Published online before print May 14, 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,1,
,2
,,3
* Department of Microbiology and Immunology,
Lineberger Comprehensive Cancer Center, and
Curriculum in Genetics and Molecular Biology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, USA; and
Department of Pharmacology, Loyola University Medical School, Maywood, Illinois, USA
3 Correspondence: Lineberger Comprehensive Cancer Center, Room 22-056, CB#7295, Department of Microbiology and Immunology, School of Medicine, University of North Carolina, Chapel Hill, NC 27599-7295, USA. E-mail: lsu{at}med.unc.edu
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
13, and its effector RhoA are able to inhibit HIV-1 replication. Here, we show that RhoA is able to inhibit HIV-1 gene expression through the NFAT-binding site in the HIV long-terminal repeat. Constitutively active NFAT counteracts the inhibitory activity of RhoA, and inhibition of NFAT activation also inhibits HIV-1 gene expression. We have shown further that RhoA inhibits NFAT-dependent transcription and IL-2 production in human T cells. RhoA does not inhibit nuclear localization of NFAT but rather, inhibits its transcriptional activity. In addition, RhoA decreases the level of acetylated histone H3, but not NFAT occupancy, at the IL-2 promoter. These data suggest that activation of RhoA can modulate IL-2 gene expression by inhibiting the transcriptional activity of NFAT and chromatin structure at the IL-2 promoter during T cell activation.
Key Words: GTPase • HIV-1 • IL-2
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B and NFAT [1
2
3
4
5
6
7
]. We have reported previously that p115Rho guanine nucleotide exchange factor (GEF) interacts directly with the C terminus of HIV gp41 [8
]. Furthermore, expression of p115RhoGEF, its upstream activator G13, or its downstream effector RhoA causes a decrease in HIV replication [9
]. Given the close relationship between T cell activation and HIV replication, we were interested in looking at how RhoA inhibits HIV replication and whether it also affects T cell activation. RhoA is a small GTPase with a well-characterized role in cytoskeletal rearrangement. Upon activation, RhoA causes the formation of stress fibers in cells [10 ]. In lymphocytes, this function of RhoA is critical for the proper homing of cells to areas of infection [11 ]. Evidence has shown that RhoA is required for the process of leukocyte rolling and diapedesis or migration beneath the endothelial layer of cells [12 ]. In addition, RhoA is involved in the assembly of the immunological synapse, an area on the cell surface where elements of the immune signaling apparatus congregate, allowing for proper activation of the T cell [13 ].
In some cells, RhoA has been shown to play a more direct role in signal transduction. Welsh et al. [14
] demonstrated a dependence on RhoA for ERK activity during the G1 phase of the cell cycle. Without ERK activation, there is no cyclin D induction, leading to a block in cell cycle progression [14
]. The specific role of RhoA in signaling pathways turned on during T cell activation has not been examined thoroughly, although reports have shown that the GTPase is able to activate the NFAT-binding partner AP-1 [15
] as well as NF-B [16
17
18
]. In addition, RhoA and its upstream activator G13 have been shown to increase the activity of phospholipase C
(PLC), leading to increased levels of intracellular calcium [19
].
The NFAT family of proteins was first discovered by identification of factors involved in the up-regulation of IL-2 in response to TCR stimulation [20
]. Since that time, NFAT proteins have been implicated in a wide variety of cellular processes including cardiac hypertrophy, learning and memory, and adipocyte differentiation [21
, 22
]. Immunologically relevant genes regulated by NFAT include IL-2, IL-4, IL-5, GM-CSF, TNF-, CD40 ligand (CD40L), and FasL. NFAT family proteins are regulated primarily through calcium levels in the cell. Upon stimulation, an increase in intracellular calcium turns on the serine/threonine phosphatase calcineurin, which then binds to NFAT and dephosphorylates the protein, allowing NFAT nuclear translocation. The immunosuppressive drugs FK506 and Cyclosporin A work through inhibition of calcineurin—preventing NFAT-dependent transcription [23
]. Studies have shown that p38MAPK, ERK, and JNK can potentially phosphorylate NFAT, inhibiting its translocation [24
].
Other pathways have also been implicated in NFAT regulation at the level of nuclear translocation and DNA binding. Once the protein enters the nucleus, kinases, including glycogen synthase kinase 3, phosphorylate NFAT, preventing DNA binding and leading to nuclear export [25 ]. Furthermore, NFAT proteins typically have a binding partner, which stabilizes their interaction with the DNA. Although several transcription factors can act in this capacity, the predominant protein is AP-1 [26 ], a heterodimer comprised of c-jun and Fos [27 ], which are activated by MAPK pathways that can also be initiated upon TCR ligation. Fos is transcriptionally up-regulated through ERK, and JNK phosphorylates jun leading to its activation and nuclear translocation [27 , 28 ]. Some studies have shown that NFAT plays a role in anergy induction as well as activation in T cells. Stimulation of T cells with ionomycin alone activates NFAT in the absence of factors including AP-1 and leads to the up-regulation of "anergic factors," which block activation instead of the up-regulation of IL-2 production and proliferation [29 , 30 ]. In addition, recent reports have shown that alternate family members can replace Fos and jun in the formation of a heterodimer, which is still able to bind DNA cooperatively with NFAT but give the complex an inhibitory function [27 , 31 32 33 ].
Here, we demonstrate that activated RhoA is able to inhibit NFAT-dependent transcription from the HIV long-terminal repeat (LTR) and the IL-2 promoter. RhoA did not affect NFAT nuclear localization in response to Ca++-mediated activation. The RhoA-GTPase did, however, inhibit the transactivation potential of NFAT. In stimulated T cells, expression of activated RhoA also led to a decrease in the level of acetylated histone H3 at the IL-2 promoter but not the occupancy of NFAT at the IL-2 promoter. RhoA activation may, therefore, affect chromatin remodeling at the IL-2 promoter and the ability of NFAT to transactivate DNA.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Transactivation assay
For the transactivation assays, 5x GAL4-luciferase was transfected along with NFAT/GAL4 or NF-B/GAL4 (gifts of Dr. Mohamed Oukka, Harvard Medical School, Boston, MA, USA; see ref. [36
]) and RhoA63L or vector as described above. Unstimulated Jurkat T cells were cultured for 2 days and then lysed using 5x lysis buffer from the Promega luciferase assay system. Luciferase activity was measured using the Fluostar Optima luminescent plate reader from BMG Labtech (Germany).
Retroviral transduction
Retroviruses were made in A293T cells by transfection using calcium phosphate as described previously [37
]. Retrovirus was added to Jurkat T cells or human PBMCs in the presence of 8 ug/ml polybrene. Cells sat at room temperature for 30 min followed by 3 h of centrifugation at room temperature at 2000 g. After 2 days in culture, cells were monitored for GFP expression by FACScan analysis.
Intracellular cytokine staining
Transduced Jurkat T cells were activated with 2 ug/ml PHA and 1 uM ionomycin for 5 h. After the 1st h, 10 ug/ml Brefeldin-A was added to the cultures. After 5 h, cells were permeabilized in Becton Dickson Permeabilization 2 buffer and stained for 30 min with a monoclonal PE-conjugated anti-IL-2 (Caltag Laboratories, Burlingame, CA, USA). Cells were gated for GFP and analyzed by FACS. Transduced, primary, human PBMCs were stimulated with anti-CD3 and anti-CD28 for 24 h. During the last 4 h, Brefeldin-A was added to cultures, and cells were stained as described above.
Immunofluorescence staining
U20S cells (1x105) were plated on coverslips in 12-well plates and allowed to grow overnight. The following day, the cells were transfected with flag-tagged, wild-type NFAT [24
], along with pCDNA3 or activated RhoA and serum-starved overnight. Cells were activated for 30 min with 5 mM CaCl2 and 1 uM ionomycin and then fixed with 4% paraformaldehyde for 15 min at room temperature, rinsed with PBS, permeabilized with 0.2% Trition for 5 min at 4°C, and rinsed again three times with PBS. Cells were blocked in PBS, 0.5% BSA, at room temperature and then stained in PBS, 0.5% BSA, with a mouse antiflag antibody (Sigma Chemical Co., St. Louis, MO, USA) for 1 h, followed by three washes in PBS and secondary staining with rhodamine-conjugated anti-mouse antibody for 1 h at room temperature. Cells were washed five times for 5 min in PBS. In the final wash, 1 ul 4',6-diamidino-2-phenylindole was added to 1 ml PBS for nuclear staining. Coverslips were mounted on slides and allowed to dry overnight in the dark at room temperature. Several hundred NFAT+ cells were then scored blindly for nuclear NFAT.
Chromatin immunoprecipitation (ChIP)
For ChIP analysis, the ChIP assay kit from Upstate Cell Signaling Solutions (Lake Placid, NY, USA) was used according to protocol. Briefly, 1 x 107-transduced Jurkat T cells for each immunoprecipitation condition were left unstimulated or stimulated with 2 ug PHA and 1 uM ionomycin for 40 min followed by a 20-min incubation with 1% formaldehyde at 37°C. After incubation with formaldehyde, glycine was added to the cultures to a final concentration of 125 mM. Cells were then washed twice with cold 1x PBS plus PMSF and protease inhibitors. Cells were lysed in 300 ul SDS lysis buffer and incubated with shaking for 10 min at 4°C followed by sonication for a single 1-min burst and eight rounds of 35 s (1-s pulse, 0.8-s rest). This process produced fragments ranging between 500 and 2000 bp. Sonicates were then precleared with 60 ul salmon sperm DNA/protein A agarose slurry for 30 min with rotation at 4°C. After clearing, the lysates were divided evenly for overnight incubation with no antibody, with 10 ug -acetylated H3 (K9 and K14) antibody (Upstate Cell Signaling Solutions) or with 25 ug -NFATc1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA). On the following day, the antibody/protein complexes were immunoprecipated with 60 ul salmon sperm/protein A agarose slurry for 2 h, followed by one wash each at 4°C with low salt, high salt, and LiCl wash buffers and two washes with 1x tris-EDTA buffer. Complexes were eluted in elution buffer (1% SDS, 0.1 M NaHCO3) during two washes for 15 min at room temperature. NaCl (20 ul 5 M) was added to 500 ul eluate and left overnight at 65°C to reverse the protein DNA cross-linking. The following day, 10 ul 0.5 M EDTA, 20 ul Tris-HCl (pH 6.5), and 2 ul 10 mg/ml proteinase K were added and incubated for 1 h at 45°C. DNA was then recovered by phenol/chloroform extraction and resuspended in 30 ul water.
Real-time PCR
Real-time PCR was used to analyze DNA pulled down by ChIP. We designed primers for the IL-2 promoter (forward: CACCTAAGTGTGGGCTAATGTAACA; reverse: CTGATGACTCTTTGGAATTCTTTAAACC), along with the TAM/FAM-labeled probe (AGAGGGATTTCACCTACATCCATTCAGTCAGTC). DNA from final ChIP preparations was diluted 1:2, and 5 ul of this dilution was used per reaction. A standard curve was produced using a dilution series from genomic DNA from the same cell type used for ChIP. Samples were run in duplicate. The average of duplicate samples was normalized by dividing the average of the quantitation from the input DNA of the same cell type and condition.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
13, a heterotrimeric G protein that activates p115, are able to inhibit HIV replication [9
]. Similarly, ectopic expression of constitutively active RhoA (RhoA-63L) in Jurkat T cells inhibited HIV-1 gene expression upon coinfection with a vesicular stomatitis virus (VSV)-G-pseudotyped HIV-luciferase reporter virus (Fig. 1a
). To further analyze how this pathway is able to inhibit HIV-1 infection, we transfected Jurkat T cells with the HIV-1 LTR, driving a luciferase reporter gene along with RhoA63L. We found that expression of activated RhoA leads to decreased LTR-luciferase expression in a dose-dependent manner (Fig. 1b)
. To show the specific inhibition of HIV LTR, we transfected pAX-lacZ, a promoter shown previously to be unaffected by Dbl family proteins including p115 [38
, 39
], into Jurkat cells, along with the HIV LTR, in the presence or absence of constitutively active RhoA. We showed that RhoA is able to inhibit transcription specifically from the HIV LTR but not from the pAX promoter (Fig. 1c)
.
 View larger version (16K): [in a new window] |
Figure 1. RhoA specifically inhibits HIV-1 LTR activity. (a) Jurkat T cells were transduced with control or RhoA63L vectors, followed by infection with HIV-luciferase virus pseudotyped with VSV-G. After 2 days, cells were harvested, and luciferase activity was measured. RLU, Relative light units. (b) Jurkat T cells were cotransfected with HIV-1 LTR-luciferase, the HIV Tat protein, and vector (pcDNA3) or the constitutively active RhoA63L. After 2 days, cells were harvested, and luciferase activity was measured. Shown are data representative of at least 10 experiments. (c) Jurkat T cells were transfected with the HIV LTR-luciferase and pAX-lacZ in the presence or absence of RhoA63L. Post-transfection (48 h), cell lysates were measured for luciferase activity as well as lacZ activity. In the presence of RhoA63L, the LTR was inhibited by 4.5-fold, and lacZ expression from the pAX promoter was unaffected. Data from six independent experiments are summarized.
|
B sites and a NFAT-binding site, was important for the ability of RhoA to inhibit transcription (Fig. 2a
). To determine which of these sites was important in RhoA inhibition of the LTR, we used a group of LTR point mutants [1
]. Although mutations in the NF-B sites of the LTR led to reduced overall activity from the promoter, only the mNFAT mutant showed consistent lack of inhibition by RhoA (Fig. 2b)
. A summary of the relative inhibition by RhoA from the deletion and site-specific mutants is presented in Figure 2c
. These data indicate that RhoA is able to inhibit the HIV LTR through the NFAT-binding site.
 View larger version (27K): [in a new window] |
Figure 2. RhoA inhibition of HIV LTR is dependent on the NFAT-binding site. The HIV LTR deletion mutants (a) or point mutants of the HIV LTR NF-B/NFAT enhancer (b) were transfected into Jurkat T cells with vector or RhoA63L, and luciferase activity was measured 48 h post-transfection. (c) Summary of the HIV LTR deletion and point mutants used to define cis-acting elements involved in RhoA-mediated inhibition of the promoter. +++, Strong inhibition (>3x); ++, moderate inhibition (1.5–3x); –, no inhibition (<1.5x). Data shown are representative of four experiments. Error bars represent the standard deviation of duplicate samples in one experiment. NRE, Negative regulatory element; KB, NF-B; SP1, specificity protein 1; mKB1, point mutation in NF-B1; luc wt, luciferase wild-type.
|
 View larger version (13K): [in a new window] |
Figure 3. RhoA inhibits NFAT to inhibit HIV-1 LTR expression. (a) Jurkat T cells (2x105) were transfected with the 3x NFAT-luc construct in the presence or absence of RhoA. After 2 days, cells were stimulated with PHA and ionomycin for 5 h or left unstimulated. RhoA inhibited luciferase expression significantly (*, P<0.01) from the NFAT promoter in stimulated Jurkat T cells. Shown are representative data for at least six independent experiments. (b) Constitutively active NFAT counteracts RhoA inhibition. Jurkat T cells were transfected with HIV LTR-luciferase construct and the HIV Tat protein in the presence or absence of RhoA63L and/or constitutively active NFAT. The presence of constitutively active NFAT prevents HIV LTR inhibition by RhoA. NFATca, . (c) Jurkat T cells were pretreated with FK506 to inhibit NFAT activation, followed by infection with HIV-luciferase virus pseudotyped with VSV-G and activation with PHA and ionomycin. After 2 days, cells were harvested, and luciferase activity was measured. Data shown are representative of four experiments. Error bars represent the standard deviation of duplicate samples in one experiment. NFATca, constitutively active NFAT.
|
 View larger version (17K): [in a new window] |
Figure 4. RhoA inhibits IL-2 expression during T cell activation. (a) Jurkat T cells transduced with vector or with RhoA63L were stimulated with PHA and ionomycin for 5 h. Cells were then stained for intracellular IL-2. The presence of active RhoA decreased IL-2 production by  50% (n=2). (b) Primary human PBMCs were transduced retrovirally with control vector or constitutively active RhoA. After activation, intracellular IL-2 was measured. The percentage of IL-2-positive cells is shown. Data shown are representative of two independent experiments.
|
An alternative explanation for the decrease in NFAT-dependent transcription in the presence of constitutively active RhoA could be that it is a result of a change in the ability of NFAT to transactivate gene expression. To determine whether RhoA was affecting this capacity, we transfected Jurkat T cells with a 5x GAL4-luciferase construct, along with GAL4/NFAT or GAL4/NF-B fusion constructs in the presence or absence of RhoA [36
]. We found that there was an approximate twofold decrease in transcription from the 5x GAL4-luciferase promoter driven by GAL4/NFAT in the presence of RhoA in Jurkat T cells (Fig. 5
). In contrast, active RhoA showed no effect of the GTPase on the transactivation activity of NF-B fused with the GAL4 DNA-binding domain. These data suggest that RhoA inhibition of NFAT-dependent transcription is caused by an effect on the transactivation activity of NFAT.
 View larger version (20K): [in a new window] |
Figure 5. RhoA decreases the transactivation activity of NFAT. Jurkat T cells were transfected with 5x GAL4-luciferase and plasmids encoding the GAL4-NFAT or GAL4-NF-B fusion proteins in the presence or absence of RhoA63L. After 48 h, the cells were harvested, and luciferase activity was measured to determine transcriptional activation. Data are shown as percent activity relative to vector from four (GAL4-NFAT) or three (GAL4-NF-B) independent experiments.
|
-NFATc1, showed that there was increased binding of the protein to the IL-2 promoter upon cellular activation in the presence or absence of RhoA (Fig. 6b
). When -AcH3 ChIP was similarly analyzed, RhoA-expressing cells showed an approximately threefold decrease compared with vector-expressing cells in the level of AcH3 at the IL-2 promoter in the unstimulated condition (Fig. 6a)
. We also found that although the level of AcH3 at the IL-2 promoter increased with stimulation in vector-transduced cells, the amount of active chromatin in RhoA-transduced cells decreased under the same conditions (Fig. 6a)
. The acetylation of H3 at the actin promoter was not affected by RhoA (data not shown). These findings suggest that activated RhoA causes a change in the IL-2 promoter at the level of chromatin organization.
 View larger version (15K): [in a new window] |
Figure 6. RhoA decreases the level of histone 3 acetylation at the IL-2 promoter in T cells. Jurkat T cells transduced with vector or RhoA63L were left unstimulated or activated with PHA and ionomycin. ChIP, using an antiacetylated H3 antibody (a) or an anti-NFATc1 antibody (b), was performed. The amount of ChIP DNA was measured by real-time, quantitative PCR of the IL-2 promoter. Input chromatin DNA (10% of total) was also measured for each sample. The relative NFAT binding is determined by the amount of anti-NFATc1 ChIP/input DNA. Data shown are representative of five independent experiments.
|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The dependence of HIV on T cell activation to further its own replication has made the virus a useful tool for furthering our understanding of factors important during this process. Earlier work from this lab showed that the G13, p115RhoGEF, and RhoA pathway is able to inhibit HIV replication [8
, 9
]. It is interesting that mice lacking G2A, a G-protein-coupled receptor (GPCR), which has been shown to activate the G13 pathway, develop a late onset, autoimmune disorder, implying an important role for the G13 signaling pathway, including RhoA, in the regulation of T cell activation [44
, 45
]. Although the underlying mechanism behind the development of autoimmunity in these mice is not fully understood, we show here that activation of the downstream effector of G13, RhoA, can lead to inhibition of transcription from the HIV LTR and the IL-2 promoter. These findings suggest that extracellular signaling through specific GPCRs may be able to modulate not only T cell activation but also HIV transcription, thus providing a potential target pathway for helping to control the virus.
T cell anergy is a state of unresponsiveness to TCR stimulation characterized in part by lack of IL-2 production [46
], a phenotype similar to that seen here in the RhoA63L-expressing T cells. Recent work has indicated that NFAT plays an important role, not only in promoting T cell activation but also in preventing it. NFAT1 has been identified as a potential anergy factor, shown to be important in up-regulation of a panel of genes associated with anergy, and T cells lacking NFAT1 are resistant to anergy induction [29
]. NFAT functions as a transcriptional regulator of anergy when AP-1 is not present to serve as a binding partner—in a situation where the T cell is not fully activated. In addition, work by Heissmeyer et al. [40
] shows that pretreatment of cells with ionomycin leads to cyclosporine A-sensitive anergy induction. Here, we have demonstrated a reduction in T cell responsiveness in the presence of constitutively active RhoA. It is interesting that although constitutively active RhoA did not inhibit the nuclear translocation of NFAT upon Ca2+ stimulation of U2OS cells, we did observe that RhoA63L expression in these cells led to an increase in nuclear translocation of NFAT in the absence of stimulation (Supplemental Fig. 1). It is unlikely that RhoA activates NFAT family proteins directly to cause translocation. One possible candidate effector in this process is PLC. Wing et al. [19
] showed recently that RhoA was able to activate PLC directly through a unique, 65 amino acid insert in the protein’s Y box [19
]. PLC isozymes are responsible for cleaving phosphatidylinositol 4,5, bisphosphate to produce 1,4,5- triphosphate (IP3) and diacylglycerol [47
]. IP3 causes the release of intracellular calcium stores, which can then lead to the activation of calcineurin [48
] and subsequently, NFAT. These findings, in combination with our observation, may provide a potential mechanism of RhoA-mediated inhibition of T cell activation. The possibility exists that early translocation of NFAT puts the protein in contact with different binding partners in the nucleus, which result in NFAT acting as a repressor of IL-2 transcription rather than as an activator. This is supported by the data presented in Figure 5
, showing that RhoA decreases the ability of NFAT to transactivate DNA. RhoA may thus be able to affect which cofactors are available for NFAT-dependent transcription on several different levels, through a direct effect on NFAT-binding partners and through an indirect effect on the timing of NFAT translocation, perhaps preventing the recruitment of a transcriptional activation complex. In support of this possibility, Bodor and colleagues [49
, 50
] have described the interaction of NFAT with the inducible cAMP early repressor, which lacks a transactivation domain, leading its interaction with NFAT to result in the prevention of the recruitment of the CBP/p300 histone acetylase complex to the promoter and thus, to inhibition of transcription. Further analysis of which cofactors bind with NFAT at the IL-2 promoter in the presence of constitutively active RhoA may shed light on how NFAT is able to induce T cell anergy as well as activation.
RhoA is a downstream effector of many different pathways, and under some conditions, activation of the GTPase could actually lead to enhancement of IL-2 transcription. For example, RhoA has well-documented roles in the activation of NF-B and AP-1 [15
16
17
18
]. It is interesting that Jurkat T cells cotransfected with constitutively active NFAT and RhoA63L actually showed consistently higher levels of activity from the NFAT-luciferase construct than cells transfected with constitutively active NFAT alone (data not shown). Again, an effect of activated RhoA on NFAT-binding partners including AP-1 may explain the enhancement when constitutively active NFAT and RhoA63L are expressed.
Finally, although it has been shown that RhoA can cause inhibition of HIV, a mechanism for this inhibition has not been described. Here, we have shown that activation of RhoA can lead to a decrease in the ability of NFAT to activate transcription, but the overall influence of RhoA on NFAT-dependent transcription may be the result of a combination of effects. In this study, we have used the constitutively active mutant of RhoA, RhoA63L, to study the effects of the GTPase on T cell activation. Previous work from this lab, however, has shown that expression of a mutant of p115RhoGEF, which lacks GEF activity and therefore, cannot activate RhoA but is still able to inhibit G12 and G13, leads to enhancement of HIV replication and NFAT-dependent transcription (ref. [9
] and data not shown). These observations suggest that the G13-p115RhoGEF-RhoA pathway plays a role specifically in down-modulating T cell activation and HIV replication. Further examination of ligands and GPCRs, which use G13, may therefore lead to novel methods of modulating T cell activation with potential uses in controlling not only HIV but also autoimmune disorders.
2 Current address: Centers for Disease Control and Prevention, Atlanta, GA 30329, USA.
Received February 27, 2007; revised March 10, 2007; accepted April 3, 2007.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B by the Rho family of GTPases J. Biol. Chem. 273,12779-12785B activation and IL-1β gene expression in cultured human epithelial cells J. Immunol. 160,3038-3045B by Rho, CDC42, and Rac-1 proteins Genes Dev. 11,463-475 by Rho J. Biol. Chem. 278,41253-41258B activity Mol. Cell. Biol. 18,110-121 B to repress cytokine gene expression and effector functions of T helper cells Proc. Natl. Acad. Sci. USA 102,5138-514313 deficiency Science 275,533-536This article has been cited by other articles:
 |
|
 |
|
  C. M. Henstridge, N. A. B. Balenga, L. A. Ford, R. A. Ross, M. Waldhoer, and A. J. Irving The GPR55 ligand L-{alpha}-lysophosphatidylinositol promotes RhoA-dependent Ca2+ signaling and NFAT activation FASEB J, January 1, 2009; 23(1): 183 - 193. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
