Journal of Leukocyte Biology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.0106046 on March 22, 2007

Published online before print March 22, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0106046v1
81/6/1362    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tumes, D. J.
Right arrow Articles by Dent, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tumes, D. J.
Right arrow Articles by Dent, L. A.
(Journal of Leukocyte Biology. 2007;81:1362-1373.)
© 2007 by Society for Leukocyte Biology

Strain-dependent resistance to allergen-induced lung pathophysiology in mice correlates with rate of apoptosis of lung-derived eosinophils

Damon J. Tumes*, James Cormie*, Michael G. Calvert*, Kalev Stewart*, Christina Nassenstein{dagger}, Armin Braun{dagger}, Paul S. Foster{ddagger},§ and Lindsay A. Dent*,1

* School of Molecular and Biomedical Science, University of Adelaide, Adelaide, South Australia, Australia;
{dagger} Fraunhofer Institute of Toxicology and Experimental Medicine, Hannover, Germany;
{ddagger} Division of Molecular Biosciences, The John Curtin School of Medical Research, The Australian National University, Canberra, ACT, Australia; and
§ School of Biomedical Sciences, Faculty of Health, University of Newcastle, Newcastle, NSW, Australia

1 Correspondence: School of Molecular and Biomedical Science, University of Adelaide, North Tce, Adelaide, South Australia, Australia, 5005. E-mail: lindsay.dent{at}adelaide.edu.au

ABSTRACT

Although exposed to similar allergic and environmental stimuli, not all humans develop asthma. Similarly, mouse strains vary in the degree of pathophysiology seen following induction of experimental asthma. Three mouse strains (CBA/Ca, BALB/c, and C57BL/6) were used to determine if the extent and duration of inflammation influenced the degree of lung tissue damage in an OVA-induced allergic asthma model. Airways obstruction, leukocyte infiltration, edema, eosinophil accumulation, and degranulation were less severe in wild-type (wt) CBA/Ca mice than wt BALB/c and C57BL/6 mice. F1 hybrids of CBA/Ca mice crossed with BALB/c or C57BL/6 mice had bronchoalveolar lavage leukocyte (BAL) and cell-free protein profiles similar to those of the respective disease-susceptible parental strain. IL-5 transgene expression on each of the three genetic backgrounds accentuated the difference between CBA/Ca and the other two strains. Importantly, even when overexpressing IL-5, CBA/Ca mice did not develop substantial airways obstruction. Eosinophils recovered from the airways of allergic wt and IL-5 transgenic (Tg) CBA/Ca mice entered apoptosis at a faster rate than eosinophils from the other parental strains and F1 hybrids. In contrast, eosinophils harvested from the peritoneal cavities of untreated CBA/Ca IL-5 Tg mice had a relatively low rate of apoptosis in vitro. The CBA/Ca mouse strain is therefore relatively resistant to experimental asthma, and this may be a consequence of a propensity for apoptosis of eosinophils recruited into the allergic lung. Restricting survival of a key effector cell may thus limit pathogenesis in this experimental model and in humans.

Key Words: asthma • allergy • necrosis • inflammation • interleukin 5

INTRODUCTION

Asthma is a chronic disorder of the airways, which is characterized by inflammation, airways and tissue eosinophilia, reversible obstruction of airflow, airways hyper-reactivity (AHR), and remodeling of the airways. Eosinophils are often a prominent feature of the inflammatory infiltrate in the tissues and the lumen of airways of asthmatics [1 , 2 ]. Eosinophils play a beneficial role in immunity to some species of parasitic worms [3 4 5 ] and may contribute to host defense against respiratory viruses (reviewed in ref. [6 ]). Considerable experimental and clinical evidence suggests that eosinophils also contribute to the pathology of asthma [7 8 9 10 11 12 13 14 15 ]. Mice partially or totally deficient in eosinophils do not develop AHR [14 , 16 ], mucus hypersecretion and airways obstruction [14 ], peribronchial collagen deposition, or increased airways smooth muscle hyperplasia [11 ]. Eosinophils express products, which may directly damage or remodel tissues, and as APC for T lymphocytes, eosinophils may also sustain and accentuate a Type 2 cytokine bias [17 ]. Numerous studies have indicated that asthma is a polygenic-inherited disease [18 19 20 ]. As in humans, in experimental allergic asthma in mice, genetic background is likely to have a major impact on the severity and resolution of the disease. In this study, we explore the impact of eosinophils and genetic background on the level of inflammation and pathology in experimental allergic asthma in mice.

Murine models of asthma have facilitated the dissection of the complex events potentiating airway inflammation in standardized systems, eliminating the need to consider uncontrolled, environmental and genetic influences, which confound investigations of asthma in humans. Numerous studies in mice have focused on the identification of genes involved in the inflammatory response to aerosolized OVA. Quantitative trait locus analysis has associated the Type 2 cytokine gene cluster with pathophysiology in experimental [21 22 23 ] and human asthma [24 ]. The extent of allergen-induced AHR, mucus production, and airways eosinophilia varies markedly between different mouse strains [25 26 27 28 29 30 31 ], and this may be in part a result of differences in the expression of Type 2 cytokines such as IL-4, IL-5, and IL-13. These cytokines help to determine the nature of the inflammatory response and alter airways function [29 ]. IL-5 drives eosinophilopoiesis and enhances eosinophil survival. Blocking these processes reduces allergen-induced tissue eosinophilia and impairment of lung function in some but not all strains of mice [16 , 32 , 33 ]. On a BALB/c background, defective eosinophilopoiesis in {Delta}dblGATA mice is associated with limited tissue remodeling in a model of asthma but does not prevent the development of AHR or mucus secretion [11 ]. In contrast, in allergic PHIL mice with a C57BL/6 genetic background, where maturing eosinophils are ablated during the expression of eosinophil peroxidase (EPO), the development of mucus hypersecretion and AHR is prevented [14 ].

The persistence of eosinophils in the airways of asthmatics may be dependent, not only on the number of eosinophils recruited but also on the rate of clearance after recruitment [34 , 35 ]. There is an inverse correlation between the number of apoptotic eosinophils present in bronchial biopsies and the severity of asthma symptoms following glucocorticoid treatment [36 ]. In addition, prosurvival cytokine receptor gene expression is increased in eosinophils isolated from the peripheral blood of atopic individuals [37 ]. It therefore seems likely that apoptosis may be a mechanism for the resolution of inflammation in asthma.

In early experiments, we were surprised to find that IL-5 transgenic (Tg) mice of the founder CBA/Ca strain were relatively resistant to the development of airways pathology in several different OVA allergen models [3 ]. However, when the IL-5 transgene was backcrossed into BALB/c and C57BL/6 backgrounds, the asthma phenotype was exacerbated, and in both of these strains, eosinophils have been implicated in the pathogenesis of disease [3 , 5 , 16 , 17 , 38 ]. In the present study, we have used wild-type (wt) and IL-5 Tg mice from CBA/Ca, C57BL/6, and BALB/c strains to investigate the severity and resolution of allergen-induced airways disease. We explored the inheritance of relative susceptibility to asthma in F1 hybrids of these strains and established that disease resistance is associated with high rates of apoptosis in eosinophils recovered from the lungs of allergic mice.

MATERIALS AND METHODS

Animals
An IL-5 transgene, linked to the dominant control region of the human CD2 gene, was introduced into the CBA/Ca founder strain [39 ]. CBA/Ca Tg5C2 IL-5 Tg mice containing ~49 copies of the transgene were used to generate IL-5 Tg BALB/c and C57BL/6 F1 hybrids, and these were then backcrossed to the respective BALB/c and C57BL/6 backgrounds for more than 20 generations [5 , 39 ]. All animals were bred under barrier conditions in the University of Adelaide Medical School Animal House (South Australia). Experimental animals were fed and watered ad libitum and housed in clean, conventional conditions under a controlled cycle of 12 h light. All animals were handled according to University of Adelaide Animal Ethics Committee guidelines.

Immunization and challenge
Light airways challenge
Mice were immunized by i.p. injection of 10 µg chicken egg OVA (Grade V, Sigma Chemical Co., St. Louis, MO, USA), mixed with 1 mg aluminum hydroxide gel (Sigma Chemical Co.) in 50 µl endotoxin-free (ef) PBS on each of Days 0 and 12. Mice were then challenged for 20 min on each of Days 28 and 29 with a nebulizer-generated aerosol (flow rate 6 l/min) of 1% OVA in efPBS or efPBS alone and euthanized on Day 32 by CO2 inhalation.

Heavy airways challenge
Mice were immunized and challenged as for the light challenge protocol described above, except that each animal received 3 x 30 min daily aerosol challenges on Days 22, 24, 26, and 28. Mice were euthanized on Day 30.

Bronchoalveolar lavage (BAL), tissue fixation, and staining
BAL with three aliquots of 1 ml PBS delivered via a cannula into the trachea was performed as described previously [3 ]. The lavage fluid was centrifuged at 300 g for 10 min in a bench-top centrifuge. Lavage cells were resuspended in PBS and counted using a hemocytometer. Differential cell counts were performed on cytocentrifuged preparations stained with Giesma (BDH Laboratory Services, Poole, UK). In several experiments, lungs were removed and fixed without inflation in 10% formalin for at least 48 h before paraffin embedding and preparation of 5 µm sections. All tissue sections were prepared and stained with H&E or periodic acid Schiff (PAS) reagent. Images presented are representative of multiple sections of tissues recovered from animals in four independent experiments. Airways obstruction was measured using Moticam Images Plus v2.0 digital image analysis software (Motic China Group Co., Ltd., Causeway Bay, Hong Kong) and expressed as a ratio of total airway area:airway luminal space.

Measurement of cell-free peroxidase activity
EPO, an eosinophil cytoplasmic granule protein, was measured in the supernatant of BAL fluid (BALF) after removal of cells by centrifugation. All samples were stored at –80°C until required. The EPO assay was performed as described previously [40 , 41 ], except that 2 µl/ml protease inhibitors (Roche Molecular Biochemicals, Indianapolis, IN, USA) were added to the first 1 ml PBS used for BAL. Briefly, EPO activity was determined in duplicate by oxidation of o-phenylene diamine (OPD) in the presence of hydrogen peroxide (Sigma FastTM OPD dihydrochloride tablets, Sigma Chemical Co.). Aliquots (50 µl) of sample were incubated in 96-well flat-bottom plates (Costar, Cambridge, MA, USA) for 10 min with 20 µl MilliQ (MQ) water or with 20 µl EPO-specific inhibitor [40 , 41 ] resorcinol (1,3-benzenediol) (Sigma Chemical Co.) at 1.2 mM in MQ water to distinguish EPO from neutrophil and macrophage myeloperoxidases. OPD (50 µl) substrate solution containing 14.5 mM KBr was added to each well, and the tray was incubated for 30 min in the dark before the addition of 30 µl 3 M HCl to stop the reaction. Absorbance was measured at 490 nm using a Biotrak II plate reader (Biochrom Ltd., Cambridge, UK). EPO activity was calculated using the following equation: EPO activity (Ab490 nm) = (Ab490 nm of sample+PBS) – (Ab490 nm of sample+resorcinol).

Lysates of known concentrations of peritoneal eosinophils from IL-5 Tg mice were used as positive control standards, where a value of 0.25 was equivalent to EPO activity generated by total lysis of 6 x 104 peritoneal eosinophils/ml in 1.5 M NaCl, 5 mM EDTA, 10 mM Tris, and 1% Triton X-100 (pH 7.4) in H2O.

Measurement of cell-free BALF protein
Protein concentrations were measured using a bicinchoninic acid (BCA) protein assay kit (Sigma Chemical Co.). Aliquots (10 µl) were assayed in triplicate in 96-well flat-bottom plates. A standard curve was produced using known concentrations of BSA (Grade V, Sigma Chemical Co.). BCA reagent (190 µl) was added to each well, and the plate was incubated at 37°C for 30 min. Absorbance was measured at 570 nm using an MR 5000 plate reader (Dynatech Laboratories, Chantilly, VA, USA).

Preparation and culture of peribronchial lymph node cells (PBLN)
PBLN, which drain the lungs, were excised and disaggregated in HBSS at 4°C in a glass homogenizer. The resulting single cell suspension was filtered through 70 µm nylon mesh, and viability and concentration were determined using trypan blue and a hemocytometer. The cells were then centrifuged at 500 g for 5 min and resuspended at 1 x 106 cells/ml in RPMI 1640 supplemented with 10% FCS, L-glutamine, and penicillin/gentamycin. Cells were cultured with or without 1 mg/ml OVA at 37°C in 5% CO2 in humidified air for 72 h. Cell-free culture supernatants were then collected and stored in aliquots at –80°C.

Analysis of cytokines
IL-4 and IL-5 concentrations were determined in supernatants from PBLN cell cultures and protease inhibitor-treated BALF by ELISA. Ninety-six-well, flat-bottom, immunoassay plates were coated overnight at 4°C with rat antimouse IL-4 or IL-5 mAb [4 µg/ml, Clone 11B11 for IL-4, and 5 µg/ml, Clone TRFK-5 anti-IL-5 for IL-5]. Plates were blocked with 1% BSA in PBS with 0.05% Tween 20 for 1.5 h at 37ºC and incubated with serial dilutions of PBLN cell culture supernatants, BALF, or purified murine IL-4 and IL-5 standards. IL-4 and IL-5 were detected with biotin-conjugated rat antimouse mAb (1 µg/ml, Clone BVD-6 for IL-4, and 2 µg/ml, Clone TRFK-4 for IL-5) for 1 h at 37°C. Plates were incubated with peroxidase-conjugated streptavidin for 1 h at room temperature and washed, and OPD substrate solution (Sigma Chemical Co.) was added. After an appropriate incubation time, the reaction was stopped with 3 M HCl. Absorbance was measured at 490 nm using a Biotrak II plate reader (Biochrom Ltd.). The sensitivity of the ELISA systems was 30 pg/ml for IL-4 and 40 pg/ml for IL-5.

Quantification of IL-5 receptor {alpha} (IL-5R{alpha}) and CCR3 expression by real-time RT-PCR
BAL was performed 48 h after the last of a series of heavy aerosol challenges with OVA, and BAL cells were washed and resuspended at 2 x 107 cells per/ml. These cells were sorted using a Beckman Coulter Altra FACS using Expo32 MultiCOMP Version 1.2B software (Beckman Coulter, Miami, FL, USA). Eosinophils were selected on the basis of distinctive forward (FSC)- and side-scatter (SSC) properties. Viable and differential cell counts were then performed as described above, and eosinophil purity was determined to be ≥98% for all samples. IL-5R{alpha} chain CCR3 mRNA expression by the purified eosinophils was assessed by real-time RT-PCR. Following DNA digestion with DNAase, total RNA was extracted from ~2 x 106 cells with TRI Reagent (Ambion, Austin, TX, USA) and purified further using an RNeasy mini kit (Qiagen GmbH, Hilden, Germany). Reverse transcription was performed with 200 ng total RNA from each sample according to the manufacturer’s recommendation (Omniscript RT kit, Qiagen). Control samples of 200 ng RNA were treated according to the same protocol, except that water was substituted for reverse transcriptase. Real-time RT-PCR was performed on a Light Cycler (Roche Molecular Biochemicals) using the DNA-binding dye SYBR Green (Light Cycler, Fast Start DNA Master SYBR Green I, Roche Molecular Biochemicals, Mannheim, Germany). The PCR reaction mix contained 2 µl SYBR Green, supplemented with 2.5 mM MgCl2, custom-synthesized primers for porphobilinogen deaminase (PBGD; sense: 5' ACTGTGGTGGCGATGCTG 3', antisense: 5' GCAAGGTTTCCAGGGTCTT 3', GenBank/European Molecular Biology Laboratory (EMBL)/DNA DataBank of Japan (DDBJ) Accession No. BC_003861; calculated product length, 303 bp); for IL-5R{alpha} (sense: 5' AACCACTTTCTGCCTTTCCA 3', antisense: 5' ACTTCCTTTCCTTTCCCACA 3', GenBank/EMBL/DDBJ Accession No. NM_008370; calculated product length, 231 bp); and for CCR3 (5' TCGCTATCCAGAGGGTGAAG 3', antisense 5' GGAAAAAGAGCCGAAGGTGT 3', GenBank/EMBL/DDBJ Accession No. NM_009914; calculated product length, 395 bp, MWG Biotech, Ebersberg, Germany) and 2 µl external standard, cDNA, or control RNA, respectively, in a final volume of 20 µl. The PCR reaction was then performed as described previously [42 ]. PCR products were commercially sequenced (GATC Biotech, Konstanz, Germany) and compared with the GenBank database.

Detection of leukocyte apoptosis
Eosinophil preparations were incubated on ice for 3–5 h to accelerate apoptosis and then cultured for up to 48 h at 37°C in 5% CO2 in humidified air. Apoptosis and viability were determined using Annexin V Fluos according to the manufacturer’s instructions (Roche, Penzberg, Germany). Briefly, BAL cells were resuspended at 4 x 106 cells/ml in RPMI 1640 supplemented with 10% FCS L-glutamine and penicillin/gentamycin, and 100 µl aliquots of each cell suspension were added into each well of a 96-well tray. After incubation, ~2 x 105 cells in 50 µl aliquots were transferred into tubes, washed by centrifugation in 3 ml Annexin V-binding buffer (10 mM Hepes, 140 mM NaCl, 5 mM CaCl2) at 250 g for 5 min, and resuspended in 50 µl apoptosis-labeling solution, consisting of 20 µl Annexin V, 20 µl propidium iodide (PI) at 50 µg/ml (Sigma Chemical Co.), and 1 ml Annexin V-binding buffer. Samples were then incubated at room temperature for 15 min. Control cell samples containing Annexin V or PI alone were included in all experiments. Cells were then washed with 3 ml binding buffer, resuspended in 500 µl binding buffer, and analyzed immediately on FACScan or LSR2 flow cytometers (Becton Dickinson, Franklin Lakes, NJ, USA).

Statistical analysis
Statistical analysis was performed using one- and two-tailed Student’s unpaired t-tests or One-Way ANOVA using the Tukey post-test where appropriate. A confidence interval of 95% was used for all analyses. All statistical analyses were calculated using GraphPad Prism Version 3.00 for Windows (GraphPad, San Diego, CA, USA).

RESULTS

Serum IL-5 and leukocytes in peripheral blood and BAL
wt and IL-5 Tg mice from the CBA/Ca founder strain develop lung inflammation after OVA immunization and aerosol challenge, but it is surprising that few of the other manifestations of allergic airways disease are seen [3 , 5 ]. The IL-5 transgene was backcrossed into BALB/c and C57BL/6 mice, as initial reports suggested that in some disease settings, these strains were prone to developing Type 1 and Type 2 cytokine profiles, respectively. Our intention was to determine the impact of overexpression of IL-5 on asthma immunopathology on these genetic backgrounds.

Serum IL-5 levels were significantly higher in IL-5 Tg CBA/Ca mice compared with IL-5 Tg C57BL/6 animals (Fig. 1A ), and this correlated with peripheral blood eosinophilia (Fig. 1B) , which was most profound in CBA/Ca IL-5 Tg mice (Fig. 1B) . Peripheral blood eosinophil numbers in naïve CBA/Ca mice were approximately two- and tenfold greater than in untreated IL-5 Tg BALB/c and C57BL/6 mice, respectively. In contrast, BAL leukocyte recovery from CBA/Ca mice was the lowest of the three IL-5 Tg strains on each of Days 28–32 P-IMM (data not shown). Eosinophils represented at least two-thirds of leukocytes recovered by BAL from OVA-challenged mice on Day 30 P-IMM and in contrast to the data for peripheral blood, were 2.5- to fivefold more numerous in the BALB/c and C57BL/6 lines than in CBA/Ca mice (Fig. 1C 1D 1D 1F) . Recruitment of leukocytes into the airways was accentuated by overexpression of IL-5, but the relative ranking of cell yields across the three parental genetic backgrounds was the same in wt (Fig. 1C) and IL-5 Tg (Fig. 1D) lines. Eosinophils represented 67–84% and 89–97% of BAL leukocytes in the parental wt and IL-5 Tg lines, respectively (Fig. 1E) . wt and IL-5 Tg CBA/Ca mice had significantly less BAL lymphocytes than the corresponding lines on BALB/c and C57BL/6 backgrounds (Fig. 1F) . Although the total numbers of macrophages recovered were comparable among the three strains, the ratio of macrophages:eosinophils was much lower in wt BALB/c and C57BL/6 mice than in CBA/Ca mice (6, 5, and 24%, respectively). wt and IL-5 Tg F1 progeny were generated from crosses between heterozygous IL-5Tg CBA/Ca mice and wt BALB/c or C57BL/6 mice. Eosinophils were more common in the peripheral blood of untreated IL-5 Tg CBA/Ca parental mice than in naive IL-5 Tg F1 progeny (Fig. 1B) . However, in wt and IL-5 Tg F1 mice immunized and challenged with OVA, total and differential BAL leukocyte counts were more similar to those of the respective BALB/c or C57BL/6 parental lines than to the CBA/Ca parental lines (Fig. 1C 1D 1E 1F) .


Figure 1
View larger version (33K):
[in this window]
[in a new window]

  		Figure 1. Serum IL-5 from naïve, parental mice (A), eosinophils/ml peripheral blood from unchallenged IL-5 Tg parental and F1 IL-5 Tg mice (B), and number of BAL leukocytes recovered on Day 30 postimmunization (P-IMM), 2 days after cessation of heavy aerosol challenge regime (C–F). wt (C, E, F) and IL-5 Tg (D–F) mice of C57BL/6, CBA/Ca, and BALB/c strains and F1 hybrids of CBA/Ca x C57BL/6 and CBA/Ca x BALB/c. Total (C and D) and differential leukocyte numbers (E and F). Data expressed as mean + SEM, n = 3–6 mice/group. ++, CBA/Ca > C57BL/6; #, CBA/Ca > BALB/c, C57BL/6, CBA/Ca x BALB/c, and CBA/Ca x C57BL/6; ##, C57BL/6 < CBA/Ca, BALB/c, CBA/Ca x BALB/c, and CBA/Ca x C57BL/6; *, CBA/Ca < C57BL/6, BALB/c, CBA/Ca x C57BL/6, and CBA/Ca x BALB/c; **, CBA/Ca < C57BL/6, BALB/c, and CBA/Ca x C57BL/6 (P<0.05). Neu, Neutrophil; Lym, lymphocyte; Mac, macrophage.

 
Lung weight and cell-free BALF protein
Increased vascular permeability may cause edema and accumulation of plasma proteins in lung tissues and airways. Gross lung weight and total cell-free protein levels in BALF for samples collected on Day 30 P-IMM were used as markers of edema and vascular permeability, respectively. Lung weights were comparable in OVA-sensitized wt CBA/Ca, BALB/c, and C57BL/6 groups challenged with PBS (Fig. 2A ). Heavy OVA challenge of immunized wt mice resulted in significantly greater lung weights in the BALB/c and C57BL/6 lines but only a slight increase in lung weight in CBA/Ca animals (Fig. 2A) . Lung weights were significantly greater in the OVA-challenged IL-5 Tg groups than in the corresponding wt groups but again, were lowest in the CBA/Ca mice (Fig. 2A) . Protein levels in cell-free BALF were lower for CBA/Ca IL-5 Tg mice than for IL-5 Tg BALB/c and C57BL/6 parental lines and for IL-5 Tg F1 progeny of wt BALB/c and C57BL/6 mice crossed with IL-5 Tg CBA/Ca mice (Fig. 2B) .


Figure 2
View larger version (26K):
[in this window]
[in a new window]

  		Figure 2. Total lung weight (A) and total protein in BAL supernatants (B). Parental wt and IL-5 Tg lines (A) and parental and F1 IL-5 Tg mice (B) were analyzed on Day 30 P-IMM of a heavy challenge regime. Data expressed as mean + SEM, n = 4–6 mice/group. *, CBA/Ca < BALB/c and C57BL/6 in similarly treated wt or IL-5 Tg animals after OVA challenge; **, CBA/Ca < BALB/c, C57BL/6, and F1s of CBA/Ca x BALB/c and CBA/Ca x C57BL/6 crosses (P<0.05).

 
Cell-free BALF EPO
As eosinophil granule proteins may damage airways epithelium and so, accentuate chronic tissue damage, degranulation in the airways lumen was assessed by measuring EPO activity in BAL supernatants. Eosinophil-specific peroxidase activity (i.e., the component inhibited by resorcinol) was significantly lower in CBA/Ca IL-5 Tg mice than in IL-5 Tg C57BL/6 and BALB/c mice. EPO was not detected in BALF from any of the three strains when immunized with OVA but challenged only with PBS (Fig. 3 ).


Figure 3
View larger version (24K):
[in this window]
[in a new window]

  		Figure 3. EPO activity in cell-free BAL supernatants from IL-5 Tg mice on Day 32 P-IMM of a light challenge regime. Data expressed as mean + SEM, n = 4–6 mice/group. *, Significantly different from all other groups (P<0.01). ND, Not detected.

 
Lung histology and airways obstruction
Intense peribronchial and perivascular cellular infiltrates were observed in all sensitized mice challenged with OVA in PBS but not in OVA-sensitized mice exposed to aerosols of PBS alone (Fig. 4 ). Substantial inflammatory infiltrates were seen in OVA-challenged wt mice (see Fig. 4A and 4B , for images representative of wt BALB/c mice), but inflammation was more severe in similarly treated IL-5 Tg animals (Fig. 4C 4D 4E 4F 4G 4H) . Although leukocytes did infiltrate in large numbers into the lung tissues of CBA/Ca mice, this was always less pronounced than in sections from the lungs of BALB/c and C57BL/6 mice (Fig. 4 and not shown). Cellular infiltrates in all strains consisted mostly of eosinophils, but mononuclear cells were also present in significant numbers. Epithelial hyperplasia and thickening of the basement membrane were sometimes evident in BALB/c and C57BL/6 strains but not in CBA/Ca mice. In BALB/c and C57BL/6 mice, the most striking feature, detected using PAS staining, was accumulation of mucus, within the epithelium and obstructing the airways lumen (representative sections in Fig. 4B 4D 4F ). Although scant and patchy PAS staining of epithelial cells was sometimes evident in the airways of allergen-challenged IL-5 Tg CBA/Ca mice, it is most important that little hypersecretion of mucus and occlusion of airways were detected on this genetic background (Fig. 4H) .


Figure 4
View larger version (97K):
[in this window]
[in a new window]

  		Figure 4. Representative lung histology in conducting airways of mice from wt (A and B) and IL-5 Tg (C–H), BALB/c (A and D), C57BL/6 (E and F), and CBA/Ca (G and H) mice. Tissues recovered on Day 30 P-IMM of a heavy challenge regime. All mice immunized with OVA and challenged with aerosols of PBS (A, C, E, G) or OVA (B, D, F, H). Sections treated with PAS reagent, dark staining of mucus in airways and epithelium (arrows). Original magnification, x50. (I) Quantitation of lung histology from sections similar to those represented in (A–H) with the percentage of airway exclusive of epithelium and mucus calculated using digital image analysis software. Data expressed as mean + SEM, n = 4–6 mice per group, ≥4 airways of similar size analyzed/mouse. *, Greater airways obstruction in OVA compared with PBS-challenged groups (P<0.05).

 
Airway obstruction was quantitated by calculating the area of unobstructed airway lumen as a ratio of total airway area, including the epithelium. Airways obstruction was increased significantly in OVA-challenged BALB/c and C57BL/6 IL-5 Tg mice relative to those challenged with PBS alone (Fig. 4I) . There was no significant difference in the airways obstruction indices for CBA/Ca mice exposed to allergen or PBS (Fig. 4I) . Similar results were obtained for wt mice of the three strains (data not shown).

IL-4 and IL-5 in BALF and PBLN cells cultures
As the presence of IL-4 and IL-5 are integral to the development of airways inflammation and accumulation of eosinophils, levels of these cytokines were measured in supernatants from BALF and cultures of PBLN cells. Samples from CBA/Ca mice were in most cases comparable with those from the corresponding wt or IL-5 Tg comparator groups from the other strains (Tables 1 and 2 ). Levels of IL-4 and IL-5 tended to be highest in BALF and cultures of PBLN from IL-5 Tg BALB/c mice. Samples derived from C57BL/6 animals were comparable with or lower than those of the other two strains for both cytokines.


View this table:
[in this window]
[in a new window]

  		Table 1. IL-4 and IL-5 in Cell-Free BALF from OVA-Challenged, wt, and IL-5 Tg Mice

 

View this table:
[in this window]
[in a new window]

  		Table 2. IL-4 and IL-5 Production by Lung-Associated Lymph Node Cells from OVA-Challenged, wt, and IL-5 Tg Mice

 
IL-5R{alpha}- and CCR3-encoding mRNA in BAL eosinophils
To investigate if there were fewer eosinophils in the airways of allergic CBA/Ca mice because of lower levels of expression of receptors important for eosinophil mobilization and recruitment, mRNA specific for IL-5R{alpha} and CCR3 was measured in purified BAL eosinophils by quantitative real-time RT-PCR. BAL eosinophils from wt CBA/Ca mice had significantly higher levels of mRNA encoding the IL-5R{alpha} than cells derived from the other two strains (Fig. 5B ). Expression of the eotaxin receptor CCR3 was similar across all three strains (Fig. 5C) .


Figure 5
View larger version (17K):
[in this window]
[in a new window]

  		Figure 5. IL-5R{alpha} and CCR3 mRNA expression was assessed in purified BAL eosinophils from CBA/Ca, BALB/c, and C57BL/6 mice on Day 32 P-IMM of a light challenge regime. (A) After amplification by quantitative RT-PCR, probes were run onto an agarose gel and visualized by staining with ethidium bromide for end-point analysis (product lengths: IL-5R{alpha}=231 bp; CCR3=395 bp; PBGD=303 bp). For quantification, the ratios of IL-5R{alpha} (B) and CCR3 (C) mRNAs and the mRNA of the housekeeping gene PBGD were calculated. Data expressed as mean + SEM, n = 8 mice per group; M, molecular weight markers 1–1000 bp; PBGD, housekeeping gene; RNA, control; *, CBA/Ca < BALB/c and C57BL/6 (P<0.05).

 
Apoptosis in BAL eosinophils
Eosinophils represented as much as 97% of BAL leukocytes in allergic animals. Where the proportion and absolute numbers of eosinophils were lowest (i.e., in CBA/Ca mice), the pathology was relatively limited. Rapid apoptosis may curtail the accumulation of eosinophils at inflammatory sites and could be one mechanism through which pathology is controlled. TUNEL staining was used initially to detect apoptotic cells in situ, but few were found in lung tissues from any strain (data not shown). Apoptosis detected with Annexin V was more obvious in BAL eosinophils, although the numbers of apoptotic cells detected were still low. Immediately after recovery, on Day 30, apoptotic BAL eosinophils (Annexin V+/PI–) from allergic C57BL/6, CBA/Ca, and BALB/c IL-5 Tg mice represented 1.7, 1.2, and 1.7 (x105) of all BAL eosinophils, respectively (or 1.0, 2.2, and 2.0% of BAL eosinophils, respectively).

The accumulation of eosinophils in the airways lumen is likely to be influenced by three major rate-limiting factors: recruitment, apoptosis, and clearance of apoptotic cells by macrophages. We decided to assess the rate of generation of apoptotic cells in vitro, as clearance was likely to be far less efficient than the remarkably rapid process typically seen in vivo in a variety of tissues and in our study in the allergic lung. Apoptosis in eosinophils is readily induced by incubation on ice for 2–5 h, and this became more obvious when cells were then cultured at 37°C. BAL leukocytes were cultured for up to 48 h, and eosinophils were identified using flow cytometry by distinctive FSC and SSC characteristics. Representative FSC/SSC dot-plots (Fig. 6A ) for BAL cells from OVA-challenged and -immunized IL-5 Tg CBA/Ca mice cultured for 0, 4, 10, and 22 h illustrate the accumulation over time of an "eosinophil" subpopulation with reduced FSC. The same cells initially bound Annexin V (early apoptosis, Annexin V+/PI–) and ultimately progressed into the late apoptotic (Annexin V+/PI+) stage, as is demonstrated in Figure 6B , as a significant Annexin V–/PI+ subpopulation was never seen.


Figure 6
View larger version (49K):
[in this window]
[in a new window]

  		Figure 6. Flow cytometric analysis of apoptosis of BAL leukocytes from allergic IL-5 Tg CBA/Ca mice after 0, 4, 10, and 22 h of culture. FSC (FSC-H) and SSC (SSC-H) profiles (A) and two-color dot-plots showing PI (FL-3-H, red) uptake and Annexin V (FL-1-H, green) binding (B). Cells recovered on Day 30 P-IMM of a heavy challenge regime and were pooled from five mice/group. Eosinophils identified by FSC/SSC profile (Gate R1) were analyzed further for PI and Annexin V staining. A total of 10,000 events acquired per sample. Over time in culture, a subpopulation of cells with lower FSC emerged from the eosinophil population (A). As FSC reduced, cells progress from viable (Annexin V+/PI–, Quadrant Q3) to early apoptotic (Annexin V+/PI–, Quadrant 4) to late apoptotic (Annexin V+/PI–, Quadrant 2).

 
The rate and extent of loss of viable eosinophils during culture (i.e., exit from Annexin V–/PI– quadrant) were greatest for cells from IL-5 Tg CBA/Ca mice (Fig. 7A ). This difference was significant when cells from CBA/Ca and BALB/c mice were compared at all time-points greater than 2 h and for comparisons of cells from CBA/Ca and C57BL/6 mice at 4 and 10 h, with a similar trend for the latter throughout most of the time course (Fig. 7A) . These results were confirmed by flow cytometry using FSC/SSC and also by microscopy and manual counting of cells treated with trypan blue (not shown). The rate and extent of accumulation of early apoptotic (Annexin V+/PI–) eosinophils were significantly higher in the CBA/Ca Tg mice after 6 and 10 h of culture (Fig. 7B) . The same relative rates of apoptosis were identified when wt CBA/Ca, BALB/c, and C57BL/6 mice were examined, and eosinophils from CBA/Ca mice underwent apoptosis faster than those from the other two strains (data not shown). BAL eosinophils from allergic IL-5 Tg F1 hybrids of asthma-resistant IL-5 Tg CBA/Ca mice and asthma-sensitive wt C57BL/6 or BALB/c mice showed similar rates of loss of viability (Fig. 7C) and apoptosis (not shown) as the disease-susceptible parental strains. In contrast to the data for eosinophils, in five experiments analyzed in detail, there was no consistent trend in differential rates of viability or apoptosis in the lymphocytes also present in cultures, and greater than 95% remained viable after 2 days.


Figure 7
View larger version (27K):
[in this window]
[in a new window]

  		Figure 7. Percentage of viable (A) and apoptotic (B) BAL eosinophils from allergic IL-5 Tg C57BL/6, CBA/Ca, and BALB/c mice and viability of BAL eosinophils from allergic IL-5 Tg F1 hybrids of these strains (C) after culture for 0–48 h. Cumulative data (A and B) from four separate experiments (mean+SEM, cells from five mice were pooled for each strain) and data from a single experiment with cells pooled from five mice/group (C), representative of three separate experiments in wt and IL-5 Tg mice. Cells recovered on Day 30 P-IMM of a heavy challenge regime. Ten thousand events analyzed per sample. Percentage of viable (Annexin V–/PI–) and apoptotic (Annexin V+/PI–) cells derived from plots similar to those represented in Figure 6B . *, Significantly different from CBA/Ca at the same time-point (P<0.05).

 
Eosinophils are a potent source of reactive oxygen species (ROS), and this may be one trigger for the induction of apoptosis. The antioxidant Mn(III) tetrakis(5,10,15,20-benzoic acid)porphyrin (MnTBAP) blocks the generation of ROS and prevents the apoptosis of T cells activated in vivo and cultured in vitro by inducing the antiapoptotic protein Bcl-2 [43 , 44 ]. However, addition of 100–300 µM MnTBAP in BAL leukocyte cultures had no obvious effect on eosinophil apoptosis in our study (data not shown).

Apoptosis in peritoneal eosinophils
In the apparent absence of inflammatory stimuli, eosinophils accumulate spontaneously in the peritoneal cavity in IL-5 Tg mice [39 ]. These cells were used to determine if the higher rate of apoptosis in BAL eosinophils from allergic CBA/Ca mice was an intrinsic feature of all eosinophils from this strain. We examined apoptosis of cultured, noninflammatory eosinophils recovered from the peritoneal cavities of untreated IL-5 Tg CBA/Ca, BALB/c, and C57BL/6 mice. For the three IL-5 Tg lines available, the rate and extent of loss of viability (exit from Annexin V–/PI– quadrant) were lowest for eosinophils from the peritoneal cavities of the CBA/Ca mice. This difference was significant when cells from CBA/Ca mice were compared with those from C57BL/6 mice at all but the 2h time-point and at all time-points when compared with cells from BALB/c mice (Fig. 8A ). The rate and extent of accumulation of early apoptotic (Annexin V+/PI–) peritoneal eosinophils were also significantly lower in the CBA/Ca Tg mice after 4 and 6 h of culture (Fig. 8B) .


Figure 8
View larger version (27K):
[in this window]
[in a new window]

  		Figure 8. Percentage of viable (A) and apoptotic (B) peritoneal cavity eosinophils from individual, untreated IL-5 Tg C57BL/6, CBA/Ca, and BALB/c mice after cultures for 0–48 h. Ten thousand events analyzed per sample. Data expressed as mean + SEM, n= 4 mice/group. Percentage of viable cells (Annexin V–/PI–) and percentage apoptotic cells (Annexin V+/PI–) from plots similar to those represented in Figure 6B . *, Significantly different from BALB/c and C57BL/6 at the same time-point; **, significantly different from BALB/c at the same time-point (P<0.05).

 
DISCUSSION

This study highlights differences in susceptibility to allergic airways disease in three common laboratory strains and identifies a potential mechanism through which disease progression might be limited. The CBA/Ca strain was shown to be relatively resistant to allergen-induced disease, even when eosinophilia was exacerbated by overexpression of IL-5. In contrast, BALB/c and C57BL/6 mice showed a strong propensity to develop the full asthma phenotype, and this was enhanced further by IL-5 transgene expression. F1 crosses between the asthma-resistant CBA/Ca strain, and the BALB/c or C57BL/6 mice were prone to asthma, suggesting that the susceptibility phenotype is dominant. Tight regulation of eosinophil survival during inflammation may be one of several factors, which determine why CBA/Ca mice have fewer BAL and lung tissue eosinophils and develop relatively few of the symptoms characteristic of asthma.

Strains of mice used in experimental studies of asthma differ in disease profile and in mechanisms underlying the disease process [11 , 16 , 25 , 26 , 29 , 30 , 45 , 46 ]. Although strain-specific differences have contributed to some confusion and much speculation in the field [47 ], our studies and several others [25 , 26 , 28 29 30 ] present opportunities to understand the genetics of asthma pathology and to identify unique mechanisms that contribute to the induction and maintenance of lung inflammation. BALB/c and C57BL/6 mice differ in the nature of the pathophysiology [11 , 14 , 32 ] of allergic airways disease and also exhibit variations in underlying mechanisms [16 , 30 , 32 ], but both strains do develop most of the characteristics of asthma. BALB/c and C57BL/6 animals developed a typical asthma phenotype, characterized by inflammatory cell recruitment to the airways, tissue and airways eosinophilia, extensive production of mucus, and airways obstruction, lung edema, and evidence of increased vascular permeability (this study and refs. [16 , 17 , 27 ]). In contrast, we have shown here that CBA/Ca mice developed few of these characteristics after allergen challenge, even when eosinophilia was enhanced by IL-5 transgene expression.

We have shown previously that in BALB/c mice immunized and challenged with OVA, most eosinophil degranulation occurs in the airways lumen rather than in lung tissues. We have also shown that EPO in cell-free BALF correlates directly with airways eosinophilia and AHR in wt and IL-5 Tg BALB/c mice [48 ]. Eosinophil degranulation within airways, measured in the current study as EPO in cell-free BALF, was most pronounced in the asthma-susceptible BALB/c and C57BL/6 strains. As IL-5 Tg CBA/Ca mice are highly resistant to some parasitic nematode species via mechanisms that include rapid degranulation of eosinophils [3 ], we are confident that eosinophils in this strain can degranulate readily and effectively in other disease states. The release of EPO and/or other eosinophil products may trigger increased vascular permeability, edema, and mucus hypersecretion, all of which are likely to contribute to the increased lung weights and high protein levels seen most predominantly in BALB/c and C57BL/6 mice. Vascular endothelial growth factor, a product of eosinophils, which is found in elevated levels in the lungs of asthmatics [49 ], may be one trigger for the vascular permeability and edema seen in our study. Our data suggest that the eosinophils present in the lungs of allergic CBA/Ca mice are not particularly active in contributing to these aspects of asthma pathology or are eliminated before becoming so.

IL-4 and IL-5 make significant contributions to the immunopathology of asthma. However, the relative lack of pathology in the lungs of allergic CBA/Ca mice was not a result of a localized deficiency in either of these cytokines. The levels of expression of IL-4 and IL-5 in the lungs or regional lymph nodes of BALB/c and C57BL/6 mice were similar to those in other studies [25 , 26 ], and importantly, that the expression of these cytokines in CBA/Ca mice was at levels at least comparable with those associated with pathology in the C57BL/6 strain. IL-4 regulates IgE production, and elevated levels of this Ig isotype are a characteristic feature of intrinsic and extrinsic asthma [50 ]. However, the variation in lung pathophysiology between strains seen in this study cannot be explained in terms of differences in IgE production. OVA-specific IgE detected by ELISA [51 ] and cutaneous anaphylaxis to OVA (J. Cormie and L. A. Dent, unpublished) are comparable in C57BL/6 and CBA mice.

After allergen challenge, less eosinophils accumulated in the lungs of IL-5 Tg CBA/Ca mice than in the other IL-5 Tg parental strains and F1 hybrids. Nevertheless, BAL eosinophil numbers in CBA/Ca mice expressing the IL-5 transgene were comparable with those in wt BALB/c mice, and yet, only the latter developed extensive pathology. Eosinophil recruitment, activation, and survival can be influenced by IL-4 and IL-5 [52 53 54 55 ]. IL-4 promotes the production of the eosinophil-specific chemokine eotaxin in the lungs of allergen-challenged mice [55 ], and IL-5 is a growth, differentiation, and survival factor for eosinophils [39 , 56 , 57 ]. In IL-5 Tg mice, serum IL-5 and peripheral blood eosinophil levels were highest on the CBA/Ca background, suggesting that the production and release of eosinophils into the blood are fully functional in these animals. IL-5 and eotaxin promote eosinophil accumulation in airways [58 ] and are sufficient to cause the production of IL-13 in the lungs [59 ]. Disruption of the IL-5R{alpha} chain [33 ] or the eotaxin receptor CCR3 [60 ] in mice prevents allergen-induced recruitment of eosinophils to the lungs and the development of AHR. We have shown that expression of IL-5R{alpha} chain- and CCR3-specific mRNA in BAL eosinophils was comparable in all three strains.

The absolute number of eosinophils accumulating in the lungs may be controlled by selective apoptosis before the cells become fully functional, thus preventing further contribution to inflammation and tissue damage. When BAL leukocytes from all three parental strains were cultured in vitro, eosinophils from the CBA/Ca strain were the first to enter apoptosis. It is significant that BAL eosinophils from F1 hybrids of BALB/c or C57BL/6 mice with CBA/Ca animals also lost viability at rates comparable with those of the disease-susceptible, parental strains. This provides further support to the hypothesis that factors controlling relative susceptibility to experimental asthma are associated with those regulating apoptosis in eosinophils.

Apoptotic cells are not readily detectable in lymphoid and inflamed tissues, presumably because of rapid clearance by macrophages. Hence, the low levels of apoptotic eosinophils in lung tissues and in BAL immediately after lavage may not be truly indicative of the rates of apoptosis actually occurring in situ. It is also worth noting that macrophages were a more prominent proportion of the population of BAL cells in CBA/Ca mice than in samples recovered from other strains, and this might be a factor in clearance of eosinophils.

We have yet to determine why BAL eosinophils from allergic CBA/Ca mice undergo apoptosis more readily than those from the other parental strains and the F1 hybrids. Attempts to block the apoptosis of BAL eosinophils with the ROS inhibitor MnTBAP were unsuccessful. Up-regulation of expression of Fas, a trigger for induction of apoptosis in lymphocytes, did not occur in our eosinophil cultures for at least 24 h, long after apoptotic cells were first detected in significant numbers. Analysis of apoptosis pathway proteins using Western blotting has thus far not revealed any differences in expression between the strains (unpublished data). Eosinophils from CBA/Ca mice are also not universally more prone to apoptosis than those from other strains. Resident peritoneal eosinophils recovered from untreated CBA/Ca IL-5 Tg mice underwent apoptosis at a slower rate than those from IL-5 Tg BALB/c or C57BL/6 mice. This suggests that in CBA/Ca mice, elements within the inflammatory environment of the allergic lung may restrict the lifespan of the eosinophils recruited.

In summary, our data suggest that the development of the asthmatic phenotype in CBA/Ca mice may in part be limited by rapid and timely clearance of eosinophils. This is consistent with a significant body of work in humans [35 36 37 , 61 ]. We propose that it should be possible to identify elements in the genetic background of CBA/Ca mice, which regulate eosinophil survival in the environment of the allergic lung and thus, the degree to which these cells can contribute to tissue damage and airways obstruction. This information should then provide a better understanding of how asthma in humans might be treated more effectively or even prevented.

ACKNOWLEDGEMENTS

This work was supported in part by grants from the National Health and Medical Research Council, the Rebecca L. Cooper Medical Research Foundation, and the Clive and Vera Ramaciotti Foundations.

Received January 22, 2006; revised January 19, 2007; accepted February 12, 2007.

REFERENCES

  1. Sampson, A. P. (2000) The role of eosinophils and neutrophils in inflammation Clin. Exp. Allergy 30,22-27[CrossRef][Medline]
  2. Ehrlich, J. C., Romanoff, A. (1951) Allergic granuloma of the lung; clinical and anatomic findings in a patient with bronchial asthma and eosinophilia AMA Arch. Intern. Med. 87,259-268[CrossRef][Medline]
  3. Dent, L. A., Daly, C., Geddes, A., Cormie, J., Finlay, D. A., Bignold, L., Hagan, P., Parkhouse, R. M., Garate, T., Parsons, J., Mayrhofer, G. (1997) Immune responses of IL-5 transgenic mice to parasites and aeroallergens Mem. Inst. Oswaldo Cruz 92,45-54[Medline]
  4. Dent, L. A., Daly, C. M., Mayrhofer, G., Zimmerman, T., Hallett, A., Bignold, L. P., Creaney, J., Parsons, J. C. (1999) Interleukin-5 transgenic mice show enhanced resistance to primary infections with Nippostrongylus brasiliensis but not primary infections with Toxocara canis Infect. Immun. 67,989-993[Abstract/Free Full Text]
  5. Dent, L. A. (2002) For better or worse: common determinants influencing health and disease in parasitic infections, asthma and reproductive biology J. Reprod. Immunol. 57,255-272[CrossRef][Medline]
  6. Rosenberg, H. F., Domachowske, J. B. (2001) Eosinophils, eosinophil ribonucleases, and their role in host defense against respiratory virus pathogens J. Leukoc. Biol. 70,691-698[Abstract/Free Full Text]
  7. Brusselle, G. G., Kips, J. C., Tavernier, J. H., van der Heyden, J. G., Cuvelier, C. A., Pauwels, R. A., Bluethmann, H. (1994) Attenuation of allergic airway inflammation in IL-4 deficient mice Clin. Exp. Allergy 24,73-80[CrossRef][Medline]
  8. Eum, S. Y., Haile, S., Lefort, J., Huerre, M., Vargaftig, B. B. (1995) Eosinophil recruitment into the respiratory epithelium following antigenic challenge in hyper-IgE mice is accompanied by interleukin 5-dependent bronchial hyperresponsiveness Proc. Natl. Acad. Sci. USA 92,12290-12294[Abstract/Free Full Text]
  9. Flood-Page, P., Menzies-Gow, A., Phipps, S., Ying, S., Wangoo, A., Ludwig, M. S., Barnes, N., Robinson, D., Kay, A. B. (2003) Anti-IL-5 treatment reduces deposition of ECM proteins in the bronchial subepithelial basement membrane of mild atopic asthmatics J. Clin. Invest. 112,1029-1036[CrossRef][Medline]
  10. Frigas, E., Motojima, S., Gleich, G. J. (1991) The eosinophilic injury to the mucosa of the airways in the pathogenesis of bronchial asthma Eur. Respir. J. Suppl. 13,123s-135s[Medline]
  11. Humbles, A. A., Lloyd, C. M., McMillan, S. J., Friend, D. S., Xanthou, G., McKenna, E. E., Ghiran, S., Gerard, N. P., Yu, C., Orkin, S. H., Gerard, C. (2004) A critical role for eosinophils in allergic airways remodeling Science 305,1776-1779[Abstract/Free Full Text]
  12. Kay, A. B. (1991) Asthma and inflammation J. Allergy Clin. Immunol. 87,893-910[CrossRef][Medline]
  13. Kung, T. T., Stelts, D. M., Zurcher, J. A., Adams, G. K., III, Egan, R. W., Kreutner, W., Watnick, A. S., Jones, H., Chapman, R. W. (1995) Involvement of IL-5 in a murine model of allergic pulmonary inflammation: prophylactic and therapeutic effect of an anti-IL-5 antibody Am. J. Respir. Cell Mol. Biol. 13,360-365[Abstract]
  14. Lee, J. J., Dimina, D., Macias, M. P., Ochkur, S. I., McGarry, M. P., O’Neill, K. R., Protheroe, C., Pero, R., Nguyen, T., Cormier, S. A., Lenkiewicz, E., Colbert, D., Rinaldi, L., Ackerman, S. J., Irvin, C. G., Lee, N. A. (2004) Defining a link with asthma in mice congenitally deficient in eosinophils Science 305,1773-1776[Abstract/Free Full Text]
  15. Mauser, P. J., Pitman, A. M., Fernandez, X., Foran, S. K., Adams, G. K., III, Kreutner, W., Egan, R. W., Chapman, R. W. (1995) Effects of an antibody to interleukin-5 in a monkey model of asthma Am. J. Respir. Crit. Care Med. 152,467-472[Abstract]
  16. Foster, P. S., Hogan, S. P., Ramsay, A. J., Matthaei, K. I., Young, I. G. (1996) Interleukin 5 deficiency abolishes eosinophilia, airways hyperreactivity, and lung damage in a mouse asthma model J. Exp. Med. 183,195-201[Abstract/Free Full Text]
  17. MacKenzie, J. R., Mattes, J., Dent, L. A., Foster, P. S. (2001) Eosinophils promote allergic disease of the lung by regulating CD4(+) Th2 lymphocyte function J. Immunol. 167,3146-3155[Abstract/Free Full Text]
  18. Duffy, D. L., Martin, N. G., Battistutta, D., Hopper, J. L., Mathews, J. D. (1990) Genetics of asthma and hay fever in Australian twins Am. Rev. Respir. Dis. 142,1351-1358[Medline]
  19. Nieminen, M. M., Kaprio, J., Koskenvuo, M. (1991) A population-based study of bronchial asthma in adult twin pairs Chest 100,70-75[CrossRef][Medline]
  20. Skadhauge, L. R., Christensen, K., Kyvik, K. O., Sigsgaard, T. (1999) Genetic and environmental influence on asthma: a population-based study of 11,688 Danish twin pairs Eur. Respir. J. 13,8-14[Abstract]
  21. Ewart, S. L., Mitzner, W., DiSilvestre, D. A., Meyers, D. A., Levitt, R. C. (1996) Airway hyperresponsiveness to acetylcholine: segregation analysis and evidence for linkage to murine chromosome 6 Am. J. Respir. Cell Mol. Biol. 14,487-495[Abstract]
  22. Ewart, S. L., Kuperman, D., Schadt, E., Tankersley, C., Grupe, A., Shubitowski, D. M., Peltz, G., Wills-Karp, M. (2000) Quantitative trait loci controlling allergen-induced airway hyperresponsiveness in inbred mice Am. J. Respir. Cell Mol. Biol. 23,537-545[Abstract/Free Full Text]
  23. De Sanctis, G. T., Merchant, M., Beier, D. R., Dredge, R. D., Grobholz, J. K., Martin, T. R., Lander, E. S., Drazen, J. M. (1995) Quantitative locus analysis of airway hyperresponsiveness in A/J and C57BL/6J mice Nat. Genet. 11,150-154[CrossRef][Medline]
  24. Zhang, Y., Lefort, J., Kearsey, V., Lapa e Silva, J. R., Cookson, W. O., Vargaftig, B. B. (1999) A genome-wide screen for asthma-associated quantitative trait loci in a mouse model of allergic asthma Hum. Mol. Genet. 8,601-605[Abstract/Free Full Text]
  25. Zhang, Y., Lamm, W. J., Albert, R. K., Chi, E. Y., Henderson, W. R., Jr, Lewis, D. B. (1997) Influence of the route of allergen administration and genetic background on the murine allergic pulmonary response Am. J. Respir. Crit. Care Med. 155,661-669[Abstract]
  26. Herz, U., Braun, A., Ruckert, R., Renz, H. (1998) Various immunological phenotypes are associated with increased airway responsiveness Clin. Exp. Allergy 28,625-634[CrossRef][Medline]
  27. Hussell, T., Georgiou, A., Sparer, T. E., Matthews, S., Pala, P., Openshaw, P. J. (1998) Host genetic determinants of vaccine-induced eosinophilia during respiratory syncytial virus infection J. Immunol. 161,6215-6222[Abstract/Free Full Text]
  28. Shinagawa, K., Kojima, M. (2003) Mouse model of airway remodeling: strain differences Am. J. Respir. Crit. Care Med. 168,959-967[Abstract/Free Full Text]
  29. Whitehead, G. S., Walker, J. K., Berman, K. G., Foster, W. M., Schwartz, D. A. (2003) Allergen-induced airway disease is mouse strain dependent Am. J. Physiol. Lung Cell. Mol. Physiol. 285,L32-L42[Abstract/Free Full Text]
  30. Takeda, K., Haczku, A., Lee, J. J., Irvin, C. G., Gelfand, E. W. (2001) Strain dependence of airway hyperresponsiveness reflects differences in eosinophil localization in the lung Am. J. Physiol. Lung Cell. Mol. Physiol. 281,L394-L402[Abstract/Free Full Text]
  31. Hylkema, M. N., Hoekstra, M. O., Luinge, M., Timens, W. (2002) The strength of the OVA-induced airway inflammation in rats is strain dependent Clin. Exp. Immunol. 129,390-396[CrossRef][Medline]
  32. Hamelmann, E., Cieslewicz, G., Schwarze, J., Ishizuka, T., Joetham, A., Heusser, C., Gelfand, E. W. (1999) Anti-interleukin 5 but not anti-IgE prevents airway inflammation and airway hyperresponsiveness Am. J. Respir. Crit. Care Med. 160,934-941[Abstract/Free Full Text]
  33. Tanaka, H., Kawada, N., Yamada, T., Kawada, K., Takatsu, K., Nagai, H. (2000) Allergen-induced airway inflammation and bronchial responsiveness in interleukin-5 receptor {alpha} chain-deficient mice Clin. Exp. Allergy 30,874-881[CrossRef][Medline]
  34. Kodama, T., Matsuyama, T., Miyata, S., Nishimura, H., Nishioka, Y., Kitada, O., Sugita, M. (1998) Kinetics of apoptosis in the lung of mice with allergic airway inflammation Clin. Exp. Allergy 28,1435-1443[CrossRef][Medline]
  35. Walsh, G. M. (2000) Eosinophil apoptosis: mechanisms and clinical relevance in asthmatic and allergic inflammation Br. J. Haematol. 111,61-67[CrossRef][Medline]
  36. Haslett, C. (1999) Granulocyte apoptosis and its role in the resolution and control of lung inflammation Am. J. Respir. Crit. Care Med. 160,S5-11[Abstract/Free Full Text]
  37. Ogawa, K., Hashida, R., Miyagawa, M., Kagaya, S., Sugita, Y., Matsumoto, K., Katsunuma, T., Akasawa, A., Tsujimoto, G., Saito, H. (2003) Analysis of gene expression in peripheral blood eosinophils from patients with atopic dermatitis and in vitro cytokine-stimulated blood eosinophils Clin. Exp. Immunol. 131,436-445[CrossRef][Medline]
  38. Mattes, J., Yang, M., Mahalingam, S., Kuehr, J., Webb, D. C., Simson, L., Hogan, S. P., Koskinen, A., McKenzie, A. N., Dent, L. A., Rothenberg, M. E., Matthaei, K. I., Young, I. G., Foster, P. S. (2002) Intrinsic defect in T cell production of interleukin (IL)-13 in the absence of both IL-5 and eotaxin precludes the development of eosinophilia and airways hyperreactivity in experimental asthma J. Exp. Med. 195,1433-1444[Abstract/Free Full Text]
  39. Dent, L. A., Strath, M., Mellor, A. L., Sanderson, C. J. (1990) Eosinophilia in transgenic mice expressing interleukin 5 J. Exp. Med. 172,1425-1431[Abstract/Free Full Text]
  40. Strath, M., Warren, D. J., Sanderson, C. J. (1985) Detection of eosinophils using an eosinophil peroxidase assay. Its use as an assay for eosinophil differentiation factors J. Immunol. Methods 83,209-215[CrossRef][Medline]
  41. Dimayuga, E., Stober, M., Kayes, S. G. (1991) Eosinophil peroxidase levels in hearts and lungs of mice infected with Toxocara canis J. Parasitol. 77,461-466[CrossRef][Medline]
  42. Nassenstein, C., Braun, A., Erpenbeck, V. J., Lommatzsch, M., Schmidt, S., Krug, N., Luttmann, W., Renz, H., Virchow, J. C., Jr (2003) The neurotrophins nerve growth factor, brain-derived neurotrophic factor, neurotrophin-3, and neurotrophin-4 are survival and activation factors for eosinophils in patients with allergic bronchial asthma J. Exp. Med. 198,455-467[Abstract/Free Full Text]
  43. Hildeman, D. A., Mitchell, T., Teague, T. K., Henson, P., Day, B. J., Kappler, J., Marrack, P. C. (1999) Reactive oxygen species regulate activation-induced T cell apoptosis Immunity 10,735-744[CrossRef][Medline]
  44. Hildeman, D. A., Mitchell, T., Aronow, B., Wojciechowski, S., Kappler, J., Marrack, P. (2003) Control of Bcl-2 expression by reactive oxygen species Proc. Natl. Acad. Sci. USA 100,15035-15040[Abstract/Free Full Text]
  45. Corry, D. B., Folkesson, H. G., Warnock, M. L., Erle, D. J., Matthay, M. A., Wiener-Kronish, J. P., Locksley, R. M. (1996) Interleukin 4, but not interleukin 5 or eosinophils, is required in a murine model of acute airway hyperreactivity J. Exp. Med. 183,109-117[Abstract/Free Full Text]
  46. Rankin, J. A., Picarella, D. E., Geba, G. P., Temann, U. A., Prasad, B., DiCosmo, B., Tarallo, A., Stripp, B., Whitsett, J., Flavell, R. A. (1996) Phenotypic and physiologic characterization of transgenic mice expressing interleukin 4 in the lung: lymphocytic and eosinophilic inflammation without airway hyperreactivity Proc. Natl. Acad. Sci. USA 93,7821-7825[Abstract/Free Full Text]
  47. Wills-Karp, M., Karp, C. L. (2004) Biomedicine. Eosinophils in asthma: remodeling a tangled tale Science 305,1726-1729[Abstract/Free Full Text]
  48. Clark, K., Simson, L., Newcombe, N., Koskinen, A. M., Mattes, J., Lee, N. A., Lee, J. J., Dent, L. A., Matthaei, K. I., Foster, P. S. (2004) Eosinophil degranulation in the allergic lung of mice primarily occurs in the airway lumen J. Leukoc. Biol. 75,1001-1009[Abstract/Free Full Text]
  49. Kay, A. B., Phipps, S., Robinson, D. S. (2004) A role for eosinophils in airway remodeling in asthma Trends Immunol. 25,477-482[CrossRef][Medline]
  50. Humbert, M., Menz, G., Ying, S., Corrigan, C. J., Robinson, D. S., Durham, S. R., Kay, A. B. (1999) The immunopathology of extrinsic (atopic) and intrinsic (non-atopic) asthma: more similarities than differences Immunol. Today 20,528-533[CrossRef][Medline]
  51. Brewer, J. P., Kisselgof, A. B., Martin, T. R. (1999) Genetic variability in pulmonary physiological, cellular, and antibody responses to antigen in mice Am. J. Respir. Crit. Care Med. 160,1150-1156[Abstract/Free Full Text]
  52. Tai, P. C., Sun, L., Spry, C. J. (1991) Effects of IL-5, granulocyte/macrophage colony-stimulating factor (GM-CSF) and IL-3 on the survival of human blood eosinophils in vitro Clin. Exp. Immunol. 85,312-316[Medline]
  53. Yamaguchi, Y., Suda, T., Suda, J., Eguchi, M., Miura, Y., Harada, N., Tominaga, A., Takatsu, K. (1988) Purified interleukin 5 supports the terminal differentiation and proliferation of murine eosinophilic precursors J. Exp. Med. 167,43-56[Abstract/Free Full Text]
  54. Yamaguchi, Y., Hayashi, Y., Sugama, Y., Miura, Y., Kasahara, T., Kitamura, S., Torisu, M., Mita, S., Tominaga, A., Takatsu, K., Suda, T., Suda, J., Eguchi, M., Harada, N. (1988) Highly purified murine interleukin 5 (IL-5) stimulates eosinophil function and prolongs in vitro survival. IL-5 as an eosinophil chemotactic factor. Purified interleukin 5 supports the terminal differentiation and proliferation of murine eosinophilic precursors J. Exp. Med. 167,1737-1742[Abstract/Free Full Text]
  55. Zimmermann, N., Hogan, S. P., Mishra, A., Brandt, E. B., Bodette, T. R., Pope, S. M., Finkelman, F. D., Rothenberg, M. E. (2000) Murine eotaxin-2: a constitutive eosinophil chemokine induced by allergen challenge and IL-4 overexpression J. Immunol. 165,5839-5846[Abstract/Free Full Text]
  56. Lopez, A. F., Begley, C. G., Williamson, D. J., Warren, D. J., Vadas, M. A., Sanderson, C. J. (1986) Murine eosinophil differentiation factor. An eosinophil-specific colony-stimulating factor with activity for human cells J. Exp. Med. 163,1085-1099[Abstract/Free Full Text]
  57. Lopez, A. F., Sanderson, C. J., Gamble, J. R., Campbell, H. D., Young, I. G., Vadas, M. A. (1988) Recombinant human interleukin 5 is a selective activator of human eosinophil function J. Exp. Med. 167,219-224[Abstract/Free Full Text]
  58. Collins, P. D., Marleau, S., Griffiths-Johnson, D. A., Jose, P. J., Williams, T. J. (1995) Cooperation between interleukin-5 and the chemokine eotaxin to induce eosinophil accumulation in vivo J. Exp. Med. 182,1169-1174[Abstract/Free Full Text]
  59. Yang, M., Hogan, S. P., Mahalingam, S., Pope, S. M., Zimmermann, N., Fulkerson, P., Dent, L. A., Young, I. G., Matthaei, K. I., Rothenberg, M. E., Foster, P. S. (2003) Eotaxin-2 and IL-5 cooperate in the lung to regulate IL-13 production and airway eosinophilia and hyperreactivity J. Allergy Clin. Immunol. 112,935-943[CrossRef][Medline]
  60. Humbles, A. A., Lu, B., Friend, D. S., Okinaga, S., Lora, J., Al-Garawi, A., Martin, T. R., Gerard, N. P., Gerard, C. (2002) The murine CCR3 receptor regulates both the role of eosinophils and mast cells in allergen-induced airway inflammation and hyperresponsiveness Proc. Natl. Acad. Sci. USA 99,1479-1484[Abstract/Free Full Text]
  61. Kankaanranta, H., Lindsay, M. A., Giembycz, M. A., Zhang, X., Moilanen, E., Barnes, P. J. (2000) Delayed eosinophil apoptosis in asthma J. Allergy Clin. Immunol. 106,77-83[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0106046v1
81/6/1362    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tumes, D. J.
Right arrow Articles by Dent, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tumes, D. J.
Right arrow Articles by Dent, L. A.