
Figure 3. IL-4 preferentially induces the noncanonical NF- B signaling pathway in B cells. (A) Purified B220+ B cells were left untreated or treated with 2 µg/ml -CD40 or 10 ng/ml IL-4 for 4 h. Cytoplasmic (left) and nuclear (right) extracts were Western blotted for the indicated proteins. ns, Nonspecific. (B) Band intensities from A were quantified by densitometry, normalized over loading control, and presented as fold induction over media-treated B cells with SD. Data presented were from three independent experiments. (C) Nuclear extract isolated from IL-4-activated B220+ B cells at the indicated time was Western blotted for RelB, p52, RelA, p50, or c-Rel. Extract was also blotted for PARP protein as a loading control. Fold induction represents the band intensities normalizing over PARP and expressed relative to unactivated cells. Data were from three independent experiments with SD. (D) Total cell lysates were used for DAPA with consensus NF- B-binding oligonucleotides and immunoblotted for p52 and RelB. Actin was used as input control for binding assays. The numbers below the blot represent the fold induction of NF- B binding to DNA normalizing over loading control compared with unstimulated cells from two to three independent experiments with SD. (E) Cytoplasmic and nuclear extracts were prepared from unactivated or LPS- or IL-4-treated BMDM and Western blotted for the indicated proteins.
|
B pathway through TNFR involve activation of IKK
and -β by phosphorylation and degradation of Traf3 [37
, 38
, 43
]. We first tested levels of p-IKK following IL-4 stimulation using immunoblot. IL-4 induced IKK
and IKKβ phosphorylation, reaching maximal levels at 2–4 h (Fig. 4A
). We then asked whether Traf3 levels are affected upon IL-4 treatment. Levels of Traf3 were decreased
50% by 2 h following treatment of B cells with IL-4, similar to what is observed in CD40-stimulated B cells [43
]. Thus, IL-4 stimulates activation of the IKK complex and degradation of Traf3 with kinetics, which mirror the time course of p100 processing.
![]() View larger version (20K): [in a new window] |
Figure 4. NF- B p100 processing to NF- B p52 by IL-4 is associated with IKK /β activity and Traf3 degradation. Purified B220+ cells were treated with 10 ng/ml IL-4 for the indicated times. Total cell extracts were prepared and immunoblotted for pIKK /β (A) or Traf3 (B). The blot was stripped and reprobed for actin as loading control. The numbers below the blot represent the band intensities of Traf3, which were normalized to actin and expressed as arbitrary units. Data are representative of two to three independent experiments.
|
B activation, we pretreated B cells with the PI-3K inhibitors LY294002 or wortmannin prior to IL-4 treatment. Corresponding with a decrease in IL-4-induced p52 nuclear protein and DNA-binding activity (Fig. 5A
and 5C
), inhibiting PI-3K activity diminished the ability of IL-4 to induce MHCII or CD86 expression (Fig. 5D
and 5E)
. In contrast, PI-3K activity was not required for IL-4-induced Stat6 phosphorylation (Fig. 5A
and 5B)
. To confirm the role of PI-3K in IL-4-induced MHCII or CD86 expression in a genetic model, we examined IL-4 responses in mice deficient in the PI-3K p85
subunit. Consistent with the overlapping function of several PI-3K
subunits, IL-4 induced MHC II, and CD86 expression was decreased partially in B cells lacking expression of p85
(Fig. 5F)
. These results suggest that PI-3K is required for IL-4-induced NF-
B activity and gene expression.
![]() View larger version (19K): [in a new window] |
Figure 5. Induction of p100 processing to p52 upon IL-4 treatment requires PI-3K activity. (A) Purified B220+ cells were cultured in the presence or absence of IL-4, with or without 50 µM LY294002 for 4 h. Nuclear extracts were prepared and Western blotted for the indicated proteins. (B) Purified B220+ cells were cultured in the presence or absence of IL-4, with or without the addition of wortmannin or IKK-2 inhibitor IV for 4 h. Whole cell extracts were immunoblotted for p- and total Stat6. (C) NF- B DAPA was performed for the control, IKK-2 inhibitor IV, and wortmannin-treated samples in B and Western blotted for p52. (D) Purified B220+ B cells were pretreated with DMSO or 50 µM LY294002 for 1 h. IL-4 was added to the cell culture for 22 h, and surface expression of MHCII and CD86 was detected as described previously. (E) Purified B220+ B cells were pretreated with DMSO, 50 µM LY294002 (Ly), or 100 nM wortmannin (Wort) for 1 h. IL-4 was then added to the culture for 22 h, and surface expression of MHCII and CD86 was detected. Graphs represent the average fold induction (IL-4-stimulated/unstimulated) of mean fluorescence intensity (MFI) from two independent experiments with SD. (F) B220+ B cells from wild-type or p85 –/– mice were treated with 10 ng/ml IL-4 for 22 h, and surface expression of MHCII or CD86 was performed. The number represents the MFI of the cells. Data are representative of two to three independent experiments.
|
B activity is required for MHCII and CD86 expression in B cells
B pathway, parthenolide, or IKK-2 inhibitor would also block IL-4-induced gene expression. Treatment with parthenolide, an inhibitor of NF-
B, inhibited NF-
B activity upon anti-CD40 or IL-4 treatment, as illustrated by the loss of NF-
B binding in a gel-shift assay, phosphorylation and degradation of I
B
, and levels of nuclear RelB (Fig. 6A
). Parthenolide and IKK-2 inhibitor IV, respectively, had only minor effects or did not affect levels of IL-4-induced p-Stat6 in the nucleus, although both inhibitors decreased Stat6 DNA binding, as assessed by gel shift or DAPA (Figs. 5B
and 6A
and 6C)
. The IKK-2 inhibitor IV also abolished the ability of IL-4 to induce p52 processing in a NF-
B DAPA (Fig. 5C)
. DAPA also showed that inhibition of PI-3K decreased IL-4-induced Stat6 DNA-binding activity (Fig. 6B
and 6C)
. The dependence of Stat6 DNA binding on NF-
B activity would predict that NF-
B inhibitors would block IL-4-induced gene expression. As shown in Figure 6D
, pretreatment of B cells with parthenolide or IKK-2 inhibitor but not DMSO ablated the ability of IL-4 to induce MHCII or CD86 expression. Taken together, these data indicate that IL-4-induced NF-
B activity in B cells plays a novel role in gene induction.
![]() View larger version (33K): [in a new window] |
Figure 6. NF- B activity is required for the induction MHCII and CD86 expression in B cells. (A) Purified B cells were pretreated with parthenolide (PN) and stimulated with 2 µg/ml -CD40 or 10 ng/ml IL-4 for 4 h. Nuclear extracts were prepared and used for NF- B EMSA or Western blotted for the indicated proteins. (B) B220+ B cells were treated with 5 µM parthenolide or 100 nM IKK-2 inhibitor IV for 1 h at 37°C, and IL-4 was added to the culture for 4 h. Total protein extracts were isolated, and Stat6 DAPA was performed using a Stat6-binding site from the MHCII promoter. DAPA complexes were separated on SDS-PAGE and immunoblotted for Stat6. (C) Densitometry (±SD) of Stat6 DAPA analysis (as in B) from cells incubated in the absence or presence of the indicated inhibitors. (D) Purified B220+ B cells were pretreated with DMSO, 5 µM parthenolide, or 100 nM IKK-2 inhibitor IV, followed by IL-4 stimulation for 22 h. Cells were analyzed for MHCII and CD86 expression using flow cytometry.
|
|
|
|---|
B pathway, and this activity is required for IL-4-induced MHCII and CD86 expression by altering Stat6 DNA-binding activity.
Based on data here, we propose the following model for IL-4-induced NF-
B activity. IL-4 induces PI-3K activity and Traf3 degradation, which in turn mediates the activation of the IKK complex. Akt, a target of PI-3K, mediates IKK
phosphorylation at threonine 23 to subsequently activate NF-
B activity through the processing of NF-
B p100 to NF-
B p52 [44
45
46
]. This allows active NF-
B complexes to enter the nucleus and interact with activated Stat6 to facilitate DNA binding. Although we observe that IL-4 predominantly activates the noncanonical pathway involving RelB:p52, it is possible that other NF-
B family members can mediate this function if they are present in basal levels or if activated by another ligand. Indeed, B cells deficient in p50 or p52 have normal, IL-4-stimulated expression of MHCII and CD86 (Estefania Vazquez and Ulrich Siebenlist, personal communication, and data not shown). As RelB can form heterodimers with p52 or p50 [42
], p50:RelB could compensate for p52 deficiency. Altered B cell development in mice doubly deficient in p50 and p52 would prevent this analysis in cells lacking both subunits [24
].
Given the extensive analysis of IL-4, B cell signaling, and NF-
B in the literature, it is surprising that these observations have not been made previously. There could be several reasons for this. One is that few studies have been performed examining IL-4 signaling with primary B cells. Another issue is the somewhat delayed activation of the pathway; we see peak activation at 2–4 h, and Stat6 is activated fully by 30 min after IL-4 stimulation. This raised some concern that the effect was not direct. However, we did not observe IL-4-induced expression of other ligands, which are known to induce NF-
B activity, including BAFF, CD40L, and IL-1 (data not shown). It is also possible that NF-
B activation could be caused by contamination in our preparation of IL-4. However, we observed similar responses with multiple stock solutions of IL-4, and use of anti-IL-4R
eliminated IL-4-induced p100 processing (data not shown). Moreover, blockade of PI-3K activity, which IL-4 is known to activate, is required for NF-
B induction and IL-4-induced gene expression. Further analysis of the proteins involved in the noncanonical NF-
B pathway will be required to elucidate this issue further.
The effect of blocking IL-4-induced NF-
B activity, with parthenolide, an IKK inhibitor or PI-3K inhibitor, on Stat6 DNA-binding activity is surprising. It has been shown previously that parthenolide can inhibit Stat6 DNA binding, and this was proposed to function through impaired nuclear transport [47
]. Our results suggest that nuclear transport is not affected, and the use of additional inhibitors of NF-
B or NF-
B-activating pathways yielded the same effect. Moreover, use of a more selective inhibitor of the p52 pathway has been shown recently to inhibit IL-4-induced I
germline transcription [48
]. NF-
B could mediate these effects in several ways. Stat6 and NF-
B are known to associate and synergize in several cell types including B cell lines in the induction of I
1, I
, lymphotoxin-
, and activation-induced deaminase [49
50
51
52
53
54
55
56
57
]. It is possible this association is necessary for Stat6 DNA binding. It is also possible that there is cooperative binding of the two transcription factors to DNA. However, in the I
1 promoter, where Stat6 and NF-
B have been shown to be important for gene induction, mutation of NF-
B-binding sites in a transgene does not abolish synergism [58
]. This suggests that NF-
B could have functions independent of DNA binding. We do not observe the converse, that Stat6 is required for NF-
B activation. In Stat6-deficient B cells, IL-4-induced NF-
B activity was normal (data not shown). Future experiments will explore these phenomena further.
The cell type specificity of IL-4-induced NF-
B activity is intriguing and may provide some understanding of the cell type-specific effects of IL-4. NF-
B induction by IL-4 correlates with the ability of IL-4 to induce MHCII and CD86 expression in B cells but not in BMDM. How the NF-
B pathway is activated by IL-4 only in B cells is not clear. The mechanism may include cell type-specific expression of some components of the signaling system including IKK complex proteins, which dictate the activation of NF-
B pathways [45
]. Regardless, the induction of NF-
B in B cells may contribute to the cell type-specific effects of IL-4 in combination with Stat6 or other transcription factors such as IFN regulatory factor 4 and Stat5 [59
, 60
].
The ability of IL-4 to induce surface expression of MHCII is likely a result of multiple mechanisms, including increased transcriptional activity, enhanced mRNA half-life, stabilization of surface expression, and transport of intracellular MHCII to the cell surface [9 , 61 ]. Our studies illustrate that treatment of B cells with IL-4 increases mRNA levels of the MHCII genes. The discrepancy between our results and other reports might be a result of the time difference in which the cells were treated with IL-4: 12 h post-IL-4 treatment verses our treatment of 3 h [62 ]. As seen in Figure 1B , after 6 h of IL-4 treatment, Class II mRNA returns to near-basal levels and continues to decrease thereafter (data not shown). IL-4-induced MHCII expression is not a result of indirect induction of the Class II transactivator (data not shown and ref. [62 ]). Our data are consistent with previous work by several groups [63 , 64 ], in which IL-4 enhances MHCII expression in part by up-regulating the transcriptional activity of its promoter and mRNA expression.
In summary, we have demonstrated the ability of IL-4 to induce NF-
B activity to regulate gene expression in B cells. This pathway may be a regulatory component of multiple cytokine-induced genes and contribute to cell type-specific effects of IL-4. It further defines a downstream effector of IL-4-stimulated PI-3K activity. Together, these data provide a further understanding of IL-4 signaling and facilitate cell type-specific manipulation of responses in B cell.
Received November 29, 2006; revised April 30, 2007; accepted May 1, 2007.
|
|
|---|
and Fc
receptor expression on murine B lymphocytes and B cell lines J. Immunol. 139,2290-2296[Abstract]
]B Nat. Rev. Immunol. 5,435-445[CrossRef][Medline]
B activation pathways and their role in innate and adaptive immunity Trends Immunol. 25,280-288[CrossRef][Medline]
B1 and NF-
B2 in immune cell biology Biochem. J. 382,393-409[CrossRef][Medline]
B2/p100 induces Bcl-2 expression Leukemia 17,1349-1356[CrossRef][Medline]
]B2 in maturing B cells Nat. Immunol. 3,958-965[CrossRef][Medline]
B2 Immunity 17,515-524[CrossRef][Medline]
B pathways Immunity 17,525-535[CrossRef][Medline]
B-p52 generation by a co-translational mechanism EMBO Rep. 4,82-87[CrossRef][Medline]
B factors via separate signaling pathways J. Biol. Chem. 278,12006-12012
B2 p100 to p52 EMBO J. 21,5375-5385[CrossRef][Medline]
B activation pathways Proc. Natl. Acad. Sci. USA 101,8108-8113
of a second, evolutionary conserved, NF-
B signaling pathway Science 293,1495-1499
B pathway Crit. Care Med. 30,S18-S26[CrossRef][Medline]
B-inducing kinase regulates the processing of NF-
B2 p100 Mol. Cell 7,401-409[CrossRef][Medline]
B-inducing kinase involves docking I
B kinase
(IKK
) to p100 and IKK
-mediated phosphorylation J. Biol. Chem. 279,30099-30105
B at the crossroads of life and death Nat. Immunol. 3,221-227[CrossRef][Medline]
B Genes Dev. 18,2195-2224
}B-inducing kinase by tumor necrosis factor receptor-associated factor 3-induced degradation J. Biol. Chem. 279,26243-26250
]B activation by tumor necrosis factor requires the Akt serine-threonine kinase Nature 401,82-85[CrossRef][Medline]
}B kinases determines the significance of phosphatidylinositol 3-kinase/Akt signaling to NF-{
}B activation J. Biol. Chem. 279,1615-1620
}B2 (p100) to p52 J. Biol. Chem. 281,16473-16481
] germline transcription and NF[
]B p52 translocation for IgE production in B cells Biochem. Biophys. Res. Commun. 350,501-507[CrossRef][Medline]
}3 region is an inducible promoter: synergistic activation by CD40 ligand and IL-4 via cooperative NF-{
}B and STAT-6 binding sites J. Immunol. 162,5327-5336
B and C/EBP in CD23 expression and IgE production Int. Immunol. 10,1529-1538
B/Rel by CD40 engagement induces the mouse germ line immunoglobulin C
1 promoter Mol. Cell. Biol. 16,4591-4603
}B Int. Immunol. 16,395-404
}B or PU.1 to mediate IL-4-induced activation of IgE germline gene transcription J. Immunol. 163,4383-4391
B/rel in the IL-4-induced up-regulation of the human IgE germline promoter J. Immunol. 159,3330-3337[Abstract]
]1 promoter by CD40 ligand and IL-4: dual role for tandem NF-[
]B binding sites Mol. Immunol. 36,31-44[CrossRef][Medline]
B: direct association and synergistic activation of interleukin-4-induced transcription Mol. Cell. Biol. 18,3395-3404
germline transcripts in B cells via activation of NF-
B: synergy with IL-4 induction J. Immunol. 158,4769-4779[Abstract]
}B elements associated with the Stat6 site in the germline {
}1 immunoglobulin promoter are not necessary for the transcriptional response to CD40 ligand Int. Immunol. 16,1741-1749
-chain J. Biol. Chem. 273,31222-31229
MHC class II promoter that binds to an inducible factor Nucleic Acids Res. 23,2919-2928This article has been cited by other articles:
![]() |
S. Sehra, H. A. Bruns, A.-N. N. Ahyi, E. T. Nguyen, N. W. Schmidt, E. G. Michels, G.-U. von Bulow, and M. H. Kaplan IL-4 Is a Critical Determinant in the Generation of Allergic Inflammation Initiated by a Constitutively Active Stat6 J. Immunol., March 1, 2008; 180(5): 3551 - 3559. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||