Journal of Leukocyte Biology eBioscience full spectrum cell analysis
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.1006643 on January 29, 2007

Published online before print January 29, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.1006643v1
81/4/942    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guillermo, L. V. C.
Right arrow Articles by Lopes, M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guillermo, L. V. C.
Right arrow Articles by Lopes, M. F.
(Journal of Leukocyte Biology. 2007;81:942-951.)
© 2007 by Society for Leukocyte Biology

The Fas death pathway controls coordinated expansions of type 1 CD8 and type 2 CD4 T cells in Trypanosoma cruzi infection

Landi V. Costilla Guillermo*, Elisabeth M. Silva*, Flávia L. Ribeiro-Gomes*, Juliana De Meis*, Wânia F. Pereira*, Hideo Yagita{dagger}, George A. DosReis* and Marcela F. Lopes*,1

* Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil; and
{dagger} Juntendo University School of Medicine, Tokyo, Japan

1 Correspondence: Instituto de Biofísica Carlos Chagas Filho, Centro de Ciências da Saúde, Universidade Federal do Rio de Janeiro, Av. Carlos Chagas Filho, Ilha do Fundão, Rio de Janeiro, RJ, 21941-902, Brazil. E-mail: marcelal{at}biof.ufrj.br

ABSTRACT

We investigated the role of the Fas ligand (FasL)/Fas death pathway on apoptosis and cytokine production by T cells in Trypanosoma cruzi infection. Anti-FasL, but not anti-TNF-{alpha} or anti-TRAIL, blocked activation-induced cell death of CD8 T cells and increased secretion of IL-10 and IL-4 by CD4 T cells from T. cruzi-infected mice. CD4 and CD8 T cells up-regulated Fas/FasL expression during T. cruzi infection. However, Fas expression increased earlier in CD8 T cells, and a higher proportion of CD8 T cells was activated and expressed IFN-{gamma} compared with CD4 T cells. Injection of anti-FasL in infected mice reduced parasitemia and CD8 T cell apoptosis and increased the ratio of CD8:CD4 T cells recovered from spleen and peritoneum. FasL blockade increased the number of activated T cells, enhanced NO production, and reduced parasite loads in peritoneal macrophages. Injection of anti-FasL increased IFN-{gamma} secretion by splenocytes responding to T. cruzi antigens but also exacerbated production of type 2 cytokines IL-10 and IL-4 at a late stage of acute infection. These results indicate that the FasL/Fas death pathway regulates apoptosis and coordinated cytokine responses by type 1 CD8 and type 2 CD4 T cells in T. cruzi infection.

Key Words: Chagas’ disease • Th2 cytokines • apoptosis • FasL

INTRODUCTION

Chagas’ disease, as a result of infection with the protozoan parasite Trypanosoma cruzi, affects 16–18 million people and represents a major health problem in developing countries. Despite efforts, the insect vector has not been eradicated, and disease burden persists in Latin America. Immune responses involving T and B cells [1 2 3 4 ] and type 1 cytokines [5 ] control parasitemia during acute infection but fail to eliminate the parasite in host tissues. We have shown previously that T cells die by apoptosis during T. cruzi infection [6 ]. Moreover, apoptotic cells increase parasite replication in cocultured macrophages [7 , 8 ], and injection of apoptotic lymphocytes exacerbates parasitemia in infected mice [7 ].

Apoptosis is induced through different routes in T cell subsets. Whereas CD4 T cells die upon activation through Fas ligand (FasL)/Fas receptor-induced death [9 ] or by apoptosis induced by Bim [10 ] or granzyme B [11 ], CD8 T cells undergo apoptosis mediated by TNF-{alpha}, TRAIL, FasL, perforin, or Bim [12 13 14 15 ]. The mechanisms of cell death have been investigated in lymphocytes from experimental Chagas’ disease [6 , 16 17 18 19 20 ]. Although CD4 and CD8 T cells express Fas and FasL upon infection with T. cruzi [16 , 19 ], CD8 T cells from T. cruzi-infected mice undergo spontaneous apoptosis in cell cultures, whereas activation with TCR agonists triggers CD4 T cell death [6 ] through the Fas death pathway [16 ]. In addition, increased Fas expression and apoptosis have been observed in B cells [17 , 18 ]. It remains unknown whether Fas and FasL play a role in CD8 T cell apoptosis during T. cruzi infection [6 , 16 , 19 ].

Similarly, the mechanisms of cross-talk between Fas death signaling and cytokine responses are not well understood [21 ] and require further investigation. Previous and recent studies suggest that Th1 but not Th2 CD4 T cells undergo activation-induced cell death (AICD) through the Fas death pathway [22 , 23 ], whereas Th2 cell death is induced by granzyme B [11 ]. However, disruption of the FasL/Fas pathway in FasL-deficient, BALB.gld mice leads to increased Th2 cytokine responses and susceptibility to T. cruzi infection [16 ]. Similar results were obtained in Fas-deficient MRL.lpr mice infected with T. cruzi [20 , 24 ]. Although these [16 , 20 ] and other observations [25 ] indicate that CD4 Th2 cells also die upon FasL/Fas interactions, chronic alterations in the immune system as a result of lpr or gld phenotypes may have affected the onset of immune responses to T. cruzi infection [16 , 20 ]. In agreement with this hypothesis, increased IL-10 expression has also been reported for Fas-deficient lpr mice and patients with autoimmune lymphoproliferative syndrome [26 , 27 ].

To better understand how FasL affects T cell death and cytokine production, we systemically blocked FasL/Fas interactions with anti-FasL antibody during T. cruzi infection. Here, we show that inhibition of Fas-mediated apoptosis affected immune responses to T cruzi. The results suggest that Fas plays a major regulatory role in T. cruzi infection by controlling CD8 T cell expansion and Th1 and Th2 cytokine responses to parasite antigens.

MATERIALS AND METHODS

Mice and T. cruzi infection
Male BALB/c mice, age 6–8 weeks, were infected i.p. with 2 x 105 T. cruzi (Clone Dm28c) trypomastigotes, obtained by chemically induced metacyclogenesis [28 ]. Groups of infected mice were treated at 11, 14, 18, and 21 days after infection with 150 µg/injection anti-FasL (Clone MFL3, BD PharMingen, San Diego, CA, USA), control hamster IgG (normal hamster serum purified through a protein A column, Pierce, Rockford, IL, USA), or diluent only (PBS). Parasitemia was detected in blood from tails by counting trypomastigote forms. Mice in all groups remained alive upon infection and treatment. For experiments, mice were killed during the acute phase, at 19 and 25 days postinfection (dpi). All experiments and animal handling were conducted according to approved institutional protocols.

Cell suspensions and cultures
Splenocytes were depleted of RBC by treatment with Tris-buffered ammonium chloride. T cell-enriched suspensions were obtained by nylon wool filtration of splenocytes. Purified CD4 T cells (>90% CD4+cells) were obtained by negative selection with a mAb mix (BD PharMingen) containing anti-B220, anti-MHC-II, anti-CD8, anti-CD11b, anti-NK cells, and anti-IgG magnetic beads (Dynal, Oslo, Norway), as described before [29 ]. For CD4 T cell depletion, T cells were treated with anti-CD4 only and anti-IgG magnetic beads (Dynal). For CD8 T cell purification (>90% CD8+cells), CD8 T cells were positively selected with anti-CD8-coated magnetic beads (Dynal). Splenocytes or T cells were resuspended in DMEM (Invitrogen Life Technologies, Carlsbad, CA, USA), supplemented with 2 mM glutamine, 5 x 10–5 M 2-ME, 10 µg/ml gentamicin, 1 mM sodium pyruvate, and 0.1 mM MEM nonessential amino acids (culture medium) plus 10% FBS (Invitrogen Life Technologies). T cells (2x106/ml) were cultured in duplicate in medium only or stimulated with 10 µg/ml plate-bound anti-CD3 (mAb 2C11, BD PharMingen) in 48-well vessels. Cultures were set at 37°C and 7% CO2 in a humid atmosphere for 24 h. Unfractionated T cells and CD4 or CD8 T cells were added to plates and incubated with 10 µg/ml anti-FasL, IgG control mAb, anti-TRAIL, anti-TNF-{alpha} (BD PharMingen), or medium only. Cytokines (IL-4, IL-10, IL-2, and IFN-{gamma}) were evaluated by ELISA in culture supernatants, collected after 24 h in culture. Cell recovery was determined by cell counts on culture samples and by flow cytometry to estimate T cell subpopulations. Apoptosis was evaluated by flow cytometry as described below. AICD was calculated as the percentage of cell loss induced by anti-CD3, taking the mean of viable cells in untreated cultures (medium only) as 100% of control: % AICD = 100 – (viable cells with treatment) x 100/(viable cells in untreated cultures).

Flow cytometry
Fresh or cultured cells were washed in sorting buffer (containing 2% FBS) and incubated with anti-CD16/CD32 for Fc blocking, followed by addition of allophycocyanin (APC)-labeled anti-CD8, anti-CD4, or anti-CD19 for 30 min at 4°C. Cells were also stained with PE-labeled anti-CD62L, FITC-labeled anti-CD44, or PE-labeled anti-Fas, and FITC-labeled anti-CD4 or anti-CD8. Cells were washed and acquired on a FACSCalibur system by using CellQuest software (BD Biosciences, San Jose, CA, USA). All mAb used in flow cytometry are from BD PharMingen. For apoptosis detection, cells were washed to remove excess of surface-staining reagents and then stained with FITC-annexin V (apoptosis detection kit, R&D Systems, Minneapolis, MN, USA) for 20 min at room temperature in annexin buffer; 7-amino-actinomycin (7-AAD) was added just prior to flow cytometry. For analysis, FlowJo software was used (TreeStar, Ashland, OR, USA).

CFSE and cytokine staining
T cells (2x107) were stained with 4 µM CFSE (Molecular Probes, Eugene, OR, USA) and cultured (1x106 /well) for 24 h with anti-CD3 in the presence of anti-FasL or control IgG. Cells were stained with APC-labeled anti-CD8, as above, and analyzed by flow cytometry using FlowJo software. For cytokine staining, splenocytes were cultured with 10 ng/ml PMA (Sigma Chemical Co., St. Louis, MO, USA) and 0.5 µg/ml ionomicin (Sigma Chemical Co.) for 4 h. Brefeldin (10 µg/ml, Sigma Chemical Co.) was added after 1 h to prevent cytokine secretion. Cells were stained with anti-CD4 or anti-CD8, permeabilized, and stained with FITC-labeled anti-IFN-{gamma} (BD PharMingen).

Semiquantitative RT-PCR
Total RNA was isolated from 5 x 106 CD8 T cells and transcribed to cDNA with RT (Promega, Madison, WI, USA). Aliquots from cDNA preparations were amplified for 33 cycles in the presence of Taq DNA polymerase with the following primers: FasL forward, 5'(CAAGGCTGTGAGAAGGAAACC)3'; reverse, 5'(CCCATGATAAAGAATAGTAGA) 3', as described [16 ]. A specific probe was used to detect FasL, 5'(GGAACCGCTCTGATCTCTCTGGA)3' (Bioserve Biotechnologies, Laurel, MD, USA), by chemiluminescent reaction (Amersham, Piscataway, NJ, USA). Hypoxanthine guanine phosphoribosyl transferase (HPRT) message was used as an internal control [30 ].

Peritoneal macrophages
Cells were collected by peritoneal wash, counted, and analyzed by flow cytometry, as above. Macrophages (3x105/well) were added to plates and cultured for 2–3 h before removal of nonadherent cells. Macrophages were cultured with 2 ng/ml IFN-{gamma} (BD PharMingen) and 10 ng/ml LPS (Sigma Chemical Co.) or in medium only for 48 h for NO production. Supernatants were collected and mixed with an equal volume of Griess reagent to determine nitrite content, as described [31 ]. Trypomastigotes released from macrophages were counted in supernatants after 14–16 days in cultures.

ELISA
Splenocytes from each animal were cultured in duplicate (3x105/well) in round-bottom, 96-well vessels for 48 h (19 dpi) or 72 h (25 dpi) with T. cruzi antigens (parasite lysates of 3x105 metacyclic trypomastigotes/well) or with medium alone. Cytokines IFN-{gamma}, IL-2, IL-4, and IL-10 were measured in culture supernatants by sandwich ELISA, using pairs of specific mAb, one of which was labeled with biotin, and developed with avidin-HRP and substrate, according to the manufacturer’s instructions (BD PharMingen).

Statistics
Data were analyzed by Student’s t test for independent samples using a SigmaPlot for Windows (Version 4.01) package. Results are expressed as average and SEM in figures. The number (n) of animals per group was indicated in figure legends; * is denoted for significant differences, P < 0.05. For parasitemia, data were transformed to neparian logarithm (ln) parasites/ml for statistical analysis. For in vitro experiments, data are expressed as the average of two or three determinations per treatment in each of at least three repeat experiments, and significant differences were indicated for P < 0.05 (*).

RESULTS

Up-regulation of Fas/FasL expression in T cells during T. cruzi infection
We analyzed T cell expression of Fas and FasL in the course of T. cruzi infection (Fig. 1A 1B 1C 1D 1E 1F ). After 9 days of infection, Fas expression was up-regulated in T cells from infected compared with normal mice (Fig. 1E) . Fas expression increased faster in CD8 than in CD4 T cells (Fig. 1A 1B 1C 1D 1E) , peaking at 16 dpi in CD8 T cells (Fig. 1C) and at 23 dpi in CD4 T cells (Fig. 1A and 1B) when Fas expression had already dropped in CD8 T cells (Fig. 1D) . Fas expression closely followed earlier expansion and later, depletion of lymphocytes in spleen upon T. cruzi infection (Fig. 1E) . FasL expression was detected by RT-PCR in CD4 [16 ] and CD8 (Fig. 1F) T cells during acute infection. Next, we investigated whether Fas and FasL expression on T cells affected their susceptibility to undergo apoptosis.


Figure 1
View larger version (30K):
[in this window]
[in a new window]

  		Figure 1. Up-regulation of Fas and FasL expression in acute T. cruzi infection. (A–E) Flow cytometry analyses show increased expression of Fas on CD4 (A, B) and CD8 (C, D) T cells upon infection at 16 (A, C) and 23 (B, D) dpi. (E) Kinetics of lymphocyte expansion (right axis) and Fas expression on T cells (left axis) in the course of infection. (F) FasL expression (by RT-PCR) in CD8 T cells during T. cruzi infection.

 
AICD in CD4 and CD8 T cells
By using viable cell counts, we have shown previously that purified CD4 T cells from T. cruzi-infected mice undergo AICD [6 ], which is blocked partially by anti-FasL [16 ]. Conversely, we observed increased spontaneous apoptosis, but not AICD, in purified CD8 T cells from T. cruzi-infected mice [6 ]. Here, we addressed the role of FasL/Fas interactions in CD4 and CD8 T cell death in vitro and in vivo by using flow cytometry analysis of annexin V binding to apoptotic cells. The results show that apoptosis increased in CD4 and CD8 T cells from infected mice upon stimulation of unfractionated T cell cultures with anti-CD3 (Fig. 2 ). Addition of anti-FasL to cultures partially prevented CD4 T cell death (Fig. 2A) but blocked AICD completely in CD8 T cells (Fig. 2C) . Anti-FasL, but not anti-TRAIL or anti-TNF-{alpha}, increased recovery of viable CD4 (Fig. 2B) and CD8 (Fig. 2D) T cells in stimulated cultures. Whereas equivalent numbers of viable CD4 and CD8 T cells were recovered from cultures activated with anti-CD3, CD8 T cells outnumbered CD4 T cells in the presence of anti-FasL (compare Fig. 2 B and D ). Compared with unstimulated CD8 T cells, the number of viable CD8 T cells decreased upon activation with anti-CD3 in CD4-depleted T cell cultures (Fig. 2E) . Treatment with anti-FasL, but not control IgG, increased the recovery of viable CD8 T cells, even in the absence of CD4 T cells (Fig. 2E) . In contrast to anti-TRAIL or anti-TNF-{alpha}, anti-FasL increased the viability of purified CD8 T cells (Fig. 2F) . Therefore, CD8 T cells from T. cruzi-infected mice undergo AICD autonomously by Fas-mediated apoptosis.


Figure 2
View larger version (22K):
[in this window]
[in a new window]

  		Figure 2. Fas-mediated T cell death in vitro. Unfractionated T cell cultures (A–D) or CD8 T cells (E and F) from mice infected with T. cruzi were cultured in medium only or were stimulated with anti-CD3 and treated with anti-FasL, control IgG, anti-TNF-{alpha}, or anti-TRAIL for 24 h. T cell death (A, C) and T cell numbers (B and D–F) were evaluated by cell counts and flow cytometry with anti-CD4 (A and B) and anti-CD8 (C–F). AICD was calculated as a decrease in cell viability determined by annexin V/7-AAD staining (A and C) upon stimulation with anti-CD3. Significant differences between T cells activated with anti-CD3 and stimulated T cells treated with anti-FasL are indicated (*) for P < 0.05.

 
Proliferation of CD8 T cells rescued by anti-FasL
Compared with CD8 T cells from normal mice, CD8 T cells from infected mice undergo spontaneous cell death in vitro (Fig. 3A and 3B ), as reported previously [6 ]. However, differences between normal and infected mice were more remarkable in anti-CD3-activated T cell cultures. There was a drop in the numbers of CD8 T cells from infected but not normal mice in stimulated cultures (Fig. 3A and 3B) . Anti-FasL increased the recovery of CD8 T cells significantly upon 24 h (Fig. 3B) or 48 h (not shown) in stimulated T cell cultures. We also analyzed the effects of anti-FasL on proliferation of CFSE-stained CD8 T cells upon stimulation with anti-CD3. There is a paucity of CFSE+CD8 T cells from infected mice, compared with T cells from normal mice in activated cultures (Fig. 3C) . However, in the presence of anti-FasL, the numbers of CFSE+CD8 T cells (Fig. 3C) , as well as the division indexes, were equivalent for CD8 T cells from normal (0.72) and infected (0.77) mice. CD8 T cells underwent one to three cell divisions (Fig. 3C) . Therefore, by blocking apoptosis, anti-FasL rescued proliferation of CD8 T cells from infected mice. Altogether, these results suggest that the Fas death pathway could play a role in the regulation of immune responses to T. cruzi in vivo.


Figure 3
View larger version (21K):
[in this window]
[in a new window]

  		Figure 3. Fas controls CD8 T cell apoptosis and proliferation in vitro. (A and B) T cells from normal (A) or infected (B) mice were analyzed fresh or cultured with anti-CD3 in the presence of anti-FasL ({alpha}FasL) or control IgG for 24 h. Cells were collected and analyzed by flow cytometry for anti-CD8 staining and number of counts within the lymphocyte gate. Significant differences (P<0.05) are indicated (*) for comparisons between T cells activated with anti-CD3 and stimulated T cells treated with anti-FasL. (C) T cells from normal (upper panels) and infected (lower panels) mice were stained with CFSE and cultured with anti-CD3 in the presence of control IgG (left panels) or anti-FasL (right panels). After 24 h, cells were collected, stained with anti-CD8, and analyzed by flow cytometry by using FlowJo software. Controls for undivided cells from normal (upper left panel) and infected (lower left panel) were included as histogram insets.

 
Fas/FasL blockade improves host immune responses to T. cruzi
To investigate the effects of blocking Fas-mediated apoptosis in vivo, mice were injected with anti-FasL during acute infection. Parasitemia was followed throughout infection, and T cell death was evaluated ex vivo. A significant decrease in peak parasitemia (Fig. 4A ) and in CD8 T cell apoptosis (Fig. 4B) was observed in infected mice treated with anti-FasL, compared with mice treated with a control IgG antibody or diluent (PBS) only. Accordingly, CD8 T cell numbers increased in the spleens from mice treated with anti-FasL compared with mice treated with control IgG (Fig. 4C) or PBS (see Fig. 5C ). To evaluate immune control of intracellular infection, we studied the peritoneal cells of infected mice. We found that T cells infiltrated the peritoneum at 19 dpi (Fig. 4D) , and CD8 T cells outnumbered CD4 T cells at a ratio of 3:1 in mice treated with anti-FasL. Peritoneal macrophages recovered from mice treated with anti-FasL produced NO spontaneously (Fig. 4E) and controlled better endogenous infection (Fig. 4F) . However, upon stimulation with IFN-{gamma} and LPS in vitro, equivalent amounts of nitrite (100 µM) were detected in macrophages from untreated and treated mice (Fig. 4E , inset), and macrophages from control mice also killed parasites (Fig. 4F) .


Figure 4
View larger version (22K):
[in this window]
[in a new window]

  		Figure 4. Regulation of CD8 T cell apoptosis by Fas in acute T. cruzi infection. Infected mice were treated with anti-FasL, control IgG, or PBS. (A) Parasitemia was followed throughout acute infection. Significant differences (P<0.05) are indicated (*) for infected mice treated with anti-FasL (n=6 mice/group) and control groups (n=6–7 mice/group). PBS and IgG control groups were represented as a single dashed line for simplicity, as treatment with IgG did not differ from the PBS control group. (B) Decreased CD8 T cells apoptosis upon treatment with anti-FasL. Splenocytes from normal and infected (25 dpi) mice were stained with anti-CD8 and annexin V and analyzed by flow cytometry within the CD8+ cell gate. Annexin V+ cells were considered as apoptotic cells. Significant differences (P<0.05) are indicated (*) for infected mice treated with anti-FasL and control (IgG/PBS) groups (n=3–4 mice/group). (C) Accumulation of splenic CD8 T cells in infected (25 dpi) mice treated with anti-FasL, as assessed by cell counts and flow cytometry. Significant differences (P<0.05) are indicated (*) for infected mice treated with anti-FasL and control IgG group. (D–F) Increased immune responses in the peritoneum of infected (19 dpi) mice treated with anti-FasL. Increased numbers of infiltrating T cells detected by flow cytometry (D) and spontaneous NO production in macrophages from mice treated with anti-FasL (E). (E and F) Macrophages were cultured with medium only or were activated with IFN-{gamma} (E, inset). (E) Supernatants were collected after 48 h to evaluate nitrite contents. (F) Macrophages from infected mice treated with anti-FasL controlled better endogenous infection. In D–F, significant differences (P<0.05) are indicated (*) for infected mice treated with anti-FasL and the control (PBS) group (n=3–4 mice/group). In F, significant differences were also indicated (*) for macrophages treated with IFN-{gamma}+LPS and medium only (16 days, PBS group).

 

Figure 5
View larger version (20K):
[in this window]
[in a new window]

  		Figure 5. Accumulation of lymphocytes in infected mice treated with anti-FasL. Mice were treated with anti-FasL or PBS (control) during acute T. cruzi infection. Lymphocytes from spleens (A–C) or s.c. lymph nodes (D–F) from normal or infected (19 dpi) mice were counted, stained with anti-CD19 (A and D), anti-CD4 (B and E), or anti-CD8 (C and F), and analyzed by flow cytometry. Significant differences (P<0.05) are indicated (*) for infected mice treated with anti-FasL and control group (n=3–4 mice/group).

 
We also investigated the effects of anti-FasL on B and T cells resident in secondary lymphoid organs at 19 dpi (Fig. 5) . Spleens (Fig. 1E) and s.c. lymph nodes (Fig. 5D 5E 5F) of mice infected with T. cruzi undergo considerable expansion during infection. The injection of anti-FasL further increased the numbers of B and T cells accumulated in spleens (Fig. 5A 5B 5C) and lymph nodes (Fig. 5D 5E 5F) of treated mice, compared with infected mice treated with control diluent. The expansion of CD8 T cells goes faster than CD4 T cell proliferation in spleens, decreasing the CD4:CD8 ratio from 2:1 (in normal mice) to 1:1 in infected mice, as reported previously [6 ]. At 19 dpi, we observed increased numbers of CD8 T cells in the spleens of mice treated with anti-FasL, further dropping the CD4/CD8 ratio to 1:2 (compare Fig. 5 , B and C). There was also an increase in the accumulation of memory/activated CD4 and CD8 T cells in the spleens of treated mice (Fig. 6A and 6B ). A higher proportion of CD8 than CD4 T cells was activated (Fig. 6C and 6D) and expressed IFN-{gamma} (Fig. 6E and 6F) in infected mice, independent of treatment. Therefore, injection of anti-FasL led to efficient local and systemic immune responses and increased resistance to T. cruzi infection.


Figure 6
View larger version (21K):
[in this window]
[in a new window]

  		Figure 6. Accumulation of activated T cells in infected mice treated with anti-FasL. Mice were infected and treated with anti-FasL or PBS (control). (A–D) Absolute numbers (A and B) and percentages (C and D) of activated T cells in spleens from normal or infected (19 dpi) mice were evaluated by cell counts and flow cytometry with anti-CD4 (A and C), anti-CD8 (B and D), anti-CD44, and anti-CD62L staining. CD44hi CD62Llow CD4+ or CD8+ cells were considered as activated T cells. (E and F) Splenocytes from normal or infected mice were cultured with PMA and ionomicin for 4 h, stained with anti-CD4 (E), anti-CD8 (F), and anti-IFN-{gamma}, and analyzed by flow cytometry. Significant differences (P<0.05) are indicated (*) for infected mice treated with the anti-FasL and control (PBS) group (n=3 mice/group).

 
Regulation of T cell cytokine responses by FasL/Fas interactions
We also investigated how the FasL/Fas pathway regulates the production of cytokines by CD4 and CD8 T cells in the course of infection. For that, we evaluated cytokine responses in anti-CD3-stimulated T cells from infected mice, by treating T cells with anti-FasL in vitro. A significant increase in the production of IL-10 and IL-4 (Fig. 7A 7B, and 7D ), but not IL-2 (Fig. 7C) or IFN-{gamma} (Fig. 7E and 7F) , was observed in supernatants from T cell cultures treated with anti-FasL. CD4 T cells were the main source of IL-10 (Fig. 7D) , IL-4, and IL-2 (not shown), whereas CD4 and CD8 T cells produced IFN-{gamma} (Figs. 6 and 7E and 7F) . Moreover, splenocytes from infected mice treated in vivo with anti-FasL produced increased amounts of IFN-{gamma} in response to T. cruzi antigens at 19 and 25 dpi (Fig. 8A and 8D ). In contrast, type 2 cytokine responses predominated later, on infection in mice injected with anti-FasL (Fig. 8E and 8F) . These results suggest that the FasL/Fas pathway can have opposed effects on immunity by regulating early type 1 and late type 2 responses in the course of T. cruzi infection (Fig. 9 ).


Figure 7
View larger version (21K):
[in this window]
[in a new window]

  		Figure 7. Fas regulates cytokine responses in vitro. (A–C) T cells from infected mice (25 dpi), purified CD4 (D and E), and CD8 (F) T cells were stimulated with anti-CD3 and treated with anti-FasL, anti-TRAIL, or anti-TNF-{alpha} in vitro. Cytokines IL-10 (A and D), IL-4 (B), IL-2 (C), and IFN-{gamma} (E and F) were evaluated in 24 h culture supernatant. IL-4, IL-2, and IL-10 were not detected in purified CD8 T cell cultures. Significant differences (P<0.05) are indicated (*) for stimulated T cells treated with anti-FasL and stimulated T cells treated with anti-TRAIL and anti-TNF-{alpha} or activated with anti-CD3 only.

 

Figure 8
View larger version (23K):
[in this window]
[in a new window]

  		Figure 8. The Fas pathway regulates types 1 and 2 cytokine responses to T. cruzi antigens (Ag). Mice were treated with anti-FasL, PBS, or control IgG during acute T. cruzi infection. Cytokine responses were evaluated at 19 (A–C) and 25 (D–F) dpi. Splenocytes from normal or infected mice were stimulated with T. cruzi antigens or were cultured with medium only, and culture supernatants were collected after 48 or 72 h and tested for IFN-{gamma} (A and D), IL-4 (B and E), and IL-10 (C and F). Significant differences (P<0.05) are indicated (*) for stimulated T cells from infected mice treated with anti-FasL and T cells from control IgG/PBS groups (n=3–4 mice/group).

 

Figure 9
View larger version (25K):
[in this window]
[in a new window]

  		Figure 9. Treatment with anti-FasL up-regulates immune responses to T. cruzi infection. Mice were treated with anti-FasL in the course of infection. Anti-FasL can block interactions between Fas receptor and membrane (A) or secreted (B) FasL. The antiapoptotic effects of anti-FasL are highlighted in red. (A) Early, local immune response. Treatment with anti-FasL inhibits apoptosis of activated CD8 T cells that proliferate and produce IFN-{gamma}, which activates peritoneal macrophages (M{phi}) to produce NO, which kills parasites. (B) Late systemic immune responses. B cells and CD4 and CD8 T cells express Fas and FasL in the spleen. Treatment with anti-FasL blocks apoptosis of B cells, CD8 T cells, and activated CD4 T cells, increasing production of Th1 (IFN-{gamma}) and Th2 (IL-4/IL-10) cytokines. IL-10 antagonizes IFN-{gamma} effects on macrophages and favors infection.

 
DISCUSSION

The regulation of T cells by Fas-mediated apoptosis may affect immune responses to T. cruzi infection (Fig. 9) . CD8 T cell death is critical, as a higher proportion of CD8 than CD4 T cells was activated and expressed earlier IFN-{gamma} production upon infection. Here, we showed that the Fas death pathway controls CD8 T cell expansion in vitro and in vivo in the course of T. cruzi infection. We also found that following anti-FasL administration, T cells, mainly CD8 T cells, infiltrated the peritoneum, where activated macrophages controlled parasite replication. This local immune response reflected in a better control of systemic infection and parasitemia.

In contrast to other models [12 , 13 ], anti-FasL, but not anti-TRAIL or anti-TNF-{alpha}, completely blocked cell death of purified CD8 T cells from infected mice upon stimulation with anti-CD3. Moreover, CD8 T cells rescued by anti-FasL proliferated and outgrew CD4 T cells in mixed T cell cultures and in infected mice. Significant inhibition of apoptosis was observed in vivo in splenic CD8 T cells but not in CD4 T cells or B cells (not shown). Nonetheless, similar to CD8 T cells, CD4 T cells and B cells accumulated in lymphoid tissues of mice treated with anti-FasL.

Increased numbers of activated CD4 and CD8 T cells were detected at 19 dpi in the spleen with increased IFN-{gamma} response to T. cruzi antigens. Type 2 responses to the parasite were minimal or undetectable at this stage. One week later, mixed type 1/type 2 cytokine responses to T. cruzi antigens were observed in the spleens of mice treated with anti-FasL. These results agree with a previous study showing that in the course of T. cruzi infection, type 2 responses have a delayed kinetics compared with type 1 responses [32 ]. Moreover, at this later stage of infection, increased amounts of IL-4 and IL-10 were detected in CD4 T cell cultures from infected mice upon activation in the presence of anti-FasL. These data are similar to our previous observations of increased Th2 responses in T. cruzi-infected gld mutant mice [16 ]. In contrast, the production of IFN-{gamma} by activated CD4 T cells from gld mice [16 ] or by activated T cells treated with anti-FasL was not increased, possibly as a result of early IFN-{gamma} release from preformed stores upon T cell activation. However, our previous studies indicate that IFN-{gamma}-producing CD4 T cells are also susceptible to Fas-mediated death induced by an agonist anti-Fas mAb [8 ].

Previous and recent reports show that CD4 T cell subsets undergo apoptosis through different mechanisms [11 , 23 , 33 34 35 ]. Increased expression of FasL [22 , 35 , 36 ] and activation of caspase-8 upon Fas ligation [37 ] were observed in Th1 cells. Effector Th2 cells express higher levels of caspase-8 activity upon activation [38 ] but also show increased expression of apoptosis blockers, such as FLIP [35 ], SPI-2A [11 ], BCL-2 [38 ], and PI-3K [37 ], which reduces Fas mobility on the membrane [39 ]. Conversely, Th2 cells are more susceptible to granzyme B-induced death as a result of reduced protection by the SPI-6 protease inhibitor and increased release of granzyme B into the cytosol [11 ]. Nonetheless, our and previous results [16 , 20 , 25 ] suggest that Fas also controls type 2 responses, possibly by killing IL-10/IL-4-producing CD4 T cells.

Fas-triggered apoptosis could be necessary to prevent exacerbated types 1 and 2 responses. Our results with mice treated with anti-FasL suggest that the blockade of CD8 T cell apoptosis increased resistance to T. cruzi infection. However, an exacerbated Th2 response prevented the resolution of parasitemia in gld mice [16 ]. This difference between these systems (anti-FasL vs. gld/lpr mice) may be caused by an intrinsic Th2 bias as a result of chronic FasL/Fas deficiency in gld/lpr mice [26 ]. When early Th2 responses were antagonized by anti-IL-4 mAb, gld mice resolved the infection promptly but died [16 ], possibly because of defective control of overwhelming type 1 responses [40 ]. Therefore, Fas and Type 2 cytokines seem to be necessary to regulate type 1 responses. Indeed, Fas-induced apoptosis is important to prevent T. cruzi-induced pathology and early animal death in certain mouse strains [41 ]. Conversely, although Fas and FasL may not play a role in the killing of T. cruzi-infected cells [41 ], the effective control of parasite replication depends on the regulation of type 2 responses by Fas-mediated apoptosis [16 , 20 ].

FasL initiates cell death by oligomerization of the Fas receptor, followed by recruitment of the Fas-associated death domain (FADD) adaptor protein and caspase-8-mediated activation of death effector caspases [9 , 42 , 43 ]. Blockade of FADD-caspase-8 interactions by cellular or viral FLIPs (v-FLIPs) interrupts Fas-induced apoptosis [44 45 46 ]. We detected caspase-8 activity in T cells during T. cruzi infection [29 ]. However, the inhibition of caspase-8 by v-FLIP revealed that caspase-8 activity is required for protective immune responses to T. cruzi [29 ]. T cell-mediated immunity was impaired in transgenic v-FLIP mice, with deficient accumulation of memory/activated T cells but exacerbated Th2 cytokine responses [29 ]. In contrast to mice deficient in caspase-8 activity [29 ], activated CD8 T cells accumulated during T. cruzi infection in mice treated with anti-FasL. These results indicate that caspase-8 signaling, necessary for CD8 T cell survival and expansion, is independent of Fas-triggered signals and agree with previous results [47 ]. Conversely, similar to the FasL blockade, caspase-8 inhibition favored a type 2-biased, immune response [29 ]. Although the mechanism by which caspase-8 activity affects type 2 cytokine production is not well understood, it is likely that Fas and caspase-8 are involved by signaling cell death.

Altogether, these data reveal a role for Fas-mediated death in Th2 CD4 and CD8 T cell subsets, which has not been appreciated fully, and suggest that FasL/Fas interactions are critical in immunoregulation by controlling apoptosis and cytokine immune responses to T. cruzi infection.

ACKNOWLEDGEMENTS

This investigation received financial support from the UNICEF/UNDP/World Bank/WHO Special Program for Research and Training in Tropical Diseases (TDR; Grants A20310 and A60281), Brazilian National Research Council [Conselho Nacional de Pesquisas (CNPq)], Rio de Janeiro State Science Foundation [Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ)], Programa de Núcleos de Excelência of the Brazilian Ministry of Science and Technology (PRONEX), and Howard Hughes Medical Institute (Grant #55003669). L. V. C. G. received a Ph.D. fellowship from CNPq. M. F. L. and G. A. D-R. are research fellows of CNPq, Brazil. We thank Dr. Marise P. Nunes (FIOCRUZ, Rio de Janeiro, Brazil) for assistance and supply of animals and Jorgete L. de Oliveira (Instituto de Biofisica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Brazil) for technical assistance.

Received October 19, 2006; revised December 7, 2006; accepted December 22, 2006.

REFERENCES

  1. Tarleton, R. L., Koller, B. H., Latour, A., Postan, M. (1992) Susceptibility of ß 2-microglobulin-deficient mice to Trypanosoma cruzi infection Nature 356,338-340[CrossRef][Medline]
  2. Rottenberg, M. E., Bakhiet, M., Olsson, T., Kristensson, K., Mak, T., Wigzell, H., Orn, A. (1993) Differential susceptibilities of mice genomically deleted of CD4 and CD8 to infections with Trypanosoma cruzi or Trypanosoma brucei Infect. Immun. 61,5129-5133[Abstract/Free Full Text]
  3. Tarleton, R. L., Grusby, M. J., Postan, M., Glimcher, L. H. (1996) Trypanosoma cruzi infection in MHC-deficient mice: further evidence for the role of both class I- and class II-restricted T cells in immune resistance and disease Int. Immunol. 8,13-22[Abstract/Free Full Text]
  4. Kumar, S., Tarleton, R. L. (1998) The relative contribution of antibody production and CD8+ T cell function to immune control of Trypanosoma cruzi Parasite Immunol. 20,207-216[Medline]
  5. Tarleton, R. L., Grusby, M. J., Zhang, L. (2000) Increased susceptibility of Stat4-deficient and enhanced resistance in Stat6-deficient mice to infection with Trypanosoma cruzi J. Immunol. 165,1520-1525[Abstract/Free Full Text]
  6. Lopes, M. F., da Veiga, V. F., Santos, A. R., Fonseca, M. E., DosReis, G. A. (1995) Activation-induced CD4+ T cell death by apoptosis in experimental Chagas’ disease J. Immunol. 154,744-752[Abstract]
  7. Freire-de-Lima, C. G., Nascimento, D. O., Soares, M. B. P., Bozza, P. T., Castro-Faria-Neto, H. C., de Mello, F. G., DosReis, G. A., Lopes, M. F. (2000) Uptake of apoptotic cells drives the growth of a pathogenic trypanosome in macrophages Nature 403,199-203[CrossRef][Medline]
  8. Nunes, M. P., Andrade, R. M., Lopes, M. F., DosReis, G. A. (1998) Activation-induced T cell death exacerbates Trypanosoma cruzi replication in macrophages cocultured with CD4+ T lymphocytes from infected hosts J. Immunol. 160,1313-1319[Abstract/Free Full Text]
  9. Siegel, R. M., Chan, F. K., Chun, H. J., Lenardo, M. J. (2000) The multifaceted role of Fas signaling in immune cell homeostasis and autoimmunity Nat. Immunol. 1,469-474[CrossRef][Medline]
  10. Hildeman, D. A., Zhu, Y., Mitchell, T. C., Bouillet, P., Strasser, A., Kappler, J., Marrack, P. (2002) Activated T cell death in vivo mediated by proapoptotic bcl-2 family member bim Immunity 16,759-767[CrossRef][Medline]
  11. Devadas, S., Das, J., Liu, C., Zhang, L., Roberts, A. I., Pan, Z., Moore, P. A., Das, G., Shi, Y. (2006) Granzyme B is critical for T cell receptor-induced cell death of type 2 helper T cells Immunity 25,237-247[CrossRef][Medline]
  12. Zheng, L., Fisher, G., Miller, R. E., Peschon, J., Lynch, D. H., Lenardo, M. J. (1995) Induction of apoptosis in mature T cells by tumor necrosis factor Nature 377,348-351[CrossRef][Medline]
  13. Janssen, E. M., Droin, N. M., Lemmens, E. E., Pinkoski, M. J., Bensinger, S. J., Ehst, B. D., Griffith, T. S., Green, D. R., Schoenberger, S. P. (2005) CD4+ T-cell help controls CD8+ T-cell memory via TRAIL-mediated activation-induced cell death Nature 434,88-93[CrossRef][Medline]
  14. Zhou, S., Ou, R., Huang, L., Moskophidis, D. (2002) Critical role for perforin-, Fas/FasL-, and TNFR1-mediated cytotoxic pathways in down-regulation of antigen-specific T cells during persistent viral infection J. Virol. 76,829-840[Abstract/Free Full Text]
  15. Pellegrini, M., Belz, G., Bouillet, P., Strasser, A. (2003) Shutdown of an acute T cell immune response to viral infection is mediated by the proapoptotic Bcl-2 homology 3-only protein Bim Proc. Natl. Acad. Sci. USA 100,14175-14180[Abstract/Free Full Text]
  16. Lopes, M. F., Nunes, M. P., Henriques-Pons, A., Giese, N., Morse, H. C., III, Davidson, W. F., Araujo-Jorge, T. C., DosReis, G. A. (1999) Increased susceptibility of Fas ligand-deficient gld mice to Trypanosoma cruzi infection due to a Th2-biased host immune response Eur. J. Immunol. 29,81-89[CrossRef][Medline]
  17. Zuniga, E., Motran, C., Montes, C. L., Diaz, F. L., Bocco, J. L., Gruppi, A. (2000) Trypanosoma cruzi-induced immunosuppression: B cells undergo spontaneous apoptosis and lipopolysaccharide (LPS) arrests their proliferation during acute infection Clin. Exp. Immunol. 119,507-515[CrossRef][Medline]
  18. Zuniga, E., Motran, C. C., Montes, C. L., Yagita, H., Gruppi, A. (2002) Trypanosoma cruzi infection selectively renders parasite-specific IgG+ B lymphocytes susceptible to Fas/Fas ligand-mediated fratricide J. Immunol. 168,3965-3973[Abstract/Free Full Text]
  19. De Meis, J., Mendes-da-Cruz, D. A., Farias-de-Oliveira, D. A., Correa-de-Santana, E., Pinto-Mariz, F., Cotta-de-Almeida, V., Bonomo, A., Savino, W. (2006) Atrophy of mesenteric lymph nodes in experimental Chagas’ disease: differential role of Fas/Fas-L and TNFRI/TNF pathways Microbes Infect. 8,221-231[CrossRef][Medline]
  20. Martins, G. A., Petkova, S. B., MacHado, F. S., Kitsis, R. N., Weiss, L. M., Wittner, M., Tanowitz, H. B., Silva, J. S. (2001) Fas-FasL interaction modulates nitric oxide production in Trypanosoma cruzi-infected mice Immunology 103,122-129[CrossRef][Medline]
  21. Zheng, L., Lenardo, M. (2006) T helper 2 cells’ preferred way to die Immunity 25,187-188[CrossRef][Medline]
  22. Ramsdell, F., Seaman, M. S., Miller, R. E., Picha, K. S., Kennedy, M. K., Lynch, D. H. (1994) Differential ability of Th1 and Th2 T cells to express Fas ligand and to undergo activation-induced cell death Int. Immunol. 6,1545-1553[Abstract/Free Full Text]
  23. Varadhachary, A. S., Perdow, S. N., Hu, C., Ramanarayanan, M., Salgame, P. (1997) Differential ability of T cell subsets to undergo activation-induced cell death Proc. Natl. Acad. Sci. USA 94,5778-5783[Abstract/Free Full Text]
  24. Boyer, M. H., Hoff, R., Kipnis, T. L., Murphy, E. D., Roths, J. B. (1983) Trypanosoma cruzi: susceptibility in mice carrying mutant gene lpr (lymphoproliferation) Parasite Immunol. 5,135-142[Medline]
  25. Watanabe, N., Arase, H., Kurasawa, K., Iwamoto, I., Kayagaki, N., Yagita, H., Okumura, K., Miyatake, S., Saito, T. (1997) Th1 and Th2 subsets equally undergo Fas-dependent and -independent activation-induced cell death Eur. J. Immunol. 27,1858-1864[Medline]
  26. Prud’homme, G. J., Kono, D. H., Theofilopoulos, A. N. (1995) Quantitative polymerase chain reaction analysis reveals marked overexpression of interleukin-1 ß, interleukin-1 and interferon-{gamma} mRNA in the lymph nodes of lupus-prone mice Mol. Immunol. 32,495-503[CrossRef][Medline]
  27. Fuss, I. J., Strober, W., Dale, J. K., Fritz, S., Pearlstein, G. R., Puck, J. M., Lenardo, M. J., Straus, S. E. (1997) Characteristic T helper 2 T cell cytokine abnormalities in autoimmune lymphoproliferative syndrome, a syndrome marked by defective apoptosis and humoral autoimmunity J. Immunol. 158,1912-1918[Abstract]
  28. Lopes, M. F., Cunha, J. M., Bezerra, F. L., Gonzalez, M. S., Gomes, J. E., Lapa e Silva, J. R., Garcia, E. S., DosReis, G. A. (1995) Trypanosoma cruzi: both chemically induced and triatomine-derived metacyclic trypomastigotes cause the same immunological disturbances in the infected mammalian host Exp. Parasitol. 80,194-204[CrossRef][Medline]
  29. Silva, E. M., Guillermo, L. V. C., Ribeiro-Gomes, F. L., De Meis, J., Pereira, R. M. S., Wu, Z., Calegari-Silva, T. C., Seabra, S. H., Lopes, U. G., Siegel, R. M., DosReis, G. A., Lopes, M. F. (2005) Caspase-8 activity prevents type 2 cytokine responses and is required for protective T cell-mediated immunity against Trypanosoma cruzi infection J. Immunol. 174,6314-6321[Abstract/Free Full Text]
  30. Gazzinelli, R. T., Giese, N. A., Morse, H. C., III (1994) In vivo treatment with interleukin 12 protects mice from immune abnormalities observed during murine acquired immunodeficiency syndrome (MAIDS) J. Exp. Med. 180,2199-2208[Abstract/Free Full Text]
  31. Green, L. C., Wagner, D. A., Glogowski, J., Skipper, P. L., Wishnok, J. S., Tannenbaum, S. R. (1982) Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids Anal. Biochem. 126,131-138[CrossRef][Medline]
  32. Zhang, L., Tarleton, R. L. (1996) Characterization of cytokine production in murine Trypanosoma cruzi infection by in situ immunocytochemistry: lack of association between susceptibility and type 2 cytokine production Eur. J. Immunol. 26,102-109[Medline]
  33. Zhang, X., Brunner, T., Carter, L., Dutton, R. W., Rogers, P., Bradley, L., Sato, T., Reed, J. C., Green, D., Swain, S. L. (1997) Unequal death in T helper cell (Th)1 and Th2 effectors: Th1, but not Th2, effectors undergo rapid Fas/FasL-mediated apoptosis J. Exp. Med. 185,1837-1849[Abstract/Free Full Text]
  34. Li, L., Lee, H. H., Bell, J. J., Gregg, R. K., Ellis, J. S., Gessner, A., Zaghouani, H. (2004) IL-4 utilizes an alternative receptor to drive apoptosis of Th1 cells and skews neonatal immunity toward Th2 Immunity 20,429-440[CrossRef][Medline]
  35. Zhang, X. R., Zhang, L. Y., Devadas, S., Li, L., Keegan, A. D., Shi, Y. F. (2003) Reciprocal expression of TRAIL and CD95L in Th1 and Th2 cells: role of apoptosis in T helper subset differentiation Cell Death Differ. 10,203-210[CrossRef][Medline]
  36. Oberg, H. H., Lengl-Janssen, B., Kabelitz, D., Janssen, O. (1997) Activation-induced T cell death: resistance or susceptibility correlate with cell surface Fas ligand expression and T helper phenotype Cell. Immunol. 181,93-100[CrossRef][Medline]
  37. Varadhachary, A. S., Peter, M. E., Perdow, S. N., Krammer, P. H., Salgame, P. (1999) Selective up-regulation of phosphatidylinositol 3'-kinase activity in Th2 cells inhibits caspase-8 cleavage at the death-inducing complex: a mechanism for Th2 resistance from Fas-mediated apoptosis J. Immunol. 163,4772-4779[Abstract/Free Full Text]
  38. Misra, R. S., Jelley-Gibbs, D. M., Russell, J. Q., Huston, G., Swain, S. L., Budd, R. C. (2005) Effector CD4+ T cells generate intermediate caspase activity and cleavage of caspase-8 substrates J. Immunol. 174,3999-4009[Abstract/Free Full Text]
  39. Varadhachary, A. S., Edidin, M., Hanlon, A. M., Peter, M. E., Krammer, P. H., Salgame, P. (2001) Phosphatidylinositol 3'-kinase blocks CD95 aggregation and caspase-8 cleavage at the death-inducing signaling complex by modulating lateral diffusion of CD95 J. Immunol. 166,6564-6569[Abstract/Free Full Text]
  40. Hunter, C. A., Ellis-Neyes, L. A., Slifer, T., Kanaly, S., Grunig, G., Fort, M., Rennick, D., Araujo, F. G. (1997) IL-10 is required to prevent immune hyperactivity during infection with Trypanosoma cruzi J. Immunol. 158,3311-3316[Abstract]
  41. Muller, U., Sobek, V., Balkow, S., Holscher, C., Mullbacher, A., Museteanu, C., Mossmann, H., Simon, M. M. (2003) Concerted action of perforin and granzymes is critical for the elimination of Trypanosoma cruzi from mouse tissues, but prevention of early host death is in addition dependent on the FasL/Fas pathway Eur. J. Immunol. 33,70-78[CrossRef][Medline]
  42. Muzio, M., Chinnaiyan, A. M., Kischkel, F. C., O’Rourke, K., Shevchenko, A., Ni, J., Scaffidi, C., Bretz, J. D., Zhang, M., Gentz, R., Mann, M., Krammer, P. H., Peter, M. E., Dixit, V. M. (1996) FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) death-inducing signaling complex Cell 85,817-827[CrossRef][Medline]
  43. Krammer, P. H. (2000) CD95’s deadly mission in the immune system Nature 407,789-795[CrossRef][Medline]
  44. Irmler, M., Thome, M., Hahne, M., Schneider, P., Hofmann, K., Steiner, V., Bodmer, J. L., Schroter, M., Burns, K., Mattmann, C., Rimoldi, D., French, L. E., Tschopp, J. (1997) Inhibition of death receptor signals by cellular FLIP Nature 388,190-195[CrossRef][Medline]
  45. Bertin, J., Armstrong, R. C., Ottilie, S., Martin, D. A., Wang, Y., Banks, S., Wang, G. H., Senkevich, T. G., Alnemri, E. S., Moss, B., Lenardo, M. J., Tomaselli, K. J., Cohen, J. I. (1997) Death effector domain-containing herpesvirus and poxvirus proteins inhibit both Fas- and TNFR1-induced apoptosis Proc. Natl. Acad. Sci. USA 94,1172-1176[Abstract/Free Full Text]
  46. Thome, M., Schneider, P., Hofmann, K., Fickenscher, H., Meinl, E., Neipel, F., Mattmann, C., Burns, K., Bodmer, J. L., Schroter, M., Scaffidi, C., Krammer, P. H., Peter, M. E., Tschopp, J. (1997) Viral FLICE-inhibitory proteins (FLIPs) prevent apoptosis induced by death receptors Nature 386,517-521[CrossRef][Medline]
  47. Wu, Z., Roberts, M., Porter, M., Walker, F., Wherry, E. J., Kelly, J., Gadina, M., Silva, E. M., DosReis, G. A., Lopes, M. F., O’Shea, J., Leonard, W. J., Ahmed, R., Siegel, R. M. (2004) Viral FLIP impairs survival of activated T cells and generation of CD8+ T cell memory J. Immunol. 172,6313-6323[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.1006643v1
81/4/942    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guillermo, L. V. C.
Right arrow Articles by Lopes, M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guillermo, L. V. C.
Right arrow Articles by Lopes, M. F.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS