Journal of Leukocyte Biology eBioscience full spectrum cell analysis
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.1106681 on February 27, 2007

Published online before print February 27, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.1106681v1
81/5/1311    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moeenrezakhanlou, A.
Right arrow Articles by Reiner, N. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moeenrezakhanlou, A.
Right arrow Articles by Reiner, N. E.
(Journal of Leukocyte Biology. 2007;81:1311-1321.)
© 2007 by Society for Leukocyte Biology

1{alpha},25-Dihydroxycholecalciferol activates binding of CREB to a CRE site in the CD14 promoter and drives promoter activity in a phosphatidylinositol-3 kinase-dependent manner

Alireza Moeenrezakhanlou*,{dagger}, Devki Nandan*, Lindsay Shephard* and Neil E. Reiner*,{ddagger},1

* Departments of Medicine (Division of Infectious Diseases) and
{ddagger} Microbiology and Immunology, University of British Columbia, Faculties of Medicine and Science, and Vancouver Coastal Health Research Institute (VCHRI), Vancouver, British Columbia, Canada; and
{dagger} School of Medicine, Hamadan University of Medical Sciences, Hamadan, Iran

1 Correspondence: Division of Infectious Diseases, University of British Columbia, Rm. 452D, 2733 Heather St., Vancouver, BC, Canada, V5Z 3J5. E-mail: ethan{at}interchange.ubc.ca


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1,25-Dihydroxycholecalciferol, also known as 1{alpha},25-dihydroxyvitamin D3 or calcitriol, regulates the differentiation and functional properties of mononuclear phagocytes. Many of these effects involve nongenomic signaling pathways, which are not fully understood. Activation of CD14 expression, a monocyte differentiation marker and coreceptor with TLR-2 for bacterial LPS, by calcitriol was shown previously to be PI-3K-dependent [1 ]; however, the mechanism of gene activation remained undefined. Using a transcription factor-binding array screen coupled with EMSA, we found evidence for PI-3K-dependent activation of CREB in THP-1 cells incubated with calcitriol. Furthermore, analysis of the proximal promoter of human CD14 identified regions that contained up to seven sequences, which showed significant similarity to a canonical CRE sequence, 5'-TGACGTCA-3'. Treatment of THP-1 cells with calcitriol activated CREB binding to one of these regions at Positions –37 to –55, relative to the transcription start site in a PI-3K-dependent manner. This 19-mer region also became transcriptionally active in a reporter assay in response to calcitriol, again dependent on PI-3K. Mutation of the CRE within the 19-mer abolished this activity. Taken together, these results show that calcitriol signaling, leading to activation of the CD14 promoter, involves CREB activation downstream of PI-3K.

Key Words: macrophage • PI-3K • calcitriol • vitamin D


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mononuclear phagocytes are pivotal regulators and effectors of the innate and acquired immune responses [2 ]. Consequently, mechanisms of monocyte cell regulation have been a focus of longstanding interest, and extensive research has highlighted an important role for phosphoinositides. In particular, the 3'-phosphoinositide metabolites produced by the PI-3K family of lipid kinases are known to be involved in regulating numerous monocyte activities including phagocytosis [3 ], activation of the phagocyte oxidase [4 ], and the production of cytokines downstream of TLRs [5 6 7 ] to name a few. An important research objective has been to develop an understanding of how specificity is achieved in PI-3K signaling in response to agonists that modulate the activities of macrophages and monocytes.

The hormone 1,25-dihydroxycholecalciferol, also known as 1{alpha},25-dihydroxyvitamin D3 or calcitriol, plays critical roles in regulating numerous cellular and physiological responses. In addition to its canonical role as a hormone involved in regulating plasma calcium homeostasis [8 , 9 ] and bone remodeling [10 , 11 ], calcitriol regulates numerous functional properties of hematopoietic cells including those of mononuclear phagocytes, thereby promoting resistance to intracellular infection [12 , 13 ]. For example, calcitriol has been shown to promote phagosome maturation [14 ] and macrophage killing of Mycobacterium tuberculosis and Salmonella typhimurium [15 , 16 ], and all of these responses were found to be PI-3K-dependent. Furthermore, it has been shown recently that TLR signaling for monocyte innate antimicrobial activity is, at least in part, calcitriol-dependent [17 ].

Calcitriol has been shown to induce gene expression in immature monocytes, thereby regulating their differentiation into mature macrophages [18 ]. For example, when immature myeloid cells such as HL60, U937, THP-1, and M1 were incubated with hormone, they differentiated into cells expressing functional properties and differentiation markers of monocytes/macrophages, including CD14 [19 20 21 22 ]. Calcitriol is also known to regulate T cell development [23 ] and T cell [24 ] and dendritic cell (DC) differentiation [25 , 26 ]. Taken together, these findings indicate that calcitriol is an important hormonal regulator of immunity with specific effects on macrophage functions and host defense.

Many effects of calcitriol are mediated by its binding to the cytosolic 1{alpha},25-dihydroxyvitamin D3 receptor (VDR), which translocates directly to the nucleus, where it functions as a transcription factor by binding to specific DNA sequences, referred to as vitamin D-response elements (VDREs), within target genes. This direct nuclear mode of action has been referred to as "genomic signaling" [27 , 28 ] to differentiate it from "nongenomic" calcitriol signaling, which involves other intermediates. There has been significant interest in identifying nongenomic pathways, as the promoters of many calcitriol-inducible genes do not contain VDREs [29 30 31 ], and several potential models have been identified. For example, calcitriol has been shown to stimulate the rapid formation of second messengers including ceramides, cAMP, inositols, and calcium and to activate a variety of protein kinases including protein kinase C (PKC), Raf, MAPK, and Src family kinases [27 , 32 33 34 ].

Our studies concerned with mechanisms of mononuclear phagocyte cell regulation identified a novel, nongenomic pathway of calcitriol action [1 ]. This model showed that calcitriol-induced, transcriptional activation of CD14 involved assembly of a hormone-induced signaling complex involving p85/p110 PI-3K and the VDR. Although these findings established a new model of nongenomic hormone signaling, it remained unclear as to how calcitriol-induced signaling would lead to induction of gene transcription, as the CD14 promoter does not contain a VDRE [35 ]. To understand how VDRE-independent, transcriptional activation in monocytes is regulated in response to hormone, we analyzed the CD14 promoter. This resulted in the identification of candidate-binding sites for multiple transcription factors including CREB, signal transducer and activator of transcription X (STATX), STAT-3, specificity protein 1 (Sp1), C/EBP-ß, protein that recognizes the motif (A/T) GATA (A/G) [GATA-1]/2, E26 transformation specific (ETS), and others. In this report, we examined the potential role of CREB in regulating monocyte responses to calcitriol. We found that incubation of THP-1 cells with hormone resulted in PI-3K-dependent activation of CREB binding to a canonical CRE sequence (5-GACGCGTGACGTCACAACAAGC-3) and to a 19-mer (5-ACTGAATGACATCCCAGGA-3) located within the proximal CD14 promoter that contained three overlapping, CRE-like sequences. Furthermore, when canonical CRE and this 19-mer were examined, they each were found to drive transcription in response to calcitriol and in a PI-3K-dependent manner. These findings suggest a novel model in which VDRE-independent gene expression in response to calcitriol in human macrophages involves changes in the activity of CREB downstream of PI-3K.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Reagents and chemicals
HBSS, DMEM, RPMI 1640, penicillin/streptomycin, PMSF, aprotinin, leupeptin, pepstatin A, and polyinosinic:polycytidylic [poly(dI-dC)] were purchased from Sigma Chemical Co. (St. Louis, MO, USA). 1{alpha}, 25-Dihydroxyvitamin D3, LY294002, and wortmannin were from Calbiochem Corp. (San Diego, CA, USA). Unlabeled and biotinylated CREB consensus oligo, TranSignalTM protein/DNA arrays, and hybridization and detection kits were from Panomics Inc. (Fremont, CA, USA). Nylon and nitrocellulose membranes were obtained from Bio-Rad Laboratories (Hercules, CA, USA). Restriction enzymes, T4 DNA ligase, Taq DNA polymerase, buffers, deoxy-NTPs, eukaryotic genome extraction kits, and DNA ladder were purchased from Fermentas (Burlington, Ontario, Canada). Plasmid isolation kits, gel extraction, and oligo purification kits were purchased from Qiagen (Mississauga, Ontario, Canada). pRL-TK-Renilla reniformis luciferase (Rr-luc), pGL3-Basic, and a pGL3 luciferase reporter construct containing three tandem repeats of canonical CRE and luciferase detection kits were obtained from Promega (Madison, WI, USA). All custom-synthesized primers, oligos, and FCS were from Invitrogen (Carlsbad, CA, USA). Anti-CREB and antiphospho-CREB antibodies were from Upstate Cell Signaling Solutions (Lake Placid, NY, USA), and anti-actin was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Transfection reagents were purchased from Invitrogen and Dharmacon RNA Technology (Lafayette, CO, USA).

Cell lines and cell culture
The epithelial carcinoma cell line HeLa and the human promonocytic cell line THP-1 were from the American Type Culture Collection (Manassas, VA, USA). THP-1 cells were grown in RPMI 1640 with 10% FCS, supplemented with penicillin (100 U/ml) and streptomycin (100 µg/ml). For most experiments, prior to use, cells were washed in HBSS and incubated for 5 h in RPMI/0.5% FCS for serum starvation. HeLa cells were cultured in DMEM with nonessential amino acids and supplemented with 10% FCS, penicillin (100 U/ml), and streptomycin (100 µg/ml). HeLa cells were washed in HBSS prior to use and incubated with DMEM/0.5% FCS for 5 h for serum starvation.

Transcription factor-binding array screen
TranSignalTM protein/DNA Array I was purchased from Panomics Inc. and used according to the manufacturer’s instruction. Briefly, a set of biotin-labeled, DNA-binding oligonucleotides were preincubated with 1–3 µg nuclear extracts from control and calcitriol-treated cells to allow the formation of DNA/protein complexes, followed by separation of complexes from free probes using a spin column. Bound probes in the DNA/protein complexes were extracted and hybridized with the TranSignalTM protein/DNA Array I membranes. Hybridized membranes were blocked using blocking solution at room temperature with gentle shaking. Bound probes were detected using a HRP-based chemiluminescence detection system provided with the kit. The identification a particular transcription factor was based on the key provided with the kit.

Preparation of nuclear and cytoplasmic fractions
Nuclear and cytoplasmic fractions were prepared based on a protocol from the Skirball Institute of Biomolecular Medicine, New York University Medical Center (New York, NY, USA) [36 ], with minor modifications. Briefly, ~2 x 107 cells were used per assay, and after treatment, the cells were washed twice with HBSS and collected by centrifugation. Subsequent steps were performed on ice. The cells were resuspended in 300 µl fractionation buffer (10 mM HEPES, pH 7.9, containing 50 mM NaCl, 0.5 M sucrose, 0.1 mM EDTA, 0.5% Triton X-100, 1 mM DTT, 10 mM tetrasodium pyrophosphate, 2 mM NaF, 17.5 mM ß-glycrophosphate, 1 mM PMSF, 4 µg/ml aprotinin, 2 µg/ml pepstatin A, and 2 µg/ml leupeptin) and incubated on ice for 5 min. Nuclei were pelleted at 4500 g for 5 min at 4°C. Supernatants, representing crude cytoplasmic/membrane extracts, were transferred to new tubes and adjusted to 10% glycerol and stored at –70°C. Nuclei were washed and resuspended in 500 µl buffer A (10 mM HEPES, pH 7.9, containing 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 1 mM PMSF, 4 µg/ml aprotinin, 2 µg/ml pepstatin A, and 2 µg/ml leupeptin) and pelleted at 4500 g for 5 min at 4°C. Nuclear pellets were resuspended in 40 µl buffer C (10 mM HEPES, pH 7.9, 500 mM NaCl, 0.1 mM EDTA, 0.1 mM EGTA, 0.1% Igepal,1 mM DTT, 1 mM PMSF, 4 µg/ml aprotinin, 2 µg/ml pepstatin A, and 2 µg/ml leupeptin) and agitated by vortexing for 15 min at room temperature. Tubes were kept cold by placing them on ice intermittently during this period. Samples were spun at 11,600 g for 20 min at 4°C, and supernatants, representing crude, soluble nuclear extracts, were then transferred to new tubes and adjusted to 10% glycerol final concentration and aliquots stored at –70°C.

EMSA
Nuclear extract (2–5 µg) and a biotinylated, commercial oligonucleotide encoding the CRE motif 5'- GACGCGTGACGTCACAACAAGC-3' (Panomics Inc., EMSA Gel-Shift Kit #AY 1288 P) were used for EMSA based on instructions provided by the manufacturer. In some cases, a custom-synthesized and biotinylated 19-mer 5'-ACTGAATGACATCCCAGGA-3', located at Positions –55 to –37 of the proximal CD14 promoter, was also used. Briefly, nuclear extract containing an equal amount of protein for each sample was incubated with 1 µg/µl poly(dI-dC) for 5 min, followed by the addition of binding buffer (20 mM HEPES, pH 7.9, 1 mM DTT, 0.1 mM EDTA, 50 mM KCl, 5% glycerol, and 200 µg/ml BSA) and biotinylated oligo (10 ng/µl). To control for specificity of binding to selected samples, tenfold excess, nonlabeled oligo was added prior to the biotinylated CRE probe. Binding reaction mixtures were incubated for 30 min at room temperature. For competition or gel shift assay, equal amounts of nuclear extract were preincubated with 1 µg anti-CREB antibody or matched, irrelevant control antibody. Protein-DNA complexes were separated on 5% nondenaturing polyacrylamide gels in Tris-borate/EDTA buffer (0.1 M Tris, 0.09 M boric acid containing 1 mM EDTA) at 4°C. After electrophoresis, gels were transferred to nylon membranes. Transferred oligos were immobilized by UV cross-linking for 3 min. For detection of bound oligos, membranes were blocked using blocking buffer (EMSA gel-shift kit, Panomics Inc.), followed by the addition of Streptavidin-HRP, and blots were developed by ECL, according to the manufacturer’s instructions (Amersham, Arlington Heights, IL, USA).

Combined Western blotting and EMSA (WEMSA)
This assay used a nonlabeled, commercial oligonucleotide encoding the same CRE motif 5'-GACGCGTGACGTCACAACAAGC-3' described above or nonlabeled, custom-synthesized oligos, based on the CRE-like sequences with the proximal CD14 promoter. These CRE-like oligos were: 5'-ACTGAATGACATCCCAGGA-3' at Positions –55 to –37, 5'-CGCCTGAGTCATC-3' at Positions –82 to –72, 5'-CGCCTGAGTCATC-3' at Positions –231 to –219, 5'-ACTGAGGATCATC-3' at Positions –306 to –294, and 5'-AATGAATCAAG-3' at Positions –386 to –376. Nuclear extracts and reaction mixtures were prepared as described for EMSA above, except for the use of nonlabeled oligos. After incubation for 30 min at room temperature, reaction mixtures were separated by nondenaturing PAGE, exactly as done for EMSA above. The separated DNA-protein complexes were then transferred to nitrocellulose membranes instead of nylon membranes and probed with anti-CREB antibody by Western blotting as described below.

Plasmid constructs
Genomic DNA from THP-1 cells was isolated (Fermentas Life Sciences #K0512), and the region –150 to –1, relative to the transcription start site from the CD14 promoter, was amplified by PCR using Taq polymerase. The forward primer with the XhoI site was GGCTCGAGCCCTGAAACATCCTTCATTGCAATATTTC, and the reverse primer with the HindIII site was AGAAGCTTGAACTCTTCGGCTGCCTCTGACTGTTT. The PCR product of 160 bp was digested by XhoI and HindIII enzymes and then subcloned into pGL3-Basic vector (Promega). This plasmid served as a wild-type reporter construct. A second construct of the –150 to –1 region was also prepared; however, in this case, site-directed mutagenesis (QuikChange® site-directed mutagenesis kit, Stratagene, La Jolla, CA, USA) was used to eliminate the three overlapping, CRE-like elements contained with a 19-mer region, spanning nucleotides –55 to –37. The starting sequence for this region was 5'-ACTGAATGACATCCCAGGA-3', and the CRE-like sequence had the highest degree of identity (80%) to canonical CRE highlighted in boldface and underlined. After mutagensis, the sequence read as 5'-ACTGAATAGTATCCCAGGA-3', and the mutated changes in the CRE-like sequence were shown in boldface and underlined. A third pGL3-Basic construct, containing three tandem repeats of the 19-mer region itself (5-ACTGAATGACATCCCAGGA-3), located at Positions –55 to –37 of the CD14 promoter, was also prepared. The correct identity of all clones was confirmed by sequencing. In addition, commercially designed luciferase reporter plasmids containing canonical CRE [TransLucent CRE (1) #LR0093] or a mutated CRE sequence (TransLucent Control Vector #LR0093) were purchased from Panomics Inc.

Transient transfections and luciferase reporter assays
Transient transfections were performed using LipofectamineTM 2000 (Invitrogen). For this assay, HeLa cells were cultured without antibiotics in 12-well plates. After 24 h, when the cells were 80–90% confluent, they were cotransfected with 0.5 µg per well of the pGL3 reporter construct of interest and with 0.25 µg pRL-TK (Promega) to control for transfection efficiency. After a further 24 h, transfection medium was replaced by new DMEM/10% FCS, and cells were treated as indicated for 48–72 h. Lysates were then prepared and examined for dual luciferase activities using an EG&G Berthold microplate luminometer (LB 96V; Berthold Technologies, Germany) and reported as ratios of Photinus pyralis luciferase (Pp-luc)/Rr-luc as described previously [37 ]. Protein concentrations were determined using Bio-Rad DC protein assay kit (#500-0116).

Western blotting
Control and treated cells were lysed in modified radioimmunoprecipitation assay buffer (50 mM Tris-HCl, pH 7.4, 1% Nonidet P-40, 0.25% Na-deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM PMSF, 1 µg/ml aprotinin, leupeptin, pepstatin, 1 mM Na3VO4, and 1 mM NaF). Lysates were separated by 10% SDS-PAGE. Proteins were then transferred to nitrocellulose membranes. Blots were probed with antiphospho-CREB, anti-CREB, or antiactin antibodies (all rabbit IgG), followed by washing and incubation with HRP-conjugated, antirabbit IgG antibody. Blots were developed by ECL.

Cell surface expression of CD14
THP-1 cells (1–2x106) were treated with agonists and inhibitors (see description in text and legend to Fig. 8 ), and cell surface CD14 expression was measured as described previously [1 ]. Briefly, cells were washed with binding buffer (HBSS with 10% FBS and 0.1% NaN3, containing 1% normal mouse serum to control for nonspecific binding) and then incubated with mAb 3C10 for 30 min at room temperature. Cells were then washed once with antimouse FITC-conjugate antibody and analyzed using a BD Biosciences FACSCalibur flow cytometer. Data were acquired using BD CellQuest software and analyzed using Summit V3.1 software (Cytomation Inc., Fort Collins, CO, USA).


Figure 8
View larger version (16K):
[in this window]
[in a new window]

  		Figure 8. Calcitriol and db-cAMP induce CREB activation, but only hormone induces CD14. THP-1 cells were cultured and treated under the same conditions as described in the legends to Figures 1 and 7 . Nuclear extracts were then examined by EMSA for binding of CREB to a canonical CRE oligo (A), and identically treated parallel cell samples were examined for cell surface CD14 expression by flow cytometry (B). The results shown in A are from one of two independent experiments that yielded similar results, and the results in B are the mean ± SD of three experiments.

 
Silencing of CREB
Small interfering (si)RNA was used to down-regulate CREB expression. These experiments were performed using two different siRNA sequences targeting human CREB (NM_004379), 5' GCAAUACAGCUGGCUAACATT 3' and 5' CAACCAAGUUGUUGUUCAATT 3' (Sigma-Proligo, Woodlands, TX, USA). THP-1 cells were plated at a density of 0.25 x 106 cells/ml and transfected with 100 nM/L CREB siRNA using DharmaFECTTM 2 (Dharmacon RNA Technology). Forty-eight to 60 h post-transfection, cells were treated with 100 nM 1{alpha}, 25-dihydroxyvitamin D3 for 72 h. In parallel, equal amounts of total cell lysates were prepared and analyzed for CREB protein expression by Western blotting. After calcitriol treatment was completed, parallel aliquots of cells were analyzed for CD14 expression by RT-PCR or by flow cytometry to evaluate the impact of CREB silencing.

RNA isolation and RT-PCR
Total RNA was isolated using RNeasy (Qiagen). cDNAs were prepared using the SuperScriptTM first-strand synthesis system for RT-PCR (Invitrogen). PCR was carried out using standard conditions. Sense and antisense amplification primers for CD14 and actin, as an internal control, were as follows: CD14 sense, 5'-GCCCTTACCAGCAGACCT-3', antisense, 5'-CCCGTCCAGTGTCAGGTTAT-3'; actin sense, 5'-TGACGGGGTCACCCACACTGTGCCCATCTA-3', and antisense, 5'-CTAGAAGCATTGCGGTGGACGATGGAGGG-3'.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Analysis of the CD14 promoter reveals the presence of multiple CRE-like elements
Incubation of monocytic cell lines of diverse origins, including THP-1, U937, Mono Mac 6, and NB4 with calcitriol, has been shown to bring about an increase in CD14 transcription and to promote monocyte differentiation [1 , 38 , 39 ]. To identify potential cis-elements and trans-acting factors involved in this response, we used a transcription factor-binding array screen. This analysis showed that incubation of THP-1 cells with calcitriol resulted in a marked increase in CREB-binding activity, which was dependent on PI-3K (Fig. 1 ). Based on this finding, we searched the hormone-responsive region of the CD14 promoter for potential elements of interest, focusing in particular on potential CRE-like elements. Depicted in Figure 2 is the proximal promoter region of human CD14 from Positions –1 to –469, which has been shown to be critical for activation of gene transcription in response to calcitriol [39 ]. Highlighted in boldface and underlined are five stretches of nucleotides within this region containing up to seven CRE-like sequences. These showed significant sequence similarity (70–79%) to a canonical CRE sequence 5'-TGACGTCA-3', which was characterized previously based on analyses of many cAMP-responsive genes [40 ].


Figure 1
View larger version (16K):
[in this window]
[in a new window]

  		Figure 1. Transcription factor-binding array screen identifies CREB activation in response to calcitriol treatment dependent on PI-3K. THP-1 cells growing in RPMI 1640/10% FCS at <0.6 x 106 cells/ml were harvested and resuspended in medium supplemented with 0.5% FCS and incubated for 5 h. Calcitriol was then added or not at 100 nM x 0.5 h to cells, which had been untreated or preincubated with LY294002 (10 µM). Nuclear extracts were then isolated and screened using a Panomics TranSignalTM protein/DNA array. (A) Extracts from untreated, control cells; (B) extracts from hormone-treated cells; (C) extracts from cells incubated first with LY294002 and then hormone.

 

Figure 2
View larger version (22K):
[in this window]
[in a new window]

  		Figure 2. CD14 proximal promoter. This region spanning 469 bp upstream of the transcription start site has been shown to be critical for induction of CD14 transcription in response to calcitriol [39 ]. Highlighted in boldface and underlined are putative, CRE-like transcription factor-binding sites in this region, identified using the TFSEARCH program (http://www.cbrc.jp/research/db/TFSEARCH.html).

 
Calcitriol activates CREB binding to a canonical CRE oligo in a PI-3K-dependent manner
In light of the evidence from the transcription factor array screen and the analysis of the proximal CD14 promoter, we examined directly whether incubation of cells with calcitriol would activate CREB for binding to a canonical CRE sequence. After treatment of THP-1 cells with hormone (100 nM, 30 min) in the presence or absence of PI-3K inhibitors, nuclear extracts were prepared and incubated with a biotinylated CRE probe (5'-GACGCGTGCGTCACAACAAGC-3') and processed for EMSA. As shown in Figure 3A , protein-DNA complexes were detected to indicate that calcitriol activated CREB binding to the CRE oligo. Although there appeared to be a low level of constitutive CREB binding to DNA in control cells, this was clearly increased significantly in hormone-treated cells (Fig. 3B) . Furthermore, the specificity of the interaction appeared to be high, as the signal was eliminated completely by competition with unlabeled probe. It is more important that activation of CREB binding appeared to be completely dependent on PI-3K, as it was abrogated in cells treated with PI-3K inhibitors LY294002 and wortmannin prior to incubation with hormone.


Figure 3
View larger version (29K):
[in this window]
[in a new window]

  		Figure 3. Calcitriol activates CREB binding to a canonical CRE sequence in a PI-3K-dependent manner. (A) THP-1 cells, untreated or preincubated with LY294002 (10 µM) or wortmannin (50 nM), were cultured and incubated with calcitriol as described in the legend to Figure 1 . Nuclear extracts were then isolated and processed for EMSA as described in Materials and Methods. Lane 1 contained free, biotinylated oligo (5'-GACGCGTGCGTCACAACAAGC-3') only. For the remaining lanes, the treatment of the cells used to generate the nuclear extracts and the contents of the EMSA incubation are shown. (C) EMSA, as in Panel A, except including anti-CREB antibody. (D) Luciferase reporter assay in HeLa cells, which were grown in DMEM without antibiotics, plus nonessential amino acids and 10% FCS. At 80–90% confluency, cells were transiently transfected with a pGL3 luciferase reporter construct under the control of three tandem repeats of a wild-type, canonical CRE. Parallel samples of cells were transfected with a modified pGL3 reporter construct containing a point mutation in each of the three CRE sites. All samples were dual-transfected with Rr-luc, and results were calculated as ratios of Pp-luc:Rr-luc. (A) Cells were then treated with agonists and inhibitors as described for THP-1 cells. The results shown are from one of three independent experiments, which yielded similar results, and (B) the results are the mean ± SD for the three experiments. (C and D) The results are, respectively, from one of three and one of two identical experiments with similar results.

 
To confirm that the protein activated by hormone to bind to CRE was bona fide CREB, antibody-based competition experiments were done. As shown in Figure 3C , when nuclear extracts from calcitriol-treated THP-1 cells were incubated with antibody specific for CREB prior to EMSA, significant inhibition of protein binding to the CRE oligo was observed as compared with irrelevant, control antibody.

To determine whether activation of CREB binding to CRE conferred functional activity, HeLa cells were transiently transfected with a pGL3 luciferase reporter construct under the control of three tandem repeats of a canonical CRE (Promega). Cells were dual-transfected with this construct along with Rr-luc, results were calculated and reported as ratios of Pp-luc:Rr-luc. The results shown in Figure 3D indicate that incubation of HeLa cells with calcitriol brought about increased reporter activity. Furthermore, induction of promoter activity by hormone treatment was PI-3K-dependent and was not observed in cells that were transfected with a modified pGL3 reporter construct containing a point mutation in each of the three CRE sites.

Calcitriol signals through PI-3K to activate CREB binding to a CRE-like sequence located between Positions –37 and –55 of the CD14 promoter
The results shown thus far indicated that calcitriol activated binding of CREB to a canonical CRE sequence (5'-TGACGTCA-3') [40 ] and CRE-dependent reporter activity, and both of these responses were PI-3K-dependent. As shown in Figure 3 , sequence analysis identified multiple potential CRE-like sequences, with varying degrees of similarity to this canonical CRE, within the proximal promoter of CD14. To determine which if any of these CRE-like sequences might be involved in a calcitriol-induced, PI-3K-dependent pathway leading to activation of CD14, five oligos (Fig. 4A ) based on these CRE-like sequences were synthesized and examined by combined EMSA and WEMSA. As shown in Figure 4B , in response to treatment of THP-1 cells with hormone, CREB was activated for binding to only one of these CRE-like sequences. This site was situated within a 19-mer, 5'-ACTGAATGACATCCCAGGA-3', corresponding to Positions –37 to –55 within the CD14 promoter and was found to contain three overlapping, CRE-like sequences with 70–79% identity to the canonical CRE shown in Figure 2 .


Figure 4
View larger version (28K):
[in this window]
[in a new window]

  		Figure 4. Treatment of THP-1 cells with calcitriol activates CREB binding a CRE-like sequence located within the region –37 to –55 of the CD14 promoter. (A) Table showing the unlabeled oligo sequences based on candidate CRE-like sequences from the CD14 promoter used in WEMSA analysis. (B) WEMSA analysis. Nuclear extracts from control and calcitriol-treated cells (details of cell culture and treatment are as described in the legend to Fig. 3 ) were prepared, and aliquots were incubated with each of five unlabeled oligonucleotides. Nuclear extracts from cells treated or not with calcitriol were separated by nondenaturing gel electrophoresis and after protein-DNA complexes, were transferred to nitrocellulose; they were analyzed by Western blotting for CREB. The results shown are from one of three independent experiments that yielded similar results.

 
A CRE-like sequence located within the proximal CD14 promoter is activated by calcitriol to drive transcription in a PI-3K-dependent manner
To determine whether the proximal CD14 promoter containing multiple CRE-like sequences would activate transcription in a calcitriol- and PI-3K-dependent manner, a –1- to –150-bp fragment, relative to the transcription start site, was cloned into a promoterless pGL3-Basic encoding Pp-luc. HeLa cells were then dual-transfected with this construct along with Rr-luc, followed by no addition or by the addition of hormone. Lysates were examined for dual luciferase activities and reported as ratios of Pp-luc:Rr-luc. As shown in Figure 5 , treatment of cells with calcitriol brought about increased reporter activity, and this was comparable with the response observed to forskolin (50 µM), a known activator of CREB via cAMP and PKA. In addition, induction of reporter activity by calcitriol through the proximal 150-bp promoter was abrogated completely by PI-3K inhibition. To examine specifically the functional importance of the CRE-like sites contained within the 19-mer sequence ACTGAATGACATCCCAGGA, located between Positions –37 and –55 of the promoter, parallel aliquots of cells were transfected with pGL3-Basic containing the –1- to –150-bp fragment, which had been altered by site-directed mutagenesis to eliminate the overlapping, CRE-like sequences. Elimination of these CRE sites resulted in complete loss of inducible reporter activity.


Figure 5
View larger version (15K):
[in this window]
[in a new window]

  		Figure 5. A 150-bp fragment of the proximal CD14 promoter containing multiple CRE-like sequences drives transcription in a calcitriol- and PI-3K-dependent manner. Details of cell culture and treatment of HeLa cells were as described in the legend to Figure 3D . A –1- to –150-bp fragment from the CD14 promoter, relative to the transcription start site, was cloned into a promoterless Pp-luc. Alternatively, a second –1- to –150-bp fragment, which was identical to the first, except for an alteration induced by site-directed mutagenesis to eliminate the overlapping CRE-like sequences located between Positions –37 and –55, was also cloned into promoterless pGL3-Basic. HeLa cells were then dual-transfected with either of these constructs plus Rr-luc, followed by no treatment or treatment with calcitriol. Some samples included PI-3K inhibitors LY294002 (10 uM) and wortmannin (50 nM), as indicated. Lysates were examined for dual luciferase activities, which were calculated as Pp-luc/Rr-luc for each sample. Results are reported as fold activation relative to untreated control cells. Forskolin (50 µM) was used as a positive control for CREB activation. The results shown are from one of two independent experiments that yielded similar results.

 
The 19-mer region –37 to –55 of the proximal promoter of CD14 functions as a CREB-binding site in a calcitriol-inducible and PI-3K-dependent manner
THP-1 cells were incubated with calcitriol in the presence or absence of wortmannin to examine whether calcitriol induced direct binding of CREB, the –37 to –55 19-mer region, and whether this was PI-3K-dependent. As the EMSA results depicted in Figure 6A show, hormone treatment induced CREB binding, and this was eliminated completely by wortmannin. To confirm that the 19-mer-binding protein activated by calcitriol and PI-3K was indeed bona fide CREB, antibody-based competition experiments were done. As shown in Figure 6B , when nuclear extracts from calcitriol-treated THP-1 cells were incubated with anti-CREB antibody prior to EMSA, binding of nuclear proteins to the 19-mer was eliminated completely. To seek additional evidence to support the argument that the 19-mer encodes a high-specificity, CREB-binding motif, EMSA, using biotinylated, canonical CRE, was also carried out in the presence or absence of excess, nonlabeled 19-mer. As shown in Figure 6C , CREB binding to canonical CRE was abrogated completely by excess 19-mer, indicating that CRE-like sequences within this –37 to –55 fragment from the proximal CD14 promoter encode a highly specific, CRE-binding site.


Figure 6
View larger version (40K):
[in this window]
[in a new window]

  		Figure 6. EMSA, showing that the 19-mer region spanning Positions –37 to –55 of the CD14 promoter, functions as a CREB-binding site in a calcitriol-inducible, PI-3K-dependent manner. Details of cell culture and treatment are the same as in the legend to Figure 1 . THP-1 cells were treated as indicated below each panel. Nuclear extracts were then prepared and processed for EMSA, the conditions for which are also given below each panel. (A) Hormone treatment induced specific binding of CREB to the 19-mer. Furthermore, this was eliminated as shown in A by wortmannin (50 nM) and in B, by anti-CREB antibody. (C) The binding of activated CREB to a labeled, canonical CRE oligo is competed off by excess, nonlabeled 19-mer. The results shown in A and B are from one of three and in C, from one of two identical experiments that gave similar results.

 
Calcitriol signals through PI-3K to activate transcriptional activity under the control of the –37 to –55 19-mer from the CD14 proximal promoter
To examine directly the functional importance of the CRE-like sites contained within the 19-bp sequence ACTGAATGACATCCCAGGA, located between Positions –37 and –55 of the CD14 promoter, HeLa cells were transfected with pGL3-Basic containing three tandem repeats of the –55 to –37 sequence upstream of Pp-luc. As shown in Figure 7 , cells containing this construct responded to calcitriol with an increase in reporter activity, which was PI-3K-dependent. The magnitude of the response to hormone was equivalent to that observed in cells incubated with db-cAMP. Furthermore, calcitriol-induced reporter activity was eliminated completely in cells transfected with a modified reporter construct in which each of the three tandem repeats of the 19-mer contained an identical mutation to eliminate the overlapping CRE-like sequences.


Figure 7
View larger version (10K):
[in this window]
[in a new window]

  		Figure 7. Calcitriol activates transcription of a reporter construct under the control of the –37 to –55 19-mer sequence from the CD14 proximal promoter in a PI-3K-dependent manner. HeLa cells, cultured as described in the legend to Figure 3D , were transiently transfected with a pGL3 luciferase reporter construct under the control of three tandem repeats of the –55 to –37 19-mer sequence from the CD14 promoter upstream of Pp-luc. Alternatively, cells were transfected with a modified pGL3 luciferase reporter construct in which each of the three tandem repeats of the 19-mer contained an identical mutation to eliminate the overlapping, CRE-like sequences. Cells were then dual-transfected with Rr-luc and treated as indicated with calcitriol (100 nMx30 min), wortmannin (50 nM), or dibutyryl (db)-cAMP (5 µM) as indicated for 48–72 h. Results of luciferase assays were calculated as ratios of Pp-luc:Rr-luc. This experiment was repeated two times with similar results.

 
Induction of CD14 expression by calcitriol is attenuated by cAMP
Exposure of cells to increased concentrations of cAMP is known to activate CREB binding downstream of PKA [41 , 42 ]. Based on a report that calcitriol treatment was observed to bring about an increase in cAMP in muscle cells [43 ], we examined the effect of increasing cellular cAMP levels per se on CD14 expression. As expected, the results depicted in Figure 8A indicate that cells treated with hormone or db-cAMP showed increased binding of CREB to a canonical CRE oligo. In contrast, as shown in Figure 8B , incubation of cells with calcitriol but not db-cAMP brought about an increase in expression of cell-surface CD14 as examined by flow cytometry. In fact, not only did db-cAMP fail to induce CD14 expression, but preincubation of cells with this agent attenuated hormone-induced CD14 expression (Fig. 8B) . These findings suggest that although activation of CREB in calcitriol-treated cells appears to be involved in the induction of CD14 expression, it is unlikely to be a direct consequence of changes in cAMP and PKA.

Impact of CREB silencing on the induction of CD14 in response to calcitriol
To examine further the contribution of CREB to CD14 expression, siRNA was used to reduce CREB protein abundance, and RT-PCR and flow cytometry, respectively, were used to examine CD14 mRNA and protein levels. As shown in Figure 9 , despite reduction of CREB protein levels to 20–30% of control values by siRNA treatment (Fig. 9C) , induction of CD14 mRNA (Fig. 9A) and cell surface CD14 (Fig. 9B) in response to calcitriol was unaffected.


Figure 9
View larger version (29K):
[in this window]
[in a new window]

  		Figure 9. siRNA silencing of CREB and induction of CD14 expression by calcitriol. THP-1 cells were plated at a density of 0.25 x 106 cells/ml for 24 h and then mock-transfected or transfected with either of two CREB siRNA sequences at 100 nM using DharmaFECTTM. (A) After 48–60 h, aliquots of cells were analyzed by Western blotting for CREB and actin, and parallel samples were treated with 100 nM calcitriol for 72 h. Total RNA was then extracted, and RT-PCR was done to assess mRNA abundance for CD14 and actin. The results shown are from one of two independent experiments with similar results. (B) After completion of calcitriol treatment, cells were incubated with mAb 3C10, followed by secondary FITC-conjugated, antimouse IgG and analyzed by flow cytometry. The histograms to the left in each panel represent untreated cells, and those displaced to the right are cells treated with calcitriol. The flow images shown are from one of three experiments that yielded similar results, and the bar graph below shows the mean ± SD for n = 3. The Western blot at the top of B shows the protein abundances for CREB and actin prior to calcitriol treatment. (C) Average values for CREB protein levels based on scanning densitometry for the two experiments shown in A and B.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Calcitriol is a pleiotropic immune modulator, which regulates the functional properties of mononuclear phagocytes and promotes host resistance to intracellular infection [1 , 12 13 14 15 16 ]. The classical genomic signaling pathway for cellular responses to calcitriol involves hormone binding to the cytosolic VDR. Ligand-occupied VDR forms a heterodimer with the retinoid X-receptor and enters the nucleus, where it activates transcription of target genes that contain specific DNA sequences known as VDREs [31 , 44 ]. The complexity of gene regulation by calcitriol is considerably greater than this would suggest, however, and recently, it was shown that a large number of genes regulated by calcitriol do not contain a canonical VDRE, and ~35% contain neither a consensus nor nonconsensus VDRE [31 ]. Thus, nongenomic signaling by calcitriol is involved prominently in cell regulation. This is directly germane to monocyte cell regulation, as hormone treatment of these cells is known to bring about important changes in gene expression that cannot be linked to the direct genomic signaling to the nucleus through VDREs [18 19 20 21 22 ]. Previously, our studies linked nongenomic signaling by calcitriol in monocytes to PI-3K [1 ]. However, an outstanding question has been how this nongenomic pathway brings about activation of hormone-responsive genes. In the present report, we show for the first time that calcitriol treatment of human mononuclear phagocytes brought about PI-3K-dependent activation of CREB (Fig. 3) . Activated CREB was then competent to bind to a region of the proximal CD14 promoter located at Positions –37 to –55, relative to the transcription start site (Fig. 6) , which contained multiple potential CRE-like elements (Fig. 2) . Consequently, this region of the promoter became transcriptionally active (Figs. 5 and 7) .

Nongenomic signaling by calcitriol has been a focus of considerable interest, and several potential models have been identified. For example, calcitriol has been shown to stimulate the rapid formation of second messengers including ceramides, cAMP, inositols, and calcium to activate a variety of protein kinases including PKC, Raf, MAPK, and Src family kinases [27 , 32 33 34 ]. In most of these instances, the mechanisms ultimately involved in bringing about nuclear responses remain to be defined. The findings we report above shed considerable new light on nongenomic signaling by calcitriol. The discovery that the hormone signals through PI-3K and CREB to activate the CD14 promoter is consistent with a recent study that examined gene-expression profiling [45 ]. In the latter report, it was shown that 40–50% of genes activated in a PI-3K-dependent manner in response to platelet-derived growth factor had on average two CREB-binding sites within their proximal promoters.

A key question that arises from these findings is how does calcitriol bring about CREB activation downstream of PI-3K. Classically, the cAMP-activated enzyme PKA phosphorylates and activates CREB at serine (Ser)133 [46 , 47 ]. This promotes the interaction of CREB with coactivator CREB-binding protein (CBP), and together, they bind as a dimer to a conserved CRE motif, TGACGTCA, or to a half-site CRE motif (CGTCA) [48 ] to activate gene transcription. In fact, calcitriol treatment has been shown to activate adenylate cyclase and to trigger increases in intracellular cAMP levels [43 ]. However, PKA has been shown to inhibit PI-3K [49 ], and we observed PI-3K activation in calcitriol-treated THP-1 cells [1 ]. Furthermore, we found that treatment of THP-1 cells with db-cAMP did not induce CD14 expression, and preincubation with db-cAMP blocked induction of CD14 in response to hormone (Fig. 8B) . Based on these findings, a direct role for PKA in PI-3K-dependent induction of gene expression (CD14, CD11b) in response to hormone seems highly unlikely. It is worth noting, however, that attenuation of calcitriol-induced CD14 expression by db-cAMP provided further indirect support for the role of CREB in regulating activation of CD14 in response to calcitriol. Thus, prior treatment of cells with db-cAMP would have led to activation of PKA and CREB. This then may have resulted in limiting amounts of CREB being available for subsequent activation and recruitment in a calcitriol and PI-3K-dependent manner to support induction of CD14 expression.

Although PKA was the first kinase shown to phosphorylate CREB on Ser133, numerous other kinases have been shown to have this capability as well [40 ], including PKB/Akt [50 ]. Although PKB/Akt acting downstream of PI-3K is an obvious attractive candidate in the context of our findings, we have been unable to detect any change in phospho-CREB levels in response to calcitriol treatment (data not shown). One caveat is that it is possible that this negative result may have been the result of the fact that the basal level of CREB Ser133 phosphorylation was consistently quite high, and this may have hindered detection of a signal in response to hormone.

Taken together, these findings suggest a novel mechanism of CREB activation in calcitriol-treated macrophages, independent of cAMP and PKA and direct phosphorylation by PKB. It is possible that calcitriol may bring about phosphorylation-independent modifications of CREB or CREB phosphorylation at residues other than Ser133, both of which have been described. For example, CREB has been shown to be a substrate for glycosylation, SUMO-ylation, acetylation, and ubiquitination, although the exact impact of these modifications on its activation is still unclear (reviewed in ref. [40 ]). Likewise, CREB activation may be brought about by increased recruitment of and complex formation with coactivator proteins such as CBP and C/EBP-ß [51 ].

One alternative model to explain how calcitriol activates macrophage gene expression in a PI-3K-dependent manner through CREB involves glycogen synthase kinase-3ß (GSK-3ß), which normally phosphorylates and inactivates CREB on Ser129. This reduces the ability of CREB to interact with coactivator CBP, resulting in decreased DNA-binding activity [46 , 47 , 52 ]. It is important that GSK-3ß is a constitutively active, serine/threonine kinase in resting cells, which is itself subject to phosphorylation and inactivation on Ser9 by Akt downstream of PI-3K [53 ] and PKC [54 , 55 ]. Thus, it is possible that calcitriol treatment of THP-1 cells leads to inactivation of GSK-3ß downstream of PI-3K/Akt, leading to reciprocal activation of CREB.

Whereas the findings we report above clearly delineate a pathway involving PI-3K and CREB, which regulates activation of CD14 in response to hormone treatment, it is likely that the full picture of how CD14 is regulated is likely to be more complex. This is suggested from results of experiments in which down-regulation of CREB using siRNA failed to attenuate CD14 expression, as assessed at the level of mRNA or protein (Fig. 9) . There are at least three potential explanations for this finding. First, although highly effective (70–80%), CREB silencing was not complete, and it is possible that the residual level of CREB was sufficient to support gene activation. Second, redundant pathways activated by calcitriol leading to activation of CD14 may exist. In this regard, previous reports have implicated other transcription factors in regulating CD14 expression. For example, calcitriol induction of CD14 expression was shown to involve Sp1 [35 ] or a combination of Sp1 and MEF2D [56 ], and our results indicate that calcitriol also activates Sp1 in a PI-3K-dependent manner (unpublished data). Induction of CD14 expression by hormone has also been linked to the retinoblastoma protein and to C/EBP-ß [38 ]. Third, it is important to note that down-regulation of CREB using RNA interference resulted in significant arrest of cell growth (50–70%) as compared with mock-transfected cells (data not shown). Growth arrest is known to promote cell differentiation, a condition that favors increased expression of differentiation markers such as CD14. Thus, it is possible that growth arrest induced by CREB silencing may have created conditions favorable to calcitriol-induced CD14 expression, even at reduced levels of CREB or potentially involving other transcriptional regulatory proteins. Taken together with the results in this report, these findings suggest the likelihood that nongenomic responses to calcitriol for monocyte differentiation likely involve multiple transcription factors whose activation is PI-3K-dependent. Some of these may act in concert to form an enhanceasome for optimal expression of calcitriol-induced genes, and others may function independently.


   ACKNOWLEDGEMENTS
 
This work was supported by Canadian Institutes of Health Research (CIHR) grants MOP-8633 (N. E. R.) and FRN-38005 (D. N.).

Received November 16, 2006; revised January 30, 2007; accepted February 1, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hmama, Z., Nandan, D., Sly, L., Knutson, K. L., Herrera-Velit, P., Reiner, N. E. (1999) 1{alpha},25-Dihydroxyvitamin D(3)-induced myeloid cell differentiation is regulated by a vitamin D receptor-phosphatidylinositol 3-kinase signaling complex J. Exp. Med. 190,1583-1594[Abstract/Free Full Text]
  2. Seljelid, R., Eskeland, T. (1993) The biology of macrophages: I. General principles and properties Eur. J. Haematol. 51,267-275[Medline]
  3. Araki, N., Johnson, M. T., Swanson, J. A. (1996) A role for phosphoinositide 3-kinase in the completion of macropinocytosis and phagocytosis by macrophages J. Cell Biol. 135,1249-1260[Abstract/Free Full Text]
  4. Yamamori, T., Inanami, O., Nagahata, H., Kuwabara, M. (2004) Phosphoinositide 3-kinase regulates the phosphorylation of NADPH oxidase component p47(phox) by controlling cPKC/PKC{delta} but not Akt Biochem. Biophys. Res. Commun. 316,720-730[CrossRef][Medline]
  5. Guha, M., Mackman, N. (2002) The phosphatidylinositol 3-kinase-Akt pathway limits lipopolysaccharide activation of signaling pathways and expression of inflammatory mediators in human monocytic cells J. Biol. Chem. 277,32124-32132[Abstract/Free Full Text]
  6. Fukao, T., Tanabe, M., Terauchi, Y., Ota, T., Matsuda, S., Asano, T., Kadowaki, T., Takeuchi, T., Koyasu, S. (2002) PI3K-mediated negative feedback regulation of IL-12 production in DCs Nat. Immunol. 3,875-881[CrossRef][Medline]
  7. Fukao, T., Koyasu, S. (2003) PI3K and negative regulation of TLR signaling Trends Immunol. 24,358-363[CrossRef][Medline]
  8. Boyle, I. T., Miravet, L., Gray, R. W., Holick, M. F., DeLuca, H. F. (1972) The response of intestinal calcium transport to 25-hydroxy and 1,25-dihydroxyvitamin D in nefrectomized rats Endocrinology 90,605-608[Medline]
  9. Nemere, I. (1995) Nongenomic effects of 1,25-dihydroxyvitamin D3: potential relation of a plasmalemmal receptor to the acute enhancement of intestinal calcium transport in chick J. Nutr. 125,1695S-1698S[Abstract/Free Full Text]
  10. Holick, M. F., Garabedian, M., DeLuca, H. F. (1972) 1,25-Dihydroxycholecalciferol: metabolite of vitamin D3 active on bone in anepheric rats Science 176,1146-1147[Abstract/Free Full Text]
  11. Raisz, L. G., Trummel, C. L., Holick, M. F., DeLuca, H. F. (1972) 1,25-Dihydroxycholecalciferol: a potent stimulator of bone resorption in tissue culture Science 175,768-769[Abstract/Free Full Text]
  12. Ustianowski, A., Shaffer, R., Collin, S., Wilkinson, R. J., Davidson, R. N. (2005) Prevalence and associations of vitamin D deficiency in foreign-born persons with tuberculosis in London J. Infect. 50,432-437[CrossRef][Medline]
  13. Wilkinson, R. J., Llewelyn, M., Toossi, Z., Patel, P., Pasvol, G., Lalvani, A., Wright, D., Latif, M., Davidson, R. N. (2000) Influence of vitamin D deficiency and vitamin D receptor polymorphisms on tuberculosis among Gujarati Asians in West London: a case-control study Lancet 355,618-621[CrossRef][Medline]
  14. Hmama, Z., Sendide, K., Talal, A., Garcia, R., Dobos, K., Reiner, N. E. (2004) Quantitative analysis of phagolysosome fusion in intact cells: inhibition by mycobacterial lipoarabinomannan and rescue by an 1{alpha},25-dihydroxyvitamin D3-phosphoinositide 3-kinase pathway J. Cell Sci. 117,2131-2140[Abstract/Free Full Text]
  15. Sly, L. M., Lopez, M., Nauseef, W. M., Reiner, N. E. (2001) 1{alpha},25-Dihydroxyvitamin D3-induced monocyte antimycobacterial activity is regulated by phosphatidylinositol 3-kinase and mediated by the NADPH-dependent phagocyte oxidase J. Biol. Chem. 276,35482-35493[Abstract/Free Full Text]
  16. Sly, L. M., Guiney, D. G., Reiner, N. E. (2002) Salmonella enterica serovar typhimurium periplasmic superoxide dismutases SodCI and SodCII are required for protection against the phagocyte oxidative burst Infect. Immun. 70,5312-5315[Abstract/Free Full Text]
  17. Liu, P. T., Stenger, S., Li, H., Wenzel, L., Tan, B. H., Krutzik, S. R., Ochoa, M. T., Schauber, J., Wu, K., Meinken, C., et al (2006) Toll-like receptor triggering of a vitamin D-mediated human antimicrobial response Science 311,1770-1773[Abstract/Free Full Text]
  18. Takahashi, T., Nakamura, K., Iho, S. (1997) Differentiation of myeloid cells and 1,25-dihydroxyvitamin D3 Leuk. Lymphoma 27,25-33[Medline]
  19. Brackman, D., Lund-Johansen, F., Aarskog, D. (1995) Expression of leukocyte differentiation antigens during the differentiation of HL-60 induced by 1,25-dihydroxyvitamin D3: comparison with the maturation of normal monocytic and granulocytic bone marrow cells J. Leukoc. Biol. 58,547-555[Abstract]
  20. Oberg, F., Botling, J., Nilsson, K. (1993) Functional antagonism between vitamin D3 and retinoic acid in the regulation of CD14 and CD23 expression during monocytic differentiation of U-937 cells J. Immunol. 150,3487-3495[Abstract]
  21. Schwende, H., Fitzke, E., Ambs, P., Dieter, P. (1996) Differences in the state of differentiation of THP-1 cells induced by phorbol ester and 1,25-dihydroxyvitamin D3 J. Leukoc. Biol. 59,555-561[Abstract]
  22. Abe, E., Miyaura, C., Sakagami, H., Takeda, M., Konno, K., Yamazaki, T., Yoshiki, S., Suda, T. (1981) Differentiation of mouse myeloid leukemia cells induced by 1{alpha},25-dihydroxyvitamin D3 Proc. Natl. Acad. Sci. USA 78,4990-4994[Abstract/Free Full Text]
  23. Panda, D. K., Miao, D., Tremblay, M. L., Sirois, J., Farookhi, R., Hendy, G. N., Goltzman, D. (2001) Targeted ablation of the 25-hydroxyvitamin D 1{alpha} -hydroxylase enzyme: evidence for skeletal, reproductive, and immune dysfunction Proc. Natl. Acad. Sci. USA 98,7498-7503[Abstract/Free Full Text]
  24. O’Kelly, J., Hisatake, J., Hisatake, Y., Bishop, J., Norman, A., Koeffler, H. P. (2002) Normal myelopoiesis but abnormal T lymphocyte responses in vitamin D receptor knockout mice J. Clin. Invest. 109,1091-1099[CrossRef][Medline]
  25. Griffin, M. D., Lutz, W. H., Phan, V. A., Bachman, L. A., McKean, D. J., Kumar, R. (2000) Potent inhibition of dendritic cell differentiation and maturation by vitamin D analogs Biochem. Biophys. Res. Commun. 270,701-708[CrossRef][Medline]
  26. Penna, G., Adorini, L. (2000) 1 {alpha},25-Dihydroxyvitamin D3 inhibits differentiation, maturation, activation, and survival of dendritic cells leading to impaired alloreactive T cell activation J. Immunol. 164,2405-2411[Abstract/Free Full Text]
  27. Marcinkowska, E., Wiedlocha, A., Radzikowski, C. (1997) 1,25-Dihydroxyvitamin D3 induced activation and subsequent nuclear translocation of MAPK is upstream regulated by PKC in HL60 cells Biochem. Biophys. Res. Commun. 241,419-426[CrossRef][Medline]
  28. Gniadecki, R. (1996) Activation of Raf-mitogen-activated protein kinase signaling in normal human keratinocytes pathway by 1,25-dihydroxyvitamin D3 in normal human keratinocytes J. Invest. Dermatol. 106,1212-1217[CrossRef][Medline]
  29. Lian, J. B., Stein, G. S. (1992) Transcriptional control of vitamin D-regulated proteins J. Cell. Biochem. 49,37-45[CrossRef][Medline]
  30. Berry, D. M., Anyochi, R., Bhatia, M., Meckling-Gill, K. A. (1996) 1,25-Dihydroxyvitamin D3 stimulates expression and translocation of protein kinase C{alpha} and C{delta} via a nongenomic mechanism and rapidly induces phosphorylation of a 33-kDa protein in acute promyelocytic NB4 cells J. Biol. Chem. 271,16090-16096[Abstract/Free Full Text]
  31. Wang, T. T., Tavera-Mendoza, L. E., Laperriere, D., Libby, E., MacLeod, N. B., Nagai, Y., Bourdeau, V., Konstorum, A., Lallemant, B., Zhang, R., Mader, S., White, J. H. (2005) Large-scale in silico and microarray-based identification of direct 1,25-dihydroxyvitamin D3 target genes Mol. Endocrinol. 19,2685-2695[Abstract/Free Full Text]
  32. Bouillon, R., Okamura, W. H., Norman, A. W. (1995) Structure-function relationships in the vitamin D endocrine system Endocr. Rev. 16,200-257[CrossRef][Medline]
  33. Gniadecki, R. (1998) Nongenomic signaling by vitamin D. A new face of Src Biochem. Pharmacol. 56,1273-1277[CrossRef][Medline]
  34. Kharbanda, S., Saleem, A., Emoto, Y., Stone, R. U., Kufe, D. (1994) Activation of Raf-1 and mitogen-activated protein kinases during monocytic differentiation of human myeloid leukemia cells J. Biol. Chem. 269,872-878[Abstract/Free Full Text]
  35. Zhang, D. E., Hetherington, C. J., Gonzalez, D. A., Chen, H. M., Tenen, D. G. (1994) Regulation of CD14 expression during monocytic differentiation induced with 1 {alpha},25-dihydroxyvitamin D3 J. Immunol. 153,3276-3284[Abstract]
  36. Giraudo, E., Primo, L., Audero, E., Gerber, H. P., Koolwijk, P., Soker, S., Klagsbrun, M., Ferrara, N., Bussolino, F. (1998) Tumor necrosis factor-{alpha} regulates expression of vascular endothelial growth factor receptor-2 and of its co-receptor neuropilin-1 in human vascular endothelial cells J. Biol. Chem. 273,22128-22135[Abstract/Free Full Text]
  37. Lee, J. S., Hmama, Z., Mui, A., Reiner, N. E. (2004) Stable gene silencing in human monocytic cell lines using lentiviral-delivered small interference RNA. Silencing of the p110{alpha} isoform of phosphoinositide 3-kinase reveals differential regulation of adherence induced by 1{alpha},25-dihydroxycholecalciferol and bacterial lipopolysaccharide J. Biol. Chem. 279,9379-9388[Abstract/Free Full Text]
  38. Ji, Y., Studzinski, G. P. (2004) Retinoblastoma protein and CCAAT/enhancer-binding protein ß are required for 1,25-dihydroxyvitamin D3-induced monocytic differentiation of HL60 cells Cancer Res. 64,370-377[Abstract/Free Full Text]
  39. Zhang, D. E., Hetherington, C. J., Tan, S., Dziennis, S. E., Gonzalez, D. A., Chen, H. M., Tenen, D. G. (1994) Sp1 is a critical factor for the monocytic specific expression of human CD14 J. Biol. Chem. 269,11425-11434[Abstract/Free Full Text]
  40. Johannessen, M., Delghandi, M. P., Moens, U. (2004) What turns CREB on? Cell. Signal. 16,1211-1227[CrossRef][Medline]
  41. Mayr, B., Montminy, M. (2001) Transcriptional regulation by the phosphorylation-dependent factor CREB Nat. Rev. Mol. Cell Biol. 2,599-609[CrossRef][Medline]
  42. Tasken, K., Aandahl, E. M. (2004) Localized effects of cAMP mediated by distinct routes of protein kinase A Physiol. Rev. 84,137-167[Abstract/Free Full Text]
  43. Vazquez, G., Boland, R., de Boland, A. R. (1995) Modulation by 1,25(OH)2-vitamin D3 of the adenylyl cyclase/cyclic AMP pathway in rat and chick myoblasts Biochim. Biophys. Acta 1269,91-97[Medline]
  44. Ebert, R., Schutze, N., Adamski, J., Jakob, F. (2006) Vitamin D signaling is modulated on multiple levels in health and disease Mol. Cell. Endocrinol. 248,149-159[CrossRef][Medline]
  45. Tullai, J. W., Schaffer, M. E., Mullenbrock, S., Kasif, S., Cooper, G. M. (2004) Identification of transcription factor binding sites upstream of human genes regulated by the phosphatidylinositol 3-kinase and MEK/ERK signaling pathways J. Biol. Chem. 279,20167-20177[Abstract/Free Full Text]
  46. Bullock, B. P., Habener, J. F. (1998) Phosphorylation of the cAMP response element binding protein CREB by cAMP-dependent protein kinase A and glycogen synthase kinase-3 alters DNA-binding affinity, conformation, and increases net charge Biochemistry 37,3795-3809[CrossRef][Medline]
  47. Grimes, C. A., Jope, R. S. (2001) CREB DNA binding activity is inhibited by glycogen synthase kinase-3 ß and facilitated by lithium J. Neurochem. 78,1219-1232[CrossRef][Medline]
  48. Montminy, M. R., Sevarino, K. A., Wagner, J. A., Mandel, G., Goodman, R. H. (1986) Identification of a cyclic-AMP-responsive element within the rat somatostatin gene Proc. Natl. Acad. Sci. USA 83,6682-6686[Abstract/Free Full Text]
  49. Mei, F. C., Qiao, J., Tsygankova, O. M., Meinkoth, J. L., Quilliam, L. A., Cheng, X. (2002) Differential signaling of cyclic AMP: opposing effects of exchange protein directly activated by cyclic AMP and cAMP-dependent protein kinase on protein kinase B activation J. Biol. Chem. 277,11497-11504[Abstract/Free Full Text]
  50. Du, K., Montminy, M. (1998) CREB is a regulatory target for the protein kinase Akt/PKB J. Biol. Chem. 273,32377-32379[Abstract/Free Full Text]
  51. Chen, Y., Zhuang, S., Cassenaer, S., Casteel, D. E., Gudi, T., Boss, G. R., Pilz, R. B. (2003) Synergism between calcium and cyclic GMP in cyclic AMP response element-dependent transcriptional regulation requires cooperation between CREB and C/EBP-ß Mol. Cell. Biol. 23,4066-4082[Abstract/Free Full Text]
  52. Martin, M., Rehani, K., Jope, R. S., Michalek, S. M. (2005) Toll-like receptor-mediated cytokine production is differentially regulated by glycogen synthase kinase 3 Nat. Immunol. 6,777-784[CrossRef][Medline]
  53. Monick, M. M., Carter, A. B., Robeff, P. K., Flaherty, D. M., Peterson, M. W., Hunninghake, G. W. (2001) Lipopolysaccharide activates Akt in human alveolar macrophages resulting in nuclear accumulation and transcriptional activity of ß-catenin J. Immunol. 166,4713-4720[Abstract/Free Full Text]
  54. Vilimek, D., Duronio, V. (2006) Cytokine-stimulated phosphorylation of GSK-3 is primarily dependent upon PKCs, not PKB Biochem. Cell Biol. 84,20-29[CrossRef][Medline]
  55. Tsujio, I., Tanaka, T., Kudo, T., Nishikawa, T., Shinozaki, K., Grundke-Iqbal, I., Iqbal, K., Takeda, M. (2000) Inactivation of glycogen synthase kinase-3 by protein kinase C {delta}: implications for regulation of {tau} phosphorylation FEBS Lett. 469,111-117[CrossRef][Medline]
  56. Park, S. Y., Shin, H. M., Han, T. H. (2002) Synergistic interaction of MEF2D and Sp1 in activation of the CD14 promoter Mol. Immunol. 39,25-30[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Leukoc. Biol.Home page
A. Moeenrezakhanlou, L. Shephard, L. Lam, and N. E. Reiner
Myeloid cell differentiation in response to calcitriol for expression CD11b and CD14 is regulated by myeloid zinc finger-1 protein downstream of phosphatidylinositol 3-kinase
J. Leukoc. Biol., August 1, 2008; 84(2): 519 - 528.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article: