Journal of Leukocyte Biology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.0906543 on January 16, 2007

Published online before print January 16, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0906543v1
81/4/1086    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boekhoudt, G. H.
Right arrow Articles by Feldman, G. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boekhoudt, G. H.
Right arrow Articles by Feldman, G. M.
(Journal of Leukocyte Biology. 2007;81:1086-1092.)
© 2007 by Society for Leukocyte Biology

Immune complexes suppress IFN-{gamma} signaling by activation of the Fc{gamma}RI pathway

Gunther H. Boekhoudt, Michelle R. Frazier-Jessen and Gerald M. Feldman1

U.S. Food and Drug Administration, Division of Monoclonal Antibodies, Office of Biotechnology Products, Office of Pharmaceutical Science, Center for Drug Evaluation and Research, Bethesda, Maryland, USA

1 Correspondence: Food and Drug Administration, Division of Monoclonal Antibodies, Office of Biotechnology Products, OPS, CDER, FDA, 29 Lincoln Drive, Bethesda, MD 20892, USA. E-mail: gerald.feldman{at}fda.hhs.gov


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Antigen-driven immune responses are modulated by immune complexes (ICs), in part through their ability to inhibit IFN-{gamma}-dependent MHC Class II expression. We have demonstrated previously that ICs dramatically inhibit IFN-{gamma}-induced activation of human monocytes through the suppression of the JAK/STAT signaling pathway. In the current study, we further explore the mechanisms by which ICs regulate IFN-{gamma} activation of human monocytes. Consistent with previous studies in monocytes pretreated with ICs, there was a reduction in steady-state levels of RNA by real-time RT-PCR of the IFN-inducible protein 10 gene as well as the Fc{gamma}RI gene. Pull-down assays confirm that IC pretreatment inhibits IFN-{gamma}-induced STAT1 phosphorylation without affecting the ability of STAT1 to bind to the STAT1-binding domain of the IFN-{gamma} receptor. In addition, the inhibitory function of ICs was reduced when cells from the FcR common {gamma}-chain knockout mice were used, supporting the role of the Fc{gamma}RI in this inhibitory pathway. It is unexpected that ICs also require the phosphatase Src homology-2-containing tyrosine phosphatase 1 (SHP-1) to inhibit IFN-{gamma} induction, as demonstrated by studies with cells from the SHP-1 knockout (motheaten) mice. These data suggest a mechanism of IC-mediated inhibition of IFN-{gamma} signaling, which requires the ITAM-containing Fc{gamma}RI, as well as the ITIM-dependent phosphatase SHP-1, ultimately resulting in the suppression of STAT1 phosphorylation.

Key Words: monocytes • Jak/STAT • cytokine signaling • Fc receptors


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
IFN-{gamma} is one of the most studied of the immunomodulatory cytokines with pleiotropic biological functions, which include the activation of mononuclear phagocytes [1 ], regulation of MHC-I and MHC-II expression [2 , 3 ], differentiation of T cells and B lymphocytes [4 ], stimulation of cytolytic activity of NK cells [5 ], and regulation of autoimmune disease [6 7 8 ]. IFN-{gamma} exerts its function through the JAK/STAT signaling pathway, which relies heavily on tyrosine phosphorylation [9 10 11 ]. Disrupting the IFN-{gamma} signaling cascade can have drastic consequences, as seen in mouse models deficient in IFN-{gamma} or its receptor (IFN-{gamma}R) [12 , 13 ], as well as in patients with mutations in the IFN-{gamma}Rs [14 ], resulting in an increased susceptibility to microbial infections.

Healthy individuals, when exposed to antigens, form immune complexes (ICs) as a normal, physiological event. Clearance of ICs occurs by the mononuclear phagocytic system, making it possible to develop an effective immune response by antigen digestion and subsequent presentation. Abnormal processing of ICs can sometimes occur, and the pathological effects are readily visible in autoimmune diseases such as systemic lupus erythematosus, vasculitis, and rheumatoid arthritis [15 ]. ICs exert their function through the interaction of their Fc portions with the Fc{gamma}Rs, which can be divided into two classes, namely the high-affinity Fc{gamma}RI and the low-affinity Fc{gamma}RII and Fc{gamma}RIII. Human monocytes express and can transduce signals through all three receptors [16 ]. Based on their cellular effector functions, the Fc{gamma}Rs are divided further into two subclasses, namely those that activate and those that suppress. Fc{gamma}RI, Fc{gamma}RIIa, and Fc{gamma}RIIIa are known as activating receptors by virtue of the presence of an ITAM in the cytoplasmic domain of the receptor or associated with the receptor as an accessory signaling subunit (common {gamma}- and/or {zeta}-chain). Fc{gamma}RIIb is the only known suppressive Fc{gamma}R that contains an ITIM in its cytoplasmic domain [17 ].

Studies by Schreiber and co-workers [18 ] and Unanue and co-workers [19 ] showed ICs as a suppressor of IFN-{gamma}-induced tumoricidal activity and MHC Class II expression. We have demonstrated previously the role of ICs in inhibiting the JAK/STAT pathway in this process [20 ]. We now expand on these previous studies by demonstrating that ICs use the Fc{gamma}RI and the common {gamma}-chain specifically for their inhibitory function. We demonstrate further the involvement of the phosphatase Src homology-2-containing tyrosine phosphatase 1 (SHP-1) in the inhibitory effects of ICs, although not that of the ITIM-containing Fc{gamma}RIIb. These data suggest a previously unknown function of the Fc{gamma}RI, one in which it activates and/or recruits directly or indirectly SHP-1 upon activation by ICs. These findings help elucidate the mechanism by which ICs can regulate IFN-{gamma} signaling and add a level of complexity to the signaling cross-talk of FcRs to that of IFN-{gamma}Rs.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cells
Human monocytes were prepared as described previously [20 ]. Briefly, peripheral blood was collected from normal human volunteers by leukapheresis. Monocytes were purified from mononuclear cells by ficoll-hypaque sedimentation followed by countercurrent centrifugal elutriation. The purified monocytes (>95% by histological examination) were allowed to adhere for 1 h in serum-free DMEM (Invitrogen, Carlsbad, CA, USA) onto untreated plates or plates coated with human {gamma}-globulin (Miles Laboratories, Kankakee, IL, USA) at 50 µg/ml. Adhered monocytes were subsequently treated with recombinant human IFN-{gamma} (kindly provided by Genentech, Inc., S. San Francisco, CA, USA) at a concentration of 10 ng/ml or as stated otherwise. Purified F(ab')2 against Fc{gamma}RI (Clone 32.2, Medarex, Annendale, NJ, USA) and/or Fc{gamma}RII (Clone FL18.26, RDI, Concord, MA, USA) were used to coat cells for 30 min at 1 µg/ml. Cells were washed and then applied to IC-coated dishes. When needed, purified F(ab')2 against a murine IgG light chain was used to cross-link for 1 h at 37°C prior to washing and subsequent IFN-{gamma} stimulation. Murine peritoneal macrophages were obtained from viable SHP–/– (The Jackson Laboratories, Bar Harbor, ME, USA) or FcR{gamma}–/– (kindly provided by Dr. David Mosser at University of Maryland, College Park, MD, USA) mice by peritoneal lavage using 4–8 ml PBS without calcium or magnesium, supplemented with 1% BSA and 50 µg/ml gentamicin sulfate. Macrophage preparations of >90% purity (by histological examination) were used subsequently in these experiments.

RNA isolation and analysis
Total RNA was isolated from cells using QIAshredder and RNeasy mini kits (Qiagen, Valencia, CA, USA) following the manufacturer’s protocols. RT was conducted using the SuperScriptTM II RT (Invitrogen) per the manufacturer’s instructions. RNA (2 µg per sample) was used, and a control parallel reaction was included where no RT was added. Samples were diluted tenfold, and 5 µL RT reaction material was analyzed by real-time PCR using SYBR Green and the ABI PRISM 7900HT sequence detection system (Applied Biosystems, Foster City, CA, USA). Two sets of PCR assays were performed for each sample using the following primers specific for cDNA: for hFc{gamma}RI{alpha}, 5'-ATGGCACCTACCATTGCTCAGG and 5'-CCAAGCACTTGAAGCTCCAACTC [21 ]; for IFN-inducible protein 10 (IP-10), 5'-GGAACCTCCAGTCTCAGCACC and 5'-CAGCCTCTGTGTGGTCCATCC [22 ]; and ß-actin, 5'- TCGTCGACAACGGCTCCGGCATGTGC and 3'-TTCTGCAGGGAGGAGCTGGAAGCAGC [22 ]. PCR conditions (45 cycles) included 15 s at 95°C, 30 s at 60°C, and 30 s at 72°C. The threshold cycle number for hFc{gamma}RI{alpha} and hIP-10 was normalized to that of ß-actin transcript and then set to a percentage of the maximum transcription detected in samples treated with 10 ng/ml IFN-{gamma}. All RT-PCR assays were performed three or more times from RNA samples prepared independently.

Western blotting and pull-downs
Subsequent to IFN-{gamma} treatment, cells were solubilized in a buffer consisting of 0.875% Brij 97 (Sigma Aldrich, St. Louis, MO, USA) and 0.125% Nonidet P-40 (Pierce, Rockford, IL, USA), 0.15 M NaCl, 50 mM Tris, pH 8.0, 50 mM NaF, 5 mM Na pyrophosphate, 1 mM PMSF, 1 mM orthovanadate, and 50% glycerol. Lysates were precleared for 1 h at 4°C with a suspension of strepavidin agarose beads (Pierce). Precleared lysates were incubated overnight at 4°C with a biotin-conjugated peptide containing the STAT1-binding sequence of the IFN-{gamma}R (biotin-KKKAPTSFGYDKPHVLVDL), which incorporated a phosphorylated tyrosine. Strepavidin beads were then added for 2 h at 4°C to bind the complexes. The pelleted complexes were washed multiple times in cold lysis buffer and boiled in Laemmli buffer prior to electrophoresis.

Electrophoresis was performed on 8% SDS-PAGE (Invitrogen) gels followed by electrophoretic transfer to polyvinylidene difluoride membranes (Immobilon-P, Millipore, Bedford, MA, USA), which were blocked using 5% nonfat milk in PBS containing 0.1% Tween 80 (Sigma Aldrich) for 1 h and incubated with mouse antiphosphorylated STAT1 (Zymed, South San Francisco, CA, USA) or rabbit anti-STAT1 (Cell Signaling Technology, Danvers, MA, USA). Following washing, the membranes were incubated with HRP-conjugated secondary antibodies (Amersham, Piscataway, NJ, USA) and developed using enhanced chemiluminescence (Amersham). The data presented are representative of at least three separate experiments.

EMSA
Nuclear extracts were prepared as described previously [20 ]. Briefly monolayers were washed once with cold PBS, and cells were scraped into ice-cold whole cell extraction buffer [1 mM MgCl2, 20 mM Hepes (pH 7.0), 10 mM KCl, 300 mM NaCl, 0.5 mM DTT, 0.1% Triton X-100, 200 mM PMSF, 1 mM vanadate, and 20% glycerol]. The extract was vortexed gently for 10 s, incubated at 4°C for 10 min, and centrifuged at 18,000 g, and the supernatant was transferred to a new tube. Equal amounts of protein were assayed by EMSA using a 32P-labeled oligonucleotide probe containing the {gamma}-response region (GRR) of the Fc{gamma}RI gene. The samples were separated on a 6% nondissociating polyacrylamide gel and analyzed by radiography. Densitometry on digitized scans was performed and analyzed using National Institutes of Health’s Image v1.63 imaging software for Macintosh computers. IFN-{gamma}-treated samples were assigned a value of 100%, and all treatment groups were compared with that baseline value. The data from at least three separate experiments were analyzed and presented as their mean ± SE.

Flow cytometry
Monocytes (1x106), treated as described, were harvested and washed twice with FACS buffer (0.5% BSA, 0.1 sodium azide in PBS). To avoid nonspecific binding, 1 µg human {gamma}-globulin (Miles Laboratories, Kankakee, IL, USA) was added per sample. Cells were then surface-stained with anti-CD64 (Fc{gamma}R1) Clone 10.1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or an isotype-matched control antibody (R&D Systems, Minneapolis, MN, USA) for 60 min at 4°C. Cells were washed twice with FACS buffer and stained with 1 µg Alexa Fluor 488-conjugated donkey antimouse IgG (Invitrogen) for 60 min at 4°C. After washing, cells were fixed with 1% paraformaldehayde (Electron Microscopy Sciences, Hatfield, PA, USA). Cellular fluorescence was monitored in a FACSCalibur® cell sorter (Becton Dickinson, Mansfield, MA, USA) and analyzed using the CellQuest software provided by the manufacturer.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
ICs markedly inhibit IFN-{gamma}-induced STAT1 phosphorylation
Previous studies have demonstrated that ICs inhibited IFN-{gamma}-induced STAT1 phosphorylation. To support these findings, RT-PCR and pull-down assays were performed. Quantitative real-time RT-PCR analyses were performed on RNA of elutriated human monocytes pretreated with ICs and activated with IFN-{gamma}. The effect of ICs on two IFN-{gamma}-induced genes, IP-10 and Fc{gamma}RI{alpha}, was analyzed. The results demonstrate a dose-dependent induction of both of these genes on IFN-{gamma} activation (Fig. 1A , open bars). Pretreatment of human monocytes with ICs resulted in a significant (70–90%) reduction in their inducible level of gene expression (Fig. 1A , shaded bars; *, P<0.05). Both of these genes rely on the activation of STAT1 by IFN-{gamma} for their induction. To determine the early effects of IC pretreatment on monocyte Fc{gamma}RI expression, FACS analysis was performed immediately after their 15-min IFN-{gamma} treatment. No effects of treatment with IFN-{gamma}, IC, or a combination of the two were observed on Fc{gamma}RI cell surface expression when analyzed within the first 2 h of treatment (Fig. 1B) . To support the RT-PCR results, whole cell lysates of elutriated human monocytes pretreated with ICs and activated with IFN-{gamma} were assayed by a pull-down assay, in which a biotinylated peptide containing the phosphorylated binding site for STAT1 contained within the IFN-{gamma}R was synthesized and used. It is interesting that the biotinylated peptide was able to pull-down STAT1 specifically in all the treatment groups, but only in the IFN-{gamma}-treated cells were the STAT1-phosphorylated, not when pretreated with IC (Fig. 1C , Lanes 1–4). These results demonstrate that IC pretreatment can inhibit the IFN-{gamma}-induced STAT1 phosphorylation in primary human monocytes yet not interfere with the ability of STAT1 to bind to an already-phosphorylated receptor (Fig. 1C , Lane 2). Phosphorylation of STAT1 is known to be required for the induction and subsequent expression of numerous IFN-{gamma}-responsive genes. These data demonstrate that in human monocytes, ICs inhibit IFN-{gamma}-induced gene expression by repressing STAT1 phosphorylation.


Figure 1
View larger version (22K):
[in this window]
[in a new window]

  		Figure 1. ICs inhibit the IFN-{gamma} signaling cascade. (A) Primary monocytes were pretreated with IC for 1 h and subsequently stimulated for 90 min with IFN-{gamma} at the indicated concentration. Quantitative RT-PCR was performed with isolated RNA using primers specific for IP-10, Fc{gamma}RIa, and ß-actin. The relative quantitation values represent the fold stimulation of IP-10 and Fc{gamma}RIa mRNA determined from the change in crossover threshold between RT-PCR samples following normalization to the crossover threshold determined for ß-actin cDNA. The sample treated with 10 ng/ml IFN-{gamma} was set arbitrarily to 100%. The averages (±SEM) of three independent experiments performed in duplicate are shown (*, significance of <0.05). (B) Primary monocytes were pretreated with IC for 1 h and subsequently stimulated with 10 ng/mL IFN-{gamma} for 15 min. Cells were then stained with an anti-Fc{gamma}RI antibody or its isotype-matched control followed by an Alexa Fluor 488-conjugated, antimouse antibody for flow cytometry. (C) Primary monocytes were pretreated with IC for 1 h and subsequently stimulated for 15 min with 1.0 ng/mL IFN-{gamma}. Cell lysates were prepared and subjected to pull-down assays using biotinylated peptide consisting of the STAT1-binding domain (Biot-STAT1-BD) of the IFN-{gamma}R. Samples were analyzed by Western blotting using antiphospho-specific STAT1 or anti-STAT1 antibodies.

 
IC-mediated inhibition uses Fc{gamma}RI
To determine the mechanism by which ICs exert their inhibitory function, specific, nonactivating F(ab')2, capable of blocking FcR binding, was used. Human monocytes were incubated with anti-Fc{gamma}RI F(ab')2 fragments or anti-Fc{gamma}RII F(ab')2 fragments prior to treatment with ICs and subsequent IFN-{gamma} stimulation. EMSA analysis performed on untreated extracts showed that ICs inhibit the IFN-{gamma}-induced STAT1 binding to the GRR probe >60% (Fig. 2A , Lane 4 vs. Lane 2). The data demonstrate that the inhibitory function of ICs was abolished when anti-Fc{gamma}RI F(ab')2 fragments were used (Fig. 2A , Lane 8 vs. Lane 4). In contrast, the use of anti-Fc{gamma}RII F(ab')2 fragments to block the Fc{gamma}RII receptor had no such effect on the inhibitory function of ICs (Fig. 2B , Lane 4 vs. Lane 2). The inability of blocking antibody fragments to the Fc{gamma}RII to inhibit IC-mediated suppression of IFN-{gamma} activation, whereas blocking antibody fragments to the Fc{gamma}RI are capable of mitigating the effects of ICs, suggests that the inhibitory function of ICs is mediated by the ITAM-containing Fc{gamma}RI and not by the ITIM-containing Fc{gamma}RII.


Figure 2
View larger version (37K):
[in this window]
[in a new window]

  		Figure 2. Inhibitory function of IC is lost when Fc{gamma}RI but not Fc{gamma}RII is blocked. Nuclear extracts of primary monocytes treated for 30 min with specific blocking F(ab')2 fragments against Fc{gamma}RI (A) or Fc{gamma}RII (B) followed by 1 h treatment with IC and subsequently stimulated for 15 min with IFN-{gamma} were prepared and incubated with a 32P-labeled oligonucleotide containing consensus STAT1-binding sites. The DNA–protein interaction was then assayed by EMSA followed by autoradiography and densitometry. For densitometry, each bar corresponds to the respective EMSA lane, and values represent the mean ± SEM of at least four independent experiments. Treatment groups are compared with the IFN-{gamma}-treated samples.

 
Activation of the ITAM-containing Fc{gamma}RI mimics the inhibitory IC effects
To further validate the involvement of the Fc{gamma}RI and to negate Fc{gamma}RII involvement in inhibiting IFN-{gamma}-induced activation, cross-linking experiments were performed. Human monocytes were incubated with anti-Fc{gamma}RI F(ab')2 fragments as above and were cross-linked with an anti-F(ab')2 antibody to mimic IC-mediated effects. EMSA analyses were performed on extracts of cells that were treated or not with anti-F(ab')2 antibodies. Cross-linking of the Fc{gamma}RI-F(ab')2 complex mimics the inhibitory function of ICs in reducing the ability of STAT1 to bind to the GRR probe after IFN-{gamma} activation (Fig. 3 , Lanes 4 and 6 compared with Lane 2). In contrast, cross-linking of the Fc{gamma}RII-F(ab')2 complex had no suppressive effect on STAT1 activation (Fig. 3 , Lane 8 vs. Lane 2) and in fact, may slightly augment the signal induced by IFN-{gamma} treatment. In addition, induction of STAT1 activation upon simultaneous cross-linking of Fc{gamma}RI and Fc{gamma}RII was identical to that of cross-linking Fc{gamma}RI alone (Fig. 3 , Lane 10 vs. Lane 6). Extracts of cells that were not cross-linked show normal IFN-{gamma}-induced STAT1 binding to the GRR probe (Fig. 2A and 2B) . These results demonstrate that the inhibitory function of ICs on IFN-{gamma} signaling uses Fc{gamma}RI but not Fc{gamma}RII.


Figure 3
View larger version (31K):
[in this window]
[in a new window]

  		Figure 3. Cross-linking of Fc{gamma}RI but not of Fc{gamma}RII mimics the effects of IC. Primary monocytes were preincubated for 30 min with specific F(ab')2 fragments against Fc{gamma}RI and/or Fc{gamma}RII. Cells were then treated for 1 h with anti-F(ab')2 antibodies to cross-link prior to a 15-min stimulation with IFN-{gamma}. Nuclear extracts were incubated with a 32P-labeled oligonucleotide containing consensus STAT1-binding sites, and the DNA–protein interaction was then assayed by EMSA followed by autoradiography and densitometry. The order of several lanes was rearranged for conciseness.

 
IC-mediated inhibition requires the presence of the common {gamma}-chain of Fc{gamma}R
If the ITAM containing Fc{gamma}RI is required for the inhibitory effect of IC, then the FcR {gamma}-chain would be involved. To demonstrate that this is indeed the case, EMSAs were performed using nuclear extracts of peritoneal macrophages obtained from wild-type and FcR {gamma}-chain knockout mice. Extracts of cells from the wild-type mouse performed as well as human primary monocytes, in that IFN-{gamma} treatment induced STAT1 binding to the GRR probe (Fig. 4 , Lanes 1 and 2), whereas IC suppressed that interaction (Fig. 4 , Lane 4 vs. Lane 2) by >60%. In contrast, cell extracts from the {gamma}-chain knockout mouse lost only 30% of their ability to exert the inhibitory function of ICs (Fig. 4 , Lane 8 vs. Lane 6), demonstrating that the inhibitory function of ICs requires the common {gamma}-chain for some of these effects and supporting the notion that this inhibitory pathway uses the high-affinity Fc{gamma}RI.


Figure 4
View larger version (39K):
[in this window]
[in a new window]

  		Figure 4. Common FcR {gamma}-chain is essential for IC-mediated effects. Peritoneal macrophages isolated from FcR{gamma} knockout mice or their wild-type littermates were treated for 1 h with IC and subsequently stimulated for 15 min with IFN-{gamma}. Nuclear extracts were prepared, and EMSAs and densitometry were performed as described previously. WT, Wild-type; PEC, peritoneal exudative cells.

 
Inhibitory effect of ICs requires SHP-1 phosphatase
Fc{gamma}Rs use the downstream effector molecules to elicit a signal, and the inhibitory effects of Fc{gamma}R signaling involve the SHP family of phosphatases [17 ]. It is interesting that SHP-1 phosphatase has been demonstrated recently to dephosphorylate JAK2 [23 ]. To determine if SHP-1 is involved in the inhibition of IFN-{gamma} signaling by IC activation, viable, motheathen mice, which are deficient in SHP-1 (but express normal levels of Fc{gamma}R on their surface [24 ]) were used. EMSA analysis of nuclear extracts of cells from SHP-1 knockout mice, which were pretreated with ICs, showed no inhibition of STAT1 activation upon IFN-{gamma} stimulation (Fig. 5 , Lane 8 vs. Lane 6), and nuclear extract of cells from wild-type mice (Fig. 5 , Lane 4 vs. Lane 2) performed as well as primary human monocytes (Fig. 2A , Lanes 1–4). These data demonstrate a requisite involvement of SHP-1 in the IC-mediated inhibition of IFN-{gamma}-induced activation.


Figure 5
View larger version (32K):
[in this window]
[in a new window]

  		Figure 5. SHP-1 is involved in the inhibitory function of IC. Peritoneal macrophages were isolated from motheaten (SHP-1 knockout) mice or their littermate controls and treated for 1 h with IC prior to activation with IFN-{gamma}. Nuclear extracts were prepared, and EMSAs and densitometry were performed as described.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
ICs have long been known to modulate immune responsiveness through their ability to cluster FcRs, but the mechanisms by which they exert these actions are not well understood. We and others [18–20] have demonstrated that ICs suppress the ability of IFN-{gamma} to activate macrophages through the inhibition of the JAK/STAT signaling pathway. The present study extends previous work by demonstrating the specific role of Fc{gamma}RI and its {gamma}-chain, ITAM-mediated activation of the downstream signaling molecule SHP-1 in the inhibitory function of ICs.

FcR aggregation occurs upon binding of the Fc regions of ICs to their receptors’ extracellular Ig-like domain. On human monocytes, all three of the Fc{gamma}Rs are expressed, namely Fc{gamma}RI, Fc{gamma}RII, and Fc{gamma}RIII. By using F(ab')2 fragments known to preferentially bind to and block Fc binding to specific Fc{gamma}Rs, we demonstrate that the inhibitory effect of ICs was lost only when Fc{gamma}RI but not when Fc{gamma}RII was blocked. This was unexpected, as the inhibitory functions of ICs normally involve Fc{gamma}RII, which contains an inhibitory ITIM domain [25 ]. The Fc{gamma}RII ITIM domain alone does not elicit a signal upon activation; receptor activity is only apparent during costimulation with an ITAM-containing receptor [17 ]. In this regard, it has been reported that the Fc{epsilon}RI, which is known to contain only ITAM domains, can interact directly with and activate the phosphatase SHP-1 [26 ]. It was subsequently shown that the Fc{epsilon}RI intracellular domain contains not only an ITAM domain but also a previously unknown inhibitory domain, based on sequence homology and functional assays [26 ]. These observations raise the possibility that the requisite role of Fc{gamma}RI but not Fc{gamma}RII in the inhibitory function of ICs is a result of its direct activation of SHP-1 through an as-yet unidentified, inhibitory motif present on the Fc{gamma}R common {gamma}-chain. Results of experiments in which the F(ab')2 fragments were cross-linked to activate only one receptor type specifically support this hypothesis, as the inhibitory action was observed only upon Fc{gamma}RI activation and not upon cross-linking or activation of the ITIM-containing Fc{gamma}RII. The F(ab')2 fragment used to block or cross-link Fc{gamma}RII is known to bind to Fc{gamma}RIIa and Fc{gamma}RIIb, which could potentially alter the interpretation of these results, as the function of these receptors could not be separated. In the current situation, however, this lack of specificity was beneficial in that it ruled out the possible role of Fc{gamma}RIIa and Fc{gamma}RIIb in inhibiting IFN-{gamma}-mediated STAT1 activation. The role of Fc{gamma}RIII was not addressed directly, as the reagents are not available, but the ability of the blocking F(ab')2 fragment directed against Fc{gamma}RI to reverse the effects of ICs totally suggests that the involvement of Fc{gamma}RIII may be minimal. This was supported further by the ability of cross-linked Fc{gamma}RI to replicate the effects of ICs completely, suggesting that Fc{gamma}RIII is not involved in the inhibitory function of ICs. Our experiments using the Fc{gamma}R common {gamma}-chain knockout mouse support this notion, as they demonstrate the requirement of the ITAM-containing receptor for the expression of the inhibitory function of ICs. A corollary of these data is that they suggest the existence of a link between the Fc{gamma}RI and its common {gamma}-chain and SHP-1 activation. However, more work is needed to demonstrate a direct link between these molecules.

An important component of the IFN-{gamma} signaling cascade is the reversible phosphorylation of proteins that mediate protein–protein interactions and enzymatic activities. Here and elsewhere [20 ], we have demonstrated that ICs can inhibit the IFN-{gamma}-induced phosphorylation of STAT1 in monocytes and macrophages, thereby down-regulating their response. This is in direct contrast to recent studies, which demonstrate the regulatory effects of ICs on IFN-{gamma}-induced macrophage activation, albeit without concomitant down-regulation of STAT1 phosphorylation [27 ]. Although the reasons for the observed discrepancies are unclear, they may include the relative concentrations of IFN-{gamma} used in each system and/or methods used for IC pretreatment.

Human monocytes express mainly Fc{gamma}RI, Fc{gamma}RII (a and b), and Fc{gamma}RIIIa on their cell surface. In contrast, mice lack Fc{gamma}RIIa and only express Fc{gamma}RI, Fc{gamma}RIIb, and Fc{gamma}RIIIa [16 ]. Not only do these systems have different Fc{gamma}R repertoires, but they also express these Fc{gamma}R at different levels. Human monocytes have more Fc{gamma}RI compared with Fc{gamma}RIIb, whereas in mice, these receptors are expressed to almost equal levels [28 , 29 ]. Differences such as these make it difficult to do a true comparison between human and murine Fc{gamma}R model systems. Such complications are minimized in the current study, as our results rule out the involvement of Fc{gamma}RII and demonstrate the involvement of Fc{gamma}RI as necessary and sufficient for the inhibitory function of ICs. Differences in the remaining Fc{gamma}R repertoire or in their respective levels of expression should therefore be irrelevant. Further studies are under way to better define the species-specific role of Fc{gamma}RI, Fc{gamma}RII, and Fc{gamma}RIII in IC-mediated signaling.

Activation or phosphorylation of STAT1 is a critical step in the induction of responsive genes by IFN-{gamma}. Upon treatment with IFN-{gamma}, a signal transduction protein complex is formed rapidly, which includes the IFN-{gamma}R, the tyrosine kinases JAK1 and JAK2, and the signal transducer STAT1 [30 ]. The activation of these components and the formation of this complex are tightly controlled. One mechanism of regulating this complex involves the phosphatase SHP-1. This molecule has been demonstrated previously to be involved in the regulation of other cytokine pathways, including that of IFN-{alpha}/ß [31], IL-4 [32 ], c-kit [33 ], and erythropoietin [34 ]. Our results suggest that upon IC stimulation with Fc{gamma}RI and the Fc{gamma}R {gamma}-chain, SHP-1 integrates itself into the IFN-{gamma} signalosome, where it is responsible for the dephosphorylation of the JAK kinases and STAT signaling molecules necessary for IFN-{gamma}-induced gene expression. Studies are under way to explore these regulatory pathways further.


   ACKNOWLEDGEMENTS
 
G. H. B. was supported in part by an appointment to the Research Fellowship Program for the Center for Drug Evaluation and Research, administered by the Oak Ridge Associated Universities through a contract with the U.S. Food and Drug Administration.

Received September 1, 2006; revised December 12, 2006; accepted December 12, 2006.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Boehm, U., Klamp, T., Groot, M., Howard, J. C. (1997) Cellular responses to interferon-{gamma} Annu. Rev. Immunol. 15,749-795[CrossRef][Medline]
  2. Shirayoshi, Y., Burke, P. A., Appella, E., Ozato, K. (1988) Interferon-induced transcription of a major histocompatibility class I gene accompanies binding of inducible nuclear factors to the interferon consensus sequence Proc. Natl. Acad. Sci. USA 85,5884-5888[Abstract/Free Full Text]
  3. Mach, B., Steimle, V., Martinez-Soria, E., Reith, W. (1996) Regulation of MHC class II genes: lessons from a disease Annu. Rev. Immunol. 14,301-331[CrossRef][Medline]
  4. Young, H. A., Hardy, K. J. (1995) Role of interferon-{gamma} in immune cell regulation J. Leukoc. Biol. 58,373-381[Abstract]
  5. Biron, C. A., Nguyen, K. B., Pien, G. C., Cousens, L. P., Salazar-Mather, T. P. (1999) Natural killer cells in antiviral defense: function and regulation by innate cytokines Annu. Rev. Immunol. 17,189-220[CrossRef][Medline]
  6. Baechler, E. C., Batliwalla, F. M., Karypis, G., Gaffney, P. M., Ortmann, W. A., Espe, K. J., Shark, K. B., Grande, W. J., Hughes, K. M., Kapur, V., Gregersen, P. K., Behrens, T. W. (2003) Interferon-inducible gene expression signature in peripheral blood cells of patients with severe lupus Proc. Natl. Acad. Sci. USA 100,2610-2615[Abstract/Free Full Text]
  7. Panitch, H. S., Hirsch, R. L., Haley, A. S., Johnson, K. P. (1987) Exacerbations of multiple sclerosis in patients treated with {gamma} interferon Lancet 1,893-895[Medline]
  8. Sarvetnick, N., Liggitt, D., Pitts, S. L., Hansen, S. E., Stewart, T. A. (1988) Insulin-dependent diabetes mellitus induced in transgenic mice by ectopic expression of class II MHC and interferon-{gamma} Cell 52,773-782[CrossRef][Medline]
  9. Igarashi, K., David, M., Larner, A. C., Finbloom, D. S. (1993) In vitro activation of a transcription factor by {gamma} interferon requires a membrane-associated tyrosine kinase and is mimicked by vanadate Mol. Cell. Biol. 13,3984-3989[Abstract/Free Full Text]
  10. Darnell, J. E., Jr, Kerr, I. M., Stark, G. R. (1994) Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins Science 264,1415-1421[Abstract/Free Full Text]
  11. Ihle, J. N. (1996) STATs: signal transducers and activators of transcription Cell 84,331-334[CrossRef][Medline]
  12. Pearl, J. E., Saunders, B., Ehlers, S., Orme, I. M., Cooper, A. M. (2001) Inflammation and lymphocyte activation during mycobacterial infection in the interferon-{gamma}-deficient mouse Cell. Immunol. 211,43-50[CrossRef][Medline]
  13. van den Broek, M. F., Muller, U., Huang, S., Aguet, M., Zinkernagel, R. M. (1995) Antiviral defense in mice lacking both {alpha}/ß and {gamma} interferon receptors J. Virol. 69,4792-4796[Abstract]
  14. Jouanguy, E., Lamhamedi-Cherradi, S., Lammas, D., Dorman, S. E., Fondaneche, M. C., Dupuis, S., Doffinger, R., Altare, F., Girdlestone, J., Emile, J. F., et al (1999) A human IFNGR1 small deletion hotspot associated with dominant susceptibility to mycobacterial infection Nat. Genet. 21,370-378[CrossRef][Medline]
  15. Mannik, M. (1982) Pathophysiology of circulating immune complexes Arthritis Rheum. 25,783-787[Medline]
  16. Ravetch, J. V., Kinet, J. P. (1991) Fc receptors Annu. Rev. Immunol. 9,457-492[Medline]
  17. McKenzie, S. E., Schreiber, A. D. (1998) Fc {gamma} receptors in phagocytes Curr. Opin. Hematol. 5,16-21[Medline]
  18. Esparza, I., Green, R., Schreiber, R. D. (1983) Inhibition of macrophage tumoricidal activity by immune complexes and altered erythrocytes J. Immunol. 131,2117-2121[Abstract]
  19. Virgin, H. W., 4th, Wittenberg, G. F., Unanue, E. R. (1985) Immune complex effects on murine macrophages. I. Immune complexes suppress interferon-{gamma} induction of Ia expression J. Immunol. 135,3735-3743[Abstract]
  20. Feldman, G. M., Chuang, E. J., Finbloom, D. S. (1995) IgG immune complexes inhibit IFN-{gamma}-induced transcription of the Fc {gamma} RI gene in human monocytes by preventing the tyrosine phosphorylation of the p91 (Stat1) transcription factor J. Immunol. 154,318-325[Abstract]
  21. Kincaid, E. Z., Ernst, J. D. (2003) Mycobacterium tuberculosis exerts gene-selective inhibition of transcriptional responses to IFN-{gamma} without inhibiting STAT1 function J. Immunol. 171,2042-2049[Abstract/Free Full Text]
  22. Liuzzo, G., Vallejo, A. N., Kopecky, S. L., Frye, R. L., Holmes, D. R., Goronzy, J. J., Weyand, C. M. (2001) Molecular fingerprint of interferon-{gamma} signaling in unstable angina Circulation 103,1509-1514
  23. Jiao, H., Berrada, K., Yang, W., Tabrizi, M., Platanias, L. C., Yi, T. (1996) Direct association with and dephosphorylation of Jak2 kinase by the SH2-domain-containing protein tyrosine phosphatase SHP-1 Mol. Cell. Biol. 16,6985-6992[Abstract]
  24. McCoy, K. L., Chi, E., Engel, D., Rosse, C., Clagett, J. (1982) Abnormal in vitro proliferation of splenic mononuclear phagocytes from autoimmune motheaten mice J. Immunol. 128,1797-1804[Abstract]
  25. Ravetch, J. V., Bolland, S. (2001) IgG Fc receptors Annu. Rev. Immunol. 19,275-290[CrossRef][Medline]
  26. Furumoto, Y., Nunomura, S., Terada, T., Rivera, J., Ra, C. (2004) The Fc{epsilon}RIß immunoreceptor tyrosine-based activation motif exerts inhibitory control on MAPK and I{kappa}B kinase phosphorylation and mast cell cytokine production J. Biol. Chem. 279,49177-49187[Abstract/Free Full Text]
  27. Barrionuevo, P., Beigier-Bompadre, M., Fernandez, G. C., Gomez, S., Alves-Rosa, M. F., Palermo, M. S., Isturiz, M. A. (2003) Immune complex-Fc{gamma}R interaction modulates monocyte/macrophage molecules involved in inflammation and immune response Clin. Exp. Immunol. 133,200-207[CrossRef][Medline]
  28. Boruchov, A. M., Heller, G., Veri, M. C., Bonvini, E., Ravetch, J. V., Young, J. W. (2005) Activating and inhibitory IgG Fc receptors on human DCs mediate opposing functions J. Clin. Invest. 115,2914-2923[CrossRef][Medline]
  29. Yada, A., Ebihara, S., Matsumura, K., Endo, S., Maeda, T., Nakamura, A., Akiyama, K., Aiba, S., Takai, T. (2003) Accelerated antigen presentation and elicitation of humoral response in vivo by Fc{gamma}RIIB- and Fc{gamma}RI/III-mediated immune complex uptake Cell. Immunol. 225,21-32[CrossRef][Medline]
  30. Levy, D. E., Darnell, J. E., Jr (2002) STATs: transcriptional control and biological impact Nat. Rev. Mol. Cell Biol. 3,651-662[CrossRef][Medline]
  31. David, M., Chen, H. E., Goelz, S., Larner, A. C., Neel, B. G. (1995) Differential regulation of the {alpha}/ß interferon-stimulated Jak/Stat pathway by the SH2 domain-containing tyrosine phosphatase SHPTP1 Mol. Cell. Biol. 15,7050-7058[Abstract]
  32. Kashiwada, M., Giallourakis, C. C., Pan, P. Y., Rothman, P. B. (2001) Immunoreceptor tyrosine-based inhibitory motif of the IL-4 receptor associates with SH2-containing phosphatases and regulates IL-4-induced proliferation J. Immunol. 167,6382-6387[Abstract/Free Full Text]
  33. Yi, T., Ihle, J. N. (1993) Association of hematopoietic cell phosphatase with c-kit after stimulation with c-kit ligand Mol. Cell. Biol. 13,3350-3358[Abstract/Free Full Text]
  34. Klingmuller, U., Lorenz, U., Cantley, L. C., Neel, B. G., Lodish, H. F. (1995) Specific recruitment of SH-PTP1 to the erythropoietin receptor causes inactivation of JAK2 and termination of proliferative signals Cell 80,729-738[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0906543v1
81/4/1086    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boekhoudt, G. H.
Right arrow Articles by Feldman, G. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boekhoudt, G. H.
Right arrow Articles by Feldman, G. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS