Published online before print April 18, 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


* Departments of Microbiology and Immunology and
Pharmacology and Physiology, Institute for Molecular Medicine and Infectious Disease and Centers for Molecular Virology and Neuroimmunology and Cancer Biology, Drexel University College of Medicine, Philadelphia, Pennsylvania, USA
1 Correspondence: Department of Microbiology and Immunology, Drexel University College of Medicine, 2900 Queen Lane, Philadelphia, PA 19129, USA. E-mail: bwigdahl{at}drexelmed.edu
ABSTRACT
Human T cell leukemia virus type 1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) is characterized by the generation of an intense CTL cell response directed against the viral transactivator protein Tax. In addition, patients diagnosed with HAM/TSP exhibit rapid activation and maturation of dendritic cells (DC), likely contributing to the robust, Tax-specific CTL response. In this study, extracellular Tax has been shown to induce maturation and functional alterations in human monocyte-derived DC, critical observations being confirmed in freshly isolated myeloid DC. Tax was shown to promote the production of proinflammatory cytokines and chemokines involved in the DC activation process in a dose- and time-dependent manner. Furthermore, Tax induced the expression of DC activation (CD40, CD80, and CD86) and maturation (CD83) markers and enhanced the T cell proliferation capability of DC. Heat inactivation of Tax resulted in abrogation of these effects, indicating a requirement for the native structure of Tax, which was found to bind efficiently to the DC membrane and was internalized within a few hours, suggesting that extracellular Tax may possess an intracellular mechanism of action subsequent to entry. Finally, inhibitors of cellular signaling pathways, NF-
B, protein kinase, tyrosine kinase, and phospholipase C, were shown to inhibit Tax-mediated DC activation. This is the first study reporting the immunomodulatory effects of extracellular Tax in the DC compartment. These results suggest that DC, once exposed to Tax by uptake from the extracellular environment, can undergo activation, providing constant antigen presentation and costimulation to T cells, leading to the intense T cell proliferation and inflammatory responses underlying HAM/TSP.
Key Words: HTLV-1 HAM/TSP Tax-specific CTL response
INTRODUCTION
Human T cell leukemia virus type 1 (HTLV-1) is the causative agent of a number of disorders, the most prominent being adult T cell leukemia (ATL) and HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). Worldwide,
20 million people are estimated to be infected with HTLV-1, 23% develop ATL [1
], and 0.53% develop HAM/TSP [2
], which is a chronic, debilitating disease of the CNS characterized by a highly stimulated immune response and intense proliferation of chronically activated, circulating CTLs in the peripheral blood (PB) and cerebrospinal fluid (CSF) of infected individuals [3
]. The majority of this CTL response is specific for viral transactivator protein Tax [4
, 5
]. The stimulus for the virus-specific T cells is the Tax-immunodominant peptide (1119)-HLA complexes expressed on APC in the context of MHC. In some HLA-A*201 (MHC Class I Subclass A allele)-positive HAM/TSP patients, the frequency of Tax1119-specific CTLs is as high as 30% of all CD8+ T cells in PB [6
] and even higher in CSF [7
8
9
]. Therefore, characterization of this antigen-specific immune response is critical in understanding the immunopathogenesis of HAM/TSP and other chronic viral infections.
Tax is required for viral replication [10
] and is of special importance with respect to the HTLV-1-specific immune response, as it is the first viral protein to be produced and is a powerful mitogen and antigen [11
]. Tax is traditionally described as nuclear protein [12
, 13
]; however, recent studies clearly demonstrated the localization and functions of Tax in the cytoplasm [14
, 15
]. In addition to its intracellular functions, Tax is also known to cause a variety of effects as an extracellular protein. Tax is known to be released from HTLV-1-infected [16
] and Tax-transfected cells [17
]. Purified, recombinant Tax protein was shown to stimulate the proliferation of PBMC [18
], activation of NF-
B pathway, and expression of TNF-ß, Ig
light chain, and IL-2 receptor
expression on lymphoid cells [19
20
21
]. Extracellular Tax has also been shown to induce cytokine production from adult human microglial cells [22
], TNF-
secretion from human neuronal cells [23
], and proliferation of human synovial cells [24
]. Serologic evidence also supports the presence of extracellular Tax;
90% of HTLV-1-infected patients have antibodies to Tax [25
26
27
28
]. It is most important that the presence of cell-free Tax has been demonstrated recently in the CSF of HAM/TSP patients [29
]. These studies suggest Tax may be released from infected cells and is available for immune recognition by APC in a cell-free form.
Immune responses, antibody- and cell-mediated, involve the formation of an immunologic synapse between a T cell and an APC for antigen presentation ("signal one") and costimulation ("signal two"). Antigen presentation by itself is not enough to activate the T cell into an effector cell. To become activated, the T cell must receive a second signal provided by the costimulatory molecules (B7-1 or CD80 and B7-2 or CD86) on APC. Antigen presentation can be provided by any type of APC, but costimulation is provided only by the "professional APC" such as a dendritic cell (DC), which is the most potent APC capable of stimulating CD4+ and CD8+ T cells. DC have also been shown to present whole antigen to B cells. It is more important that mature DC are the only type of APC competent to prime and activate naïve CD8+ T cells [30 ]. With respect to HTLV-1 infection, DC are of particular significance, as the development of HAM/TSP is associated with rapid maturation of DC [31 ], and ATL involves a maturation defect in this critical cell population [32 , 33 ]. The most characteristic feature during the course of HAM/TSP is the spontaneous proliferation of lymphocytes (SPL), the levels of which reflect the severity of the disease [34 ]. It has been shown that depletion of DC from the patients PBMC abolished SPL, while supplementing DC, but not other APC (B cells or macrophages), restored proliferation. Furthermore, SPL can be blocked by mAb to MHC Class II, CD86, and CD58, indicating a DC-dependent mechanism [35 ]. DC are also known to be infected with HTLV-1 in vitro and lead to T cell proliferation [36 , 37 ]. These studies strongly suggest that DC play a critical role during the progression of HAM/TSP; however, the mechanism of DC activation and the role of activated DC in the generation of a Tax-specific immune response have not been fully delineated. It was hypothesized that the presentation of Tax peptide by activated DC to naïve T cells likely plays an important role in the continuous stimulation of T cells as well as in the induction of a Tax-specific CTL response observed during HAM/TSP.
The ability of DC to regulate adaptive immunity has been shown to be dependent on their maturation [38 ]. The process of DC maturation results in the increased expression of MHC, costimulatory and adhesion molecules, along with their ability to secrete cytokines and chemokines. DC maturation can be induced by a variety of factors including LPS, inflammatory cytokines, CD40 ligand [39 ], pertussis toxins [40 ], and HIV-1 Tat [41 ]. We have shown previously that HTLV-1 Tax induces the mRNA expression of DC markers associated with activation using a murine DC line, JAWS II [42 ]. In the study reported herein, an extensive, functional analysis of DC maturation is performed using primary human monocyte-derived DC (MDDC) and confirmed with freshly isolated myeloid DC (mDC) after treatment with recombinant Tax as a surrogate for extracellular Tax. This study suggests that DC, once exposed to Tax, undergo activation and maturation and provide antigen presentation as well as costimulation to T cells, leading to the development of an intense, Tax-specific immune response, characteristic of HAM/TSP. This is the first comprehensive study focused on the effects of Tax as an antigen capable of modulating human DC function.
MATERIALS AND METHODS
In vitro generation and culture of primary human DC
Highly purified DC were generated from the PBMC of healthy individuals, as published previously [43
] with certain modifications per Lee et al. [44
]. Briefly, PBMC were isolated from heparinized blood using Ficoll-Paque Plus (Amersham Biosciences, Uppsala, Sweden) density gradient centrifugation and were washed several times in serum-free RPMI-1640 medium (Mediatech, Herndon, VA, USA) supplemented with HEPES (10 mM, Mediatech), sodium pyruvate (1 mM, Mediatech), glucose (4.5 mg/ml, Mediatech), and penicillin (100 U/ml) and streptomycin (100 µg/ml, Mediatech) to remove platelets. Cells were plated in six-well culture plates (Corning, Corning, NY, USA) in RPMI supplemented with 5% pooled human serum (Sigma Chemical Co., St. Louis, MO, USA) at 10 x 106 cells per well and incubated for 6090 min at 37°C to adhere monocytes. Nonadherent cells (PBL) were removed by several washes with serum-free RPMI and frozen in 10% DMSO for future use. The purity of monocytes was always >95%, as assessed by flow cytometry (FACScan, BD Biosciences, San Jose, CA, USA) using allophycocyanin-conjugated anti-CD14 antibody (61D3, isotype mouse IgG1,
, eBioscience, San Diego, CA, USA). The monocyte-enriched, adherent cell population was cultured in 1% normal human plasma (Sigma Chemical Co.) in the presence of recombinant human (rh)GM-CSF (100 IU/ml, Peprotech, Rocky Hill, NJ, USA) and rhIL-4 (300 IU/ml, PeproTech) for 5 days at 37°C and 5% CO2. Cells were provided with fresh cytokines every other day. DC differentiation was confirmed by multicolor FACS analyses for DC surface markers (CD1a, CD11c, CD40, CD80, CD83, CD86, HLA-DR, and DC-SIGN) in conjunction with a lineage cocktail (Lin-1; BD Biosciences) containing antibody clones against CD3, CD14, CD16, CD19, CD20, and CD56, which when used in combination, stain lymphocytes, monocytes, B cells, eosinophils, and neutrophils. Antibodies used were FITC-conjugated Lin-1; PE-conjugated antibody directed against CD1a (HI149, isotype mouse IgG1,
), CD11c (3.9, isotype mouse IgG1,
), CD40 (5C3, isotype mouse IgG1,
), and CD83 (HB15e, isotype mouse IgG1,
); Cy-chrome (PE-Cy5)-conjugated anti-CD80 (2D10.4, isotype mouse IgG1,
) and anti-CD86 (IT2.2, isotype isotype mouse IgG2b,
); and allophycocyanin-conjugated anti-CD11c (3.9, isotype mouse IgG1,
), anti-HLA-DR (G46-6, isotype mouse IgG2a,
), and anti-DC-SIGN (eb209, isotype mouse IgG1,
). Cells were gated to include the Lin-1/HLA-DRhigh+ population, per the new, widely accepted, phenotypic definition of DC [45
]. The negative controls for FACS analyses were isotype-matched FITC/PE/ allophycocyanin/PE-Cy5-labeled, irrelevant antibodies, as indicated, and were used to establish plot boundaries.
Isolation of mDC
Highly purified mDC were generated from PBMC of healthy individuals using a CD1c (blood-DC antigen-1+) DC isolation kit, as described by the manufacturer (Miltenyi Biotec, Auburn, CA, USA). As a subset of B cells also expresses CD1c, B cells were depleted first from the PBMC using CD19 microbeads (Miltenyi Biotec). Cells were subsequently processed for CD1c+ mDC enrichment using anti-CD1c (Miltenyi Biotec), followed by antibiotin microbeads (Miltenyi Biotec). The purity of the isolated mDC population was assessed by flow cytometry by using a FITC-conjugated antibody against Lin-1 (BD Biosciences) and a PE-conjugated antibody against CD11c (eBioscience).
HTLV-1 Tax expression, purification, and treatment
Tax protein was expressed in Escherichia coli HB101 by the pCMV-Tax-His6 expression vector (kindly provided by Dr. Chou-Zen Giam, Uniformed Services, Bethesda, MD, USA) and purified by Ni2+ chromatography using the His-bind purification kit (Novagen, Madison, WI, USA) as described [42
, 43
]. The presence of Tax protein in the preparation was confirmed by Western blot analysis using an anti-Tax mAb (1:50, Tab 170, provided by Dr. Fatah Kashanchi, George Washington University School of Medicine, Washington, DC, USA). The specific, functional activity of purified protein was determined by EMSA using its ability to enhance CREB-1 (provided by Dr. Jennifer Nyborg, Colorado State University, Fort Collins, CO, USA) binding to the HTLV-1, 21-bp promoter-proximal repeat of Tax responsive element-1 (data not shown). A number of measures were taken to ensure the specificity of the purified protein. First, a mock preparation, which included an empty parent plasmid purified along with Tax, was used to demonstrate that the protein purification process did not incorporate copurified factors capable of activating DC. In addition, the purified protein was heat-inactivated at 95°C for 2 h, and its biological inactivation was confirmed by Western blot and EMS analyses. Endotoxoin levels were determined in mock fluid, Tax, and heated Tax preparations and were consistently found to be below the limit of detection (<0.016 EU/µg) as determined by the Limulus amebocyte lysate analysis (Pyrochrome, Associates of Cape Cod, Falmouth, MA, USA). For experiments involving treatment of cells with purified Tax, mock fluid or where indicated, heated Tax was used as negative control, and a conventional DC stimulation agent LPS from E. coli Type 0111:B4 (10 ng/ml, Sigma Chemical Co.) was used as a positive control.
Quantitative immune assays for cytokines and chemokines
ELISA was performed on cell culture supernatants for the detection of cytokines (Ready-SET ELISAs, eBioscience) and ß-chemokines (Quantikine ELISAs, R&D Systems, Minneapolis, MN, USA), as described by the manufacturer. In each case, OD was recorded at 450 nm with a microplate reader (Multiskan Ascent, Thermo Scientific, Milford, MA, USA). A standard curve for each protein was used to extrapolate the amount of cytokine and chemokine in each experimental sample. Experiments were performed in triplicate, and the results were statistically analyzed by one-way ANOVA followed by Students t-test. Differences between groups were considered significant if P < 0.05 were obtained.
RNA extraction and preparation of cDNA
Total RNA was isolated from DC using Qiagens RNeasy mini kit (Valencia, CA, USA). Residual DNA was removed by treatment with 2 U rDNase I (Ambion, Austin, TX, USA) at 37°C for 30 min, followed by inactivation with 5 µl DNase-inactivating reagent (Ambion). The RT reaction was performed with 1 µg total RNA using OmniscriptTM RT enzyme (4 U, Qiagen) in the presence of deoxy (d)NTP mix (0.5 mM each dNTP), oligo dT15 primer (1 µM, Promega, Madison, WI, USA), and SUPERaseInTM RNase inhibitor (10 U, Ambion), and the reaction was allowed to proceed for 1 h at 37°C.
Quantitation of mRNA levels using real-time PCR
Quantitative analysis of mRNA expression was assessed using real-time PCR on an ABI Prism 7700 sequence detector (Applied Biosystems, Foster City, CA, USA) performed in the Center for Molecular and Functional Genomics in the Institute for Molecular Medicine and Infectious Disease, Drexel University College of Medicine (Philadelphia, PA, USA). Primers for each cytokine, chemokine, and ß-actin were designed using Primer3 software using sequence data from SOURCE, a web database (http://source.stanford.edu). Primer sequences (forward/reverse) used were as follows: ß-actin (TGCTGCCATCGTAAACTGAC/CTTCCACAGGGCTTTGTTTC), IL-12 (ATTGTGCCACGCATACCAG/AGGACTGCCATGGAAGCTAA), TNF-
(AACGGAGCTGAACAATAGGC/CAGAGGCTCAGCAATGAGTG), MIP-1
(AGCGACCTAGAGCTGAGTGC/TTGGCAACAACCAGTCCATA), and MIP-1ß (AGCAAGCAAGTCTGTGCTGA/TGTCTCATGGAGAAGCATCC).
The standard, real-time PCR reaction using SYBR Green I consisted of 15 µl SYBR Green PCR master mix (Applied Biosystems), forward and reverse primers (each primer was included at a concentration of 0.2 µM, IDT, Coralville, IA, USA), and 5 µl cDNA in a total volume of 30 µl. The thermal cycling conditions comprised an initial activation step at 95°C for 10 min followed by 40 cycles, including denaturation at 95°C for 15 s and annealing and extension at 60°C for 1 min. Each data-point was analyzed in triplicate. Dissociation or melting curve analysis was performed to ensure the presence of a single peak at the correct melting temperature. Gene expression was measured by the quantitation of cDNA transcribed from mRNA for the Tax-treated samples relative to mock-treated samples. All quantitative determinations were normalized to ß-actin (endogenous control) to account for any variability in the initial concentrations, quality of the total RNA, and the conversion efficiency of the RT reaction. The mean threshold cycle (CT) value for each target gene was subtracted from the mean CT value for ß-actin with each sample to obtain the
CT value. The difference 
CT was calculated from the
CT values of the sample and the mean
CT value of the control. The relative quantitation value (fold-change) was expressed as 2
CT.
FACS analyses of DC maturation
Cell suspensions (0.51.0 x 106 cells/ml in PBS containing 3% FBS and 0.02% sodium azide with more than 90% viability, as determined by trypan blue exclusion) were kept at 4°C during the entire procedure and were incubated for 15 min with anti-CD16/32 to prevent nonspecific binding of the antibodies to the FcRs. Fluorochrome-conjugated antibodies (as described above) were added directly to the cell suspension at the appropriate dilution, mixed, and incubated on ice for 30 min before being washed with FACS staining buffer (eBioscience). Cells were then analyzed directly or fixed with 2% paraformaldehyde (Alfa Aesar, Ward Hill, MA, USA). Four-color FACS analyses were performed using a FACScan (Becton Dickinson, San Jose, CA, USA) after appropriate color compensation, and 30,000 events collected for each sample were gated to include the Lin-1/HLA-DR+ population using FlowJo software (Tree Star, Inc., San Carlos, CA, USA). Each experimental sample was analyzed to determine the percentage of cells positive for DC surface markers and the mean fluorescence intensity (MFI) of the positive population.
Intracellular cytokine detection in mDC
To detect intracellular cyotkine levels in mDC, cells were stimulated with purified Tax (25 nM) for 48 h. During the last 4 h of incubation, cells were treated with 1 µl/ml cell culture of GolgiPlugTM protein transport inhibitor (containing Brefeldin A; BD Biosciences), resulting in the accumulation of cytokines in the Golgi complex, thereby enhancing intracellular cytokine detection. Cells were harvested and processed for FACS analyses by first staining for the surface expression of Lin-1 and CD11c, followed by fixation and permeabilization using a Cytofix/Cytoperm kit (BD PharMingen, San Diego, CA, USA), and subsequently stained intracellularly to detect cytokines TNF-
(mAb11, isotype mouse IgG1,
) and IL-12 (C8.6, isotype mouse IgG1,
) using flurochrome-conjugated antibodies (eBioscience) at the appropriate titer. Multicolor FACS analysis was performed as described above, and 30,000 events collected were gated to include Lin-1/CD11c+ cells. Each sample was analyzed to determine the percentage of cells positive for intracellular cytokines as well as the MFI values.
MLR
Immature DC were first incubated with mock fluid, LPS 0111:B4 (10 ng/ml), Tax (25 nM), or heat-inactivated Tax for 48 h and washed two times with PBS. Treated DC were then added to autologous T cells (2x105 per well) in graded doses (DC:T cell ratio: 1:320, 1:160, 1:80, 1:40, and 1:20) and cocultured for 4 days in 96-well plates. Cells were stained with PE-Cy5-labeled anti-CD3 (eBioscience), fixed, and permeabilized using a Cytofix/CytoPerm kit (BD PharMingen) and stained intracellularly for Ki-67 (a nuclear protein expressed exclusively in proliferating cells during all active stages of the cell cycle) using FITC-labeled anti-Ki-67 (BD PharMingen). T cell proliferation was assessed by FACS analyses. Thirty-thousand events collected for each sample were gated to include CD3+/Ki-67+ cells using FlowJo software. Data were analyzed to determine percentage of CD3+/Ki-67+ cells.
Immunofluorescence and confocal microscopy
For fluorescence microscopy, DC were plated onto Biocoat poly-D-lysine-coated, eight-well, tissue-culture slides (BD Labware, Bedford, MA, USA) at 5 x 104 cells per well in 500 µl medium. Cells were allowed to adhere for 24 h at 37°C and then treated with mock fluid or Tax (25 nM) at the indicated time-points. At various times post-treatment, cells were fixed first with 2% paraformaldehyde (10 min) and then with 4% paraformaldehyde (20 min) at room temperature. After fixation, cells were washed three times with PBS and stored at 4°C in PBS prior to immunofluorescence analyses. When indicated, cells were permeabilized with 0.1% Triton X-100. The primary antibodies included antisera to Tax [1:5000, Cat. No. 712, National Institutes of Health (NIH), AIDS Research and Reference Reagent Program, Bethesda, MD, USA], anti-CD1a (1:200, Cat No. SC-7092, Santa Cruz Biotechnology, Santa Cruz, CA, USA), and anti-DC-SIGN (1:80, Clone #120507, R&D Systems). An appropriate secondary antibody conjugated with Cy-2 (1:200, Jackson Immunoresearch Labs, West Grove, PA, USA), Cy-3 (1:200, Jackson Immunoresearch Labs), or Alexa-Fluor 488 (1:200, Molecular Probes, Eugene, OR, USA) was then added. Hoechst 33342 (0.6 µl/ml, Vector Laboratories Inc., Burlingame, CA, USA) was used for nuclear counterstaining. For conventional fluorescence microscopy, cells were observed under an epifluorescent microscope (Olympus IX-70) connected to a MicroMax charge-coupled device camera (Roper Scientific, Tuscon, AZ). Images were acquired and analyzed using the software Metamorph (Molecular Devices, Downingtown, PA, USA) as described [46
]. Confocal images were obtained with a single laser microscope (Nikon Diaphot 300, connected to a Nikon PCM 2000 camera) using Simple PCI (Pixera, Los Gatos, CA, USA) software or a dual-laser confocal microscope (Leica DMRE connected to a Leica TCS SP2) camera using LCS software (Leica, Bannockburn, IL, USA).
Signaling pathway inhibitors
For the study of signaling pathways, immature DC were pretreated for 30 min with a specific inhibitor of NF-
B activation [tosyl-L-lysine chloromethyl ketone (TLCK); 50 µM and 100 µM, Sigma Chemical Co.], tyrosine kinase [hemagglutinin (HA); 1 µM and 2 µM, Calbiochem, San Diego, CA, USA], protein kinase C (PKC; H7, 5 µM and 10 µM, Calbiochem), PKA (H89, 5 µM and 10 µM, Calbiochem), or phospholipase C (PLC; U73122, 5 µM and 10 µM, Calbiochem). Following treatment with inhibitors, cells were incubated with mock fluid, LPS (0111:B4, 10 ng/ml), or Tax (25 nM) for 24 h, and the analyses of cytokine and chemokine secretion and T cell proliferation were performed as described above.
RESULTS
HTLV-1 Tax enhanced the production of Th1 cytokines and ß-chemokines from MDDC in a dose- and time-dependent manner
The function of DC is associated with their maturation and the production of cytokines (IL-1ß, TNF-
, IL-12, IL-15) and ß-chemokines (MIP-1
, MIP-1ß). Therefore, we have performed extensive dose-response and kinetic analyses of Tax-induced cytokine and chemokine secretion from DC of multiple donors. Immature DC were differentiated from highly purified monocytes and confirmed for their purity by FACS analyses using Lin-1 to confirm the absence of other leukocytes. The Lin-1-negative population was analyzed for the high expression of HLA-DR and low-to-moderate expression of other immature DC markers such as CD1a, CD11c, CD40, CD80, CD83, CD86, HLA-DR, and DC-SIGN, per a new, widely accepted, phenotypic definition of DC [45
]. The purity of the Lin-1/HLA-DR+ population was found consistently to be >90%, indicating that observed effects were a result of DC and not other cell populations.
Dose-response studies were performed to determine the lowest concentration of Tax sufficient to induce detectable secretion of cytokine and chemokine secretion. Immature DC were treated with increasing concentrations of recombinant Tax (0.025250 nM) in parallel with mock fluid as a negative control and LPS as a positive control. Secretion of the cytokines and chemokines was assessed in the supernatants of DC by antigen-specific ELISA. TNF-
, IL-12, MIP-1
, and MIP-1ß were produced reproducibly by DC in the presence of Tax in a dose-dependent manner (Fig. 1
). Our data revealed that Tax, at a concentration as low as 2.5 nM, was sufficient to induce cytokine/chemokine secretion from DC, a concentration known to be released from HTLV-1-infected cells [19
]. However, an optimal response in most cases was observed at 250 nM Tax. Therefore, an intermediate concentration (25 nM) of Tax was selected for the follow-up studies.
![]() View larger version (27K): [in a new window] |
Figure 1. Tax enhanced the production of Th1 cytokines and ß-chemokines by MDDC in a dose-dependent manner. Immature DC were cultured for 5 days in complete growth medium supplemented with GM-CSF and IL-4. Cells were treated with mock fluid, LPS (10 ng/ml), or serial concentrations of Tax (0.025250 nM) for 24 h. Cell culture supernatants were assayed for the quantity of TNF- , IL-12, MIP-1 , and MIP-1ß using specific ELISAs as described. Each data-point represents the mean ± SD of triplicate samples examined by ELISA. *, Statistically significant protein production as compared with mock; P 0.05. Data shown are representative of four different donors.
|
, 4 h for MIP-1
and MIP-1ß, and 24 h for IL-12. The detection of cytokines and chemokines at the protein level used an end-point detection technique and consequently resulted in sustained and maximal production at the later time-points. Nonetheless, with the exception of IL-12, other proteins were detected in the culture supernatants as early as 1 h (MIP-1ß) or 4 h (TNF-
, MIP-1
) with increasing amounts of protein up to 24 h. A multitude of information is derived from these extensive kinetic analyses, which compares Tax effects nicely with those of LPS at the mRNA and the protein level. Although at the level of protein, LPS and Tax appeared to have similar kinetics, RNA analyses indicated a much earlier response to Tax, confirming that the observed effects were not a result of the presence of endotoxin in the Tax preparations and were specific to the protein. Furthermore, as most of the effects were initiated between 1 h and 2 h, an intracellular mechanism of action was indicated. However, any membrane level effect cannot be ruled out at this point and will be investigated in follow-up studies.
![]() View larger version (31K): [in a new window] |
Figure 2. Kinetics of cytokine and chemokine production in DC treated with Tax. Immature DC were untreated or treated with Tax (25 nM) or LPS (10 ng/ml). (A) At various times after treatment, total RNA was isolated, converted to cDNA, and subjected to real-time PCR using gene-specific primers. The Ct values obtained for triplicate samples were averaged and normalized to the levels of ß-actin mRNA, and the fold-change in mRNA expression with respect to the control was calculated. (B) Supernatants were harvested and analyzed for cytokine and chemokine secretion by ELISA. Each data-point shown represents the mean ± SD of triplicate samples. Data shown are representative of four different donors. *, Statistically significant protein production as compared with mock; P 0.05. Data shown are representative of four different donors.
|
Tax-induced surface expression of DC activation and maturation markers
To determine whether Tax stimulated phenotypic changes associated with DC maturation, FACS analyses were performed for the expression of CD83 (a specific surface marker found on matured DC) and costimulatory molecules CD40, CD80, and CD86. Immature DC were treated with mock fluid, LPS, Tax, or heated Tax at 2.5 and 25 nM concentration for 12, 24, and 48 h. For the FACS analyses of DC surface markers, live cells were gated to include the Lin-1/HLA-DR+ population and analyzed for individual DC activation and maturation markers. Cellular responses at 12 h were negligible; therefore, data obtained at 24 and 48 h are presented in Figure 3
, where 48 h represents the optimal response period across the donor range. Changes in the expression of DC surface marker on the positive population were also evident in the significant MFI shifts between the mock- and Tax-stimulated cells (Fig. 4
). LPS resulted in elevated expression levels of all surface molecules, as indicated by the percentage of positive cells (Fig. 3)
and corresponding MFI values (Fig. 4)
. Heat inactivation of Tax abrogated its effects, suggesting that the native structure of the protein was essential to induce DC maturation. The negligible effects following treatment of DC with mock fluid or heated Tax further confirmed the specificity of the Tax response and ruled out any effects as a result of endotoxin contamination or copurifying factors. Collectively, these results suggest that Tax can efficiently induce phenotypic maturation of DC at doses as low as 2.5 nM, a concentration of Tax shown previously to be released from HTLV-1-infected cells in vitro [19
].
![]() View larger version (59K): [in a new window] |
Figure 3. Phenotypic analyses of DC activation and maturation by Tax. Immature DC were treated with mock fluid, LPS (10 ng/ml), Tax (2.525 nM), or heat-inactivated Tax (2.525 nM) for 12, 24, and 48 h. At the end of the incubation period, cells were stained with a lineage cocktail (CD3, CD14, CD16, CD19, CD20, and CD56; Lin-1-FITC) and DC markers (CD40, CD80, CD83, CD86, and HLA-DR) conjugated to PE, PE-Cy5, or allophycocyanin and subjected to FACS analyses. Thirty-thousand events collected for all samples were gated on live cells to include the Lin-1/HLA-DR+ population. The isotype control is represented by a dotted line, solid lines represent specific antibody staining at 24 h, and filled, gray histograms represent specific antibody staining at 48 h. Numbers indicate percentage of cells positive for specific antibody at 24 and 48 h, respectively. Data shown represent the median of one of four different donors.
|
![]() View larger version (44K): [in a new window] |
Figure 4. Quantitation of MFI. Tax-stimulated DC were subjected to FACS analyses as described in Materials and Methods. Mock fluid or heat-inactivated Tax (25 nM) was used as the negative control, and LPS (10 ng/ml) served as the positive control. Cells were gated to include the Lin-1/HLA-DR+ population positive for the indicated surface markers. The y-axis represents the MFI, and the x-axis represents DC activation and maturation surface markers. Data represent the median MFI values of one of four different donors.
|
and IL-12, respectively) from mDC, and mock fluid had negligible effects (8% and 6% Lin-1/CD11c+ cells for TNF-
and IL-12, respectively). Similarly, Tax stimulated phenotypic changes associated with DC maturation, as indicated by MFI shifts in the treated cell population for maturation marker CD83 and costimulatory molecules CD40, CD80, and CD86 (Fig. 5B)
. These results provide confidence toward the use of MDDC as surrogate for mDC in our studies.
![]() View larger version (23K): [in a new window] |
Figure 5. Tax-induced cytokine secretion and maturation of freshly isolated mDC. Blood-derived, fresh mDC were treated with Tax (25 nM) for 48 h and analyzed for intracellular cytokine expression (A) or phenotypic analyses for cell surface markers (B). Live cells were gated to include the Lin-1/CD11c+ population. Data shown are representative of one of three donors.
|
![]() View larger version (48K): [in a new window] |
Figure 6. Stimulation of T cell proliferation in autologous MLR by DC treated with Tax. DC were treated with mock fluid, LPS (10 ng/ml), Tax (25 nM), or heat-inactivated Tax (25 nM) for 48 h and washed two times with PBS. Treated DC were added to autologous T cells (2x105 per well) in graded doses (DC:T cell ratio: 1:320, 1:160, 1:80, 1:40, and 1:20) and were cocultured for 4 days in 96-well plates. Cells were then stained with PE-Cy5-conjugated anti-CD3, fixed, and permeabilized to stain intracellularly for Ki-67 using a FITC-conjugated antibody. T cell proliferation was assessed by FACS analyses of cells positive for CD3/Ki-67. Thirty-thousand collected events were gated to include the live CD3+/Ki-67+ population. The x-axis represents the number of treated DC used to simulate 2 x 105 T cells. The y-axis represents the percentage of CD3+/Ki-67+ cells. When no DC were added, 10% of the cells stained positively for CD3/Ki-67. Data are representative of one of three donors.
|
![]() View larger version (24K): [in a new window] |
Figure 7. Binding and internalization of Tax to human MDDC. Immature DC cultured in chamber slides were treated with mock fluid or purified Tax at the indicated times, washed extensively to remove unbound Tax, and fixed for immunoflourescence. Nonpermeabilized and permeabilized cells were stained with antibodies directed against a DC surface marker DC-SIGN (green) and anti-Tax antibody (red) and counterstained for the visualization of nucleus with Hoechst 33342 (blue), as described in Materials and Methods. (A) Immunofluorescence microscopy depicting positive Tax staining in the cells exposed to Tax, and no Tax staining was observed in mock-treated samples in nonpermeabilized or permeabilized cells (original magnification, 10x). All cells positive for Tax were positive for the DC marker as well. Furthermore, the number of DC positively stained with the surface marker (green) corresponded to the number of positive nuclei (blue). (B) Confocal microscopy demonstrated Tax staining and localization to the surface of DC at early time-points (5 and 30 min). However, by 4 h, Tax was heavily localized to the perinuclear region and made its way into the nucleus by 8 h. Images in each panel are at an original magnification of 40x, and the image shown at the right enlarged to an original magnification of 63x. Cells were fixed and permeabilized at all times after exposure to Tax.
|
B, protein kinases, and PLC in Tax-mediated DC activation and maturation
B by endogenous [47
, 48
] and exogenous Tax [19
, 49
] in lymphoid cells. Therefore, experiments were performed to determine if TLCK, a specific blocker of NF-
B activation, could affect extracellular Tax-induced cytokine and chemokine secretion. DC pretreated with TCLK were exposed to Tax (25 nM) or LPS for 24 h, and culture supernatants were analyzed for the secretion of cytokines and chemokines. Inhibitor treatment abrogated the secretion of TNF-
and MIP-1
completely (Fig. 8
), indicating that Tax-mediated cytokine and chemokine secretion is regulated by NF-
B signaling. As I
B
, the major component of NF-
B, is phosphorylated by protein kinases, the role of tyrosine kinase, PKC, and PKA was investigated similarly using small molecule inhibitors followed by Tax (25 nM) or LPS treatment. As indicated in Figure 8
, tyrosine kinase inhibitor HA, PKC inhibitor H7, and PKA inhibitor H89 had no effect on Tax-mediated TNF-
secretion. The secretion of MIP-1
, however, was inhibited by >50% in the case of all inhibitors, suggesting that the protein kinases may play a role in Tax-mediated chemokine secretion. The role of PLC was examined additionally, and pretreatment of DC with the inhibitor U73122 resulted in the complete abrogation of TNF-
and MIP-1
secretion (Fig. 8)
. Treatment of DC with Tax or any of the pharmacological agents did not affect cell viability (data not shown). Collectively, these results suggest that Tax-mediated effects are regulated by NF-
B and PLC signaling. The protein kinases had no effect on cytokine secretion but appear to play a role in Tax-induced chemokine secretion.
![]() View larger version (23K): [in a new window] |
Figure 8. Role of NF- B, protein kinases, and PLC in Tax-induced cytokine and chemokine secretion. Immature DC were pretreated with the NF- B inhibitor TLCK (50 µM and 100 µM); an inhibitor for tyrosine kinase, HA (1 µM and 2 µM); a PKC inhibitor, H7 (5 µM and 10 µM); a specific blocker for PKA, H89 (5 µM and 10 µM); or a PLC, U73122 (U731; 5 µM and 10 µM), following which, they were exposed to mock fluid, LPS (10 ng/ml), or Tax (25 nM) for 24 h. Culture supernatants were analyzed for the secretion of TNF- and MIP-1 by ELISA. Each data-point represents the percentage of inhibition of cytokine and chemokine production in the presence of the indicated inhibitor, normalized to the effect of the inhibitors in mock-treated samples. Data shown are representative of three different donors.
|
![]() View larger version (39K): [in a new window] |
Figure 9. Mechanism of Tax-mediated T cell proliferation. Immature DC were pretreated with intracellular signaling pathway blockers and then exposed to mock fluid, LPS 0111:B4 (10 ng/ml), or Tax (25 nM), as described in Materials and Methods. Treated DC (2x104) were added to autologous T cells (2x105 per well) and were cocultured for 4 days in 96-well plates. Cells were then stained with PE-Cy5-conjugated anti-CD3, fixed, and permeabilized to stain intracellularly for Ki-67 using a FITC-conjugated antibody. T cell proliferation was assessed by FACS analyses of cells positive for CD3/Ki-67. Thirty-thousand collected events were gated to include a live CD3+/Ki-67+ population. The y-axis represents the number of CD3+/Ki-67+ cells following inhibition of signaling pathways using indicated inhibitors. Data are representative of one of three donors.
|
The presence of antibodies to Tax in the serum of HTLV-1-infected individuals [25
26
27
28
], an intense cell-mediated immune response directed to Tax in a large proportion of HAM/TSP patients [46
], detection of Tax protein in the cell-free supernatant of cells expressing Tax [16
] or transfected with Tax [14
], and the presence of cell-free Tax in the CSF of HAM/TSP patients [29
] suggest that extracellular Tax may have important biological functions outside the infected cell. Numerous studies of HAM/TSP patients have demonstrated the generation of an intense CTL response directed against the Tax1119 peptide. Hanon and colleagues [50
] have reported that CD8+ lymphocytes selectively kill Tax-expressing CD4+ lymphocytes in vitro. Studies have also shown that there is a dominant, protective effect associated with certain HLA class 1 alleles (e.g., HLA-A*201), suggesting that class 1-restricted T lymphocytes play an important role in controlling the HTLV-1 proviral DNA load in vivo [51
]. Studies of DC in HIV-1 and HTLV-1 indicate that infection of DC may play a critical role in the development of T cell abnormalities [52
]. DC have specific antigen-presentation pathways, which allow them to cross-present HLA Class 1-restricted antigens from virus-infected host cells to antigen-specific CD8+ cells. Therefore, we hypothesized that activated DC may play an important role in the proliferation of Tax-specific CD8+ T cells during HTLV-1 infection. A potential source of antigen for DC could be the Tax present in the extracellular environment released from other infected cell types, which could be processed within DC and presented to T cells. An additional source of extracellular Tax may be necrotic or apoptotic HTLV-1-infected cells. A number of studies have suggested that the genesis of HAM/TSP may be in part dependent on Tax to function as an extracellular signaling molecule [16
, 18
19
20
21
22
23
]. At some point during disease progression, cell-free Tax may be internalized by DC and presented in the context of Class I to naive CD8+ T cells. This study focuses on two important aspects of HTLV-1-associated, neurologic disease: first, Tax as an extracellular cytokine and second, the potential role of APC in inducing an autoimmune response that underlies HAM/TSP. Specifically, we have demonstrated the effects of extracellular Tax on the maturation and overall function of human MDDC. The functional properties of DC are strictly dependent on their activation and maturation and their ability to secrete cytokines and chemokines [53
]. DC are powerful producers of key inflammatory and immunoregulatory cytokines and chemokines when coactivated by antigens and adjuvants derived from microbial pathogens [53
]. Consequently, the production of Th1 (IL-12, TNF-
) and Th2 (IL-2, IL-6, IL-10, IL-15) cytokines was examined. IL-12 and TNF-
were found to be secreted reproducibly in a dose- and time-dependent manner. IL-12 and TNF-
are essential for driving a Th1 response [54
] and evidently important in HTLV-1 pathogenesis, as elevated levels of these cytokines have been detected in HAM/TSP patients [55
]. IL-12 augments T cell-mediated cytotoxicity and stimulates the production of TNF-
[56
], which can cause cytotoxic damage to endothelial cells, leading to the breakdown of the blood-brain barrier [57
]. The presence of TNF-
has been demonstrated in the spinal cord lesions of HAM/TSP patients [58
]. Secretion of ß-chemokines assists in DC migration to the lymph node and plays a key role in the effector phase of the lymphocyte response [59
, 60
]. Endogenous Tax has been shown to induce the secretion of MIP-1
, MIP-1ß, and other chemokines [61
62
63
]. MIP-1
has been detected in the CSF of patients with a number of inflammatory neurologic diseases including HAM/TSP [64
]. In the studies reported herein, MIP-1
and MIP-1ß were produced in high amounts with a short exposure of MDDC to Tax. The high and sustained production of these chemokines by MDDC has suggested their capacity to recruit T cells selectively with regulatory properties at sites of inflammation.
We also tested the capability of Tax to induce phenotypic changes in DC. Native but not heat-inactivated Tax was able to enhance the expression of the DC maturation marker CD83, costimulatory molecules CD40, CD80, and CD86, and MHC Class I and II molecules. The response to Tax was comparable with those induced by optimal doses of LPS, a potent agent for DC maturation. A similar pattern of DC response was observed with extracellular HIV-1 Tat protein [41
] and SIV/HIV-like particles [65
]. Heat-inactivated Tax was unable to induce DC maturation, suggesting that the conformation of native Tax structure was required to induce DC maturation. The negligible effects observed with mock fluid and heat-inactivated Tax also confirmed that the observed results were specific to Tax and not a result of endotoxin contamination or copurifying factors. Similar conclusions can be drawn for the T cell proliferation capability of DC once exposed to native Tax. Critical observations relevant to Tax-mediated cytokine secretion and DC maturation were reproducible in mDC isolated ex vivo. Tax stimulated the production of TNF-
and IL-12 as well as induced phenotypic alterations in surface molecule expression of freshly isolated mDC within 48 h.
To delineate the mechanism of Tax activity, we proceeded to examine the uptake of Tax first and its intracellular localization in DC, as Tax activity is highly dependent on its nuclear and/or cytoplasmic distribution [14
, 15
]. It was observed that Tax binds efficiently to the DC cell membrane and can be internalized, potentially contributing to the functional activation of DC. The binding and uptake of Tax by DC could be a specific receptor-ligand interaction or occur via receptor-independent mechanisms, such as a cholesterol-dependent lipid raft pathway [66
]. DC express a repertoire of pathogen-recognition receptors, including TLR and C-type lectins, which can recognize molecular patterns expressed by pathogens [67
]. The mechanism of Tax-mediated DC activation could then involve membrane-based signaling initiated by TLRs or the intracellular activation of transcription factors. Previous studies also suggested that once extracellular Tax enters the cell, it may assume its normal, intracellular role as a transcriptional transactivator [20
]. A well-defined target transcription factor of Tax is NF-
B/Rel, a family of enhancer-binding proteins, which play a central role in cell growth and survival [68
69
70
]. The results of this study confirmed further that NF-
B coupled with protein kinases and PLC plays a critical role in Tax-mediated DC activation and maturation. Studies examining the uptake of Tax are also relevant to examining the processing and presentation of Tax by MDDC and are being explored currently in our laboratory.
Overall results of this study have suggested that native Tax targets APC and can drive a Th1 cellular response in the PB. These results not only establish the Tax role in a HTLV-1-specific immune response but also signify its potential importance as an antigen and/or adjuvant for the production of an effective anti-HTLV-1 vaccine. Consistent with this avenue of thought, HIV-1 Tat protein, tat DNA, or tat expression vectors have been shown to protect vaccinated monkeys challenged with pathogenic virus [71 72 73 74 75 ]. As a package, this study represents a novel approach to investigating HTLV-1 pathogenesis during the course of immunologic and neurologic dysfunction observed in HAM/TSP and will enhance further our ability to fully characterize the interaction of Tax with the APC.
ACKNOWLEDGEMENTS
These studies were supported by United States Public Health Service/NIH grant CA54559 (to B. W.) and DA15014 and DA19808 (to O. M.). The following reagent was obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases, NIH: Antiserum to HTLV-1 Tax from Dr. Kuan-Teh Jeang. We thank Dr. Fatah Kashanchi (George Washington University School of Medicine, Washington, DC, USA) and Dr. C. Z. Giam (Department of Medicine, Case Western Reserve University, Cleveland, OH, USA) for providing anti-Tax antibody. This work was presented during the 12th International Conference on Human Retrovirology, Montego Bay, Jamaica, June 2225, 2005.
Received October 18, 2006; revised February 7, 2007; accepted March 6, 2007.
REFERENCES
B-CBP ternary complex in the cytoplasm Oncogene 24,4521-4530[CrossRef][Medline]
B DNA binding activity after exposure of lymphoid cells to soluble tax1 protein New Biol. 2,1034-1043[Medline]
B and expression of NF-
B-responsive Ig
and TNF ß genes in lymphoid cells" AIDS Res. Hum. Retroviruses 8,724-727[Medline]
light chain expression in lymphoid cells J. Virol. 66,1294-1302
expression by extracellular HTLV-I Tax1 protein: a potential role in HTLV-I pathogenesis Oncogene 7,1749-1755[Medline]
in human neuronal cells by extracellular human T-cell lymphotropic virus type 1 Tax J. Virol. 71,6982-6989[Abstract]
-producing capacity of blood plasmacytoid dendritic cells in human T-cell leukaemia virus type I-infected individuals Br. J. Haematol. 125,568-575[CrossRef][Medline]
B via stimulation of signaling pathways J. Biol. Chem. 270,11745-11748
B from p100 (NF-
B2)-inhibited cytoplasmic reservoirs Proc. Natl. Acad. Sci. USA 91,12634-12638
to blood-brain barrier damage in patients with active multiple sclerosis J. Neuroimmunol. 38,27-33[CrossRef][Medline]
Biochem. Biophys. Res. Commun. 262,429-432[CrossRef][Medline]
in the cerebrospinal fluid of patients with multiple sclerosis and other inflammatory neurological diseases J. Neurol. Sci. 129,223-227[CrossRef][Medline]
B transcription factors Oncogene 18,6910-6924[CrossRef][Medline]
B Cytokine Growth Factor Rev. 12,207-217[CrossRef][Medline]
B by the tax transforming protein of HTLV-1: hijacking cellular I
B kinases Oncogene 18,6948-6958[CrossRef][Medline]This article has been cited by other articles:
![]() |
P. Jain, K. Mostoller, K. E. Flaig, J. Ahuja, V. Lepoutre, T. Alefantis, Z. K. Khan, and B. Wigdahl Identification of Human T Cell Leukemia Virus Type 1 Tax Amino Acid Signals and Cellular Factors Involved in Secretion of the Viral Oncoprotein J. Biol. Chem., November 23, 2007; 282(47): 34581 - 34593. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||