Journal of Leukocyte Biology eBioscience full spectrum cell analysis
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published online as doi:10.1189/jlb.0606391 on December 21, 2006

Published online before print December 21, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0606391v1
81/4/1065    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lengi, A. J.
Right arrow Articles by Ahmed, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lengi, A. J.
Right arrow Articles by Ahmed, S. A.
(Journal of Leukocyte Biology. 2007;81:1065-1074.)
© 2007 by Society for Leukocyte Biology

Estrogen selectively regulates chemokines in murine splenocytes

Andrea J. Lengi1, Rebecca A. Phillips1, Ebru Karpuzoglu and S. Ansar Ahmed2

Center for Molecular Medicine and Infectious Diseases, Department of Biomedical Sciences and Pathology, Virginia-Maryland Regional College of Veterinary Medicine, Virginia Polytechnic Institute and State University, Blacksburg, Virginia, USA

2 Correspondence: Center for Molecular Medicine and Infectious Diseases, Virginia-Maryland Regional College of Veterinary Medicine, Virginia Tech, 1410 Prices Fork Road, Blacksburg, VA 24061-0342, USA. E-mail: ansrahmd{at}vt.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Estrogen has striking effects on immunity and inflammatory autoimmune conditions. One potential mechanism of estrogen-induced regulation of immunity and inflammatory autoimmune conditions is by altering the secretion of chemokines by lymphocytes, an aspect not well addressed thus far. We found that estrogen has marked, but differential, effects on the secretion of chemokines from activated splenocytes. Estrogen treatment significantly increased the secretion of MCP-1, MCP-5, eotaxin, and stromal cell-derived factor 1ß from Con A-activated splenocytes when compared with placebo-treated controls, and it had no effects on the levels of RANTES, thymus and activation-regulated chemokine, and keratinocyte-derived chemokine (KC) at 24 h. A kinetic analysis showed that chemokines tended to increase with stimulation time, but only MCP-1 and MCP-5 showed a biological trend of increasing in splenocytes from estrogen-treated mice, and KC was decreased significantly in estrogen-treated splenocytes at 18 h. Estrogen did not affect the protein levels of chemokine receptors CCR1 or CCR2 at 24 h. Estrogen-induced alterations in the levels of MCP-1 and MCP-5 are mediated, in part, by IFN-{gamma}, as estrogen treatment of IFN-{gamma} null mice, unlike wild-type mice, did not up-regulate these chemokines. However, addition of recombinant IFN-{gamma} resulted in markedly increased secretion of MCP-1 and MCP-5 only in the cells derived from estrogen-treated mice. These studies provide novel data indicating that estrogen may promote inflammatory conditions by altering the levels of chemokines, providing evidence for an additional mechanism by which estrogens can regulate inflammation.

Key Words: inflammation • MCP-1 • MCP-5 • RANTES • SDF-1ß • eotaxin


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chemokines are a family of low molecular weight proinflammatory cytokines, which induce migration and activation of leukocyte subsets and are responsible for chemoattraction of specific subsets of leukocytes to sites of inflammation [1 , 2 ]. The CC (or ß) family of chemokines, such as MCP-1 (CCL2), MCP-5 (CCL12), eotaxin (CCL11), thymus and activation-regulated chemokine (TARC; CCL17), and RANTES (CCL5), in which the first two amino terminal cysteines are adjacent, is known to act on monocytes, eosinophils, basophils, NK cells, and different lymphocyte populations [1 2 3 ]. The CXC (or {alpha}) chemokines, in which the first two cysteines are separated by one amino acid, are thought to primarily attract neutrophils and include kerotinocyte-derived chemokine (KC; CXCL1) and stromal cell-derived factor-1ß (SDF-1ß; CXCL12) [2 ]. Chemokines act on target cells via G-protein-coupled receptors [2 , 4 ]. Most chemokines are capable of binding more than one receptor, and receptors generally bind more than one chemokine ligand [2 ].

Studies in nonlymphoid tissues have shown that the expression of chemokines is altered by estrogen and that these modifications vary depending on tissue and cell type. For example, spleen endothelial cells cultured with estradiol showed an increase in expression of MCP-1, a potent chemoattractant and activator of macrophages, and dermal endothelial cells showed no increase. The increase in splenic endothelial cells was abrogated if the cells were cocultured with the estrogen receptor (ER) antagonists tamoxifen or ICI 182,780, indicating that this effect is mediated through the ER [5 ]. In humans, increased expression of MCP-1 is associated with endometriosis, an estrogen-dependent disease. Estradiol was found to increase mRNA and protein expression of MCP-1 in endometrial cells in response to IL-1ß [6 ]. In murine macrophage cell lines, ANA-1 and J774A.1, estradiol was shown to inhibit LPS-stimulated MCP-1 mRNA expression [7 ]. Estrogen was also found to down-regulate MCP-1 mRNA and protein expression in a dose-dependent manner in human coronary artery endothelial cells but not in HUVECs [8 ]. Decreasing MCP-1 levels in coronary artery endothelial cells may be a mechanism through which estrogen ameliorates artherosclerosis by reducing macrophage recruitment [8 ]. Estrogen decreases the MCP-1 levels significantly in murine mammary tissue [9 ]. Estrogen also decreased chemotaxis of monocytes to MCP-1 [10 ]. In a model of collagen-induced arthritis using DBA/1LacJ mice, ethinyl estradiol, a synthetic estrogen, was shown to increase MCP-1 expression in the spleen and decrease MCP-1 expression in lymph nodes [11 ]. Furthermore, MCP-1 was increased greater than MCP-5 in lacrimal gland lesions in MRL/MpJ mice, models for Sjögren’s syndrome [12 ].

Macrophage recruitment to the uterus is dependent on estrogen and progesterone. MCP-1 and RANTES are expressed in the uterus during early pregnancy in mice and may be involved in macrophage recruitment [13 ]. Estrogen and progesterone induce mRNA expression of MCP-1, RANTES, MIP-1{alpha}, and KC in mouse uterine tissue, possibly through autocrine/paracrine activities of IL-1. These chemokines may play a role in accumulation of macrophages in the uterus during pregnancy [14 ]. RANTES mRNA was increased significantly in spleen tissue from DNA/1LacJ mice induced with bovine type II collagen and treated orally with ethinyl estradiol [11 ]. However, estrogen exposure of human keratinocytes in vitro inhibits RANTES production. It is believed that estrogen may suppress the infiltration of Th1 cells into psoriatic skin lesions by inhibiting RANTES production. This inhibition is abrogated by the ER antagonist ICI 182-780 [15 ].

TARC is a constitutively expressed chemokine, which has been shown previously to be increased in LPS-treated dendritic cells (DC) by estrogen exposure [16 ]. The eosinophil chemoattractant, eotaxin, has been shown to be increased at the mRNA level in prostate tissue from estrogen-treated male Wistar rats [17 ]. SDF-1ß acts via CXCR4 as a chemotactic and proliferative factor for endothelial cells as well as T and B cells. Treatment of ovarian and breast carcinoma cells with estrogen has been shown to result in dramatic induction of SDF-1ß [18 ]. In a model of acute lung inflammation, levels of another CXC chemokine, KC, were not different in gender or in ovariectomized/intact mice [19 ].

Although there are several studies documenting the role of estrogen in chemokine regulation in nonlymphoid tissues, there is a paucity of fundamental data relating to estrogen regulation of chemokines and their receptors in immune cells. This is a critical gap in the literature, as estrogens are believed to be involved in a wide range of organ and nonorgan-specific autoimmune diseases [20 21 22 23 ] and are thought to be responsible for the increased prevalence of these diseases among females [24 25 26 27 28 29 ]. Therefore, considering that estrogen has notable effects on immunity and autoimmune inflammatory conditions [30 31 32 ], we investigated estrogen regulation of several key chemokines and chemokine receptors using our standard mouse model. For this study, we chose to examine the expression of MCP-1, MCP-5, RANTES, KC, SDF-1ß, TARC, and eotaxin as well as the receptors CCR1, CCR2, CCR3, and CCR4.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Estrogen treatment of mice and culture of splenic lymphocytes
Male C57BL/6 wild-type mice from Charles River Laboratories (Wilmington, MA, USA) were used, except where it is noted that male IFN-{gamma} (bred at Virginia-Maryland Regional College of Veterinary Medicine, Blacksburg, VA, USA) knockout mice on a C57BL/6 background were used. At 4–5 weeks of age, mice were orchiectomized and surgically implanted with silastic capsules containing 17ß-estradiol or empty (placebo) silastic implants by standard procedures, which have been described extensively previously [33 , 34 ]. Briefly, 4–5 mm silastic medical-grade tubing (0.062 inches internal diameterx0.125 inches outer diameter) was packed with estrogen, and the flanking ends were plugged with sterile wooden plugs and sealed with silicone. The animals were anesthetized with ketamine/xylazine and orchietomized as reported previously. Implants (estrogen or placebo) were surgically placed through an incision on the lower back, and the implants were pushed to the neck region. The surgical wounds were closed with wound clips. Serum levels of 17ß-estradiol (placebo, 8.01 pg/ml±2.3; estrogen, 156.02 pg/ml±16.6; P<0.0001; n=6 each) were confirmed 6–7 weeks after surgery using an active estradiol EIA kit from Diagnostic Systems Laboratories (Webster, TX, USA), according to the manufacturer’s instructions. Mice were kept in the Center for Molecular Medicine and Infectious Diseases animal facility, fed a commercial pellet diet devoid of estrogenic hormones (7013 NIH-31 modified 6% mouse/rat-sterilizable diet), given water ad libitum, and housed three to five animals per cage. Mice were killed by cervical dislocation at 1–2 months after treatment, as per our previous studies [32 , 35 ]. The Animal Care Committee at Virginia Polytechnic Institute and State University (Blacksburg, VA, USA) approved all procedures on mice.

Splenic lymphocytes were isolated with ACK-Tris-NH4Cl lysis buffer, per our previous studies, cultured in RPMI-1640 media, devoid of estrogenic phenol red (CellGro, Mediatech, Herndon, VA, USA), and supplemented with steroid-free, 10% charcoal-stripped FBS (Atlanta Biologicals, Atlanta, GA, USA), 2 mM L-glutamine (ICN, Costa Mesa, CA, USA), 50 IU/ml penicillin (Mediatech), 50 µg/ml streptomycin (Mediatech), and nonessential amino acids (Fisher, Pittsburgh, PA, USA). Splenic lymphocytes (500 µL; 5x106 cells/ml) from estrogen- and placebo-treated mice were stimulated for 24 h with 500 µL Con A (10 µg/ml; C0412, Sigma Chemical Co., St. Louis, MO, USA), mouse recombinant (r)IFN-{gamma} (10,000 pg/ml; 554587, BD PharMingen, San Jose, CA, USA), or left unstimulated in media alone. All concentrations of reagents have been optimized in our laboratory. Cells were then harvested and used for the following experiments described.

Cytokine array and ELISA
Mouse splenocytes were cultured with Con A, rIFN-{gamma}, or media only for 24 h as indicated, after which cells were pelleted, and the supernatants were transferred to a clean tube. Supernatants were stored frozen until use. Cytokine arrays (Ray Biotech, Norcross, GA, USA) were performed according to the manufacturer’s instructions. The levels of MCP-5 and RANTES (R&D Systems, Minneapolis, MN, USA) and MCP-1 (Endogen, Rockford, IL, USA) were determined using ELISA kits according to the manufacturer’s instructions.

SearchLight chemokine array
Mouse splenocytes were cultured in Con A or in media alone for 24 h, after which cells were pelleted, and the supernatants were transferred to a clean tube. Supernatants were stored frozen until use. SearchLight mouse chemokine arrays (Pierce Biotechnology, Inc., Rockford, IL, USA) were performed according to the manufacturer’s instructions and analyzed using a cooled, charged-coupled device camera. In selected studies, kinetic analysis of chemokine levels was determined by culturing Con A-activated cells for 3, 6, and 18 h. Pierce Biotechnology (Woburn, MA, USA) analyzed the kinetic samples.

Western blot analysis for chemokine receptors
Western blots were performed according to our procedures reported previously [33 ]. Membranes were incubated with a polyclonal antibody specific to CCR1 (1:4000), CCR2 (1:500), CCR4 (1:1000), or ß-actin (1:8000), diluted in TBS with 0.1% Tween-20 and 5% dried, nonfat milk overnight at 4°C on a shaking platform. Antibodies reactive against CCR1, CCR4, and ß-actin were purchased from Abcam (Cambridge, MA, USA). Antibodies reactive against CCR2 were purchased from GenWay Biotech (San Diego, CA, USA). Membranes were developed using ECL-Plus reagents (Amersham, Piscataway, NJ, USA). Bands were visualized using a Kodak Image Station 440CF.

RNA isolation
RNA was isolated from murine splenocytes (5–10x106 cells per sample) using TRI Reagent (Molecular Research Center, Inc., Cincinnati, OH, USA) according to the manufacturer’s instructions. RNA pellets were resuspended in RNase-free water, quantitated using a RiboGreen RNA quantitation kit (Molecular Probes, Eugene, OR, USA), according to the manufacturer’s instructions, and stored at –80°C until use.

Real-time PCR
Total RNA (500 ng) was used in each reaction. RT and PCR reactions were performed using the QuantiTect SYBR Green RT-PCR kit (Qiagen, Valencia, CA, USA), according to the manufacturer’s instructions. Real-time PCR was carried out on an iCycler machine (BioRad, Hercules, CA, USA) programmed for 40 cycles of 95°C for 20 s, 58°C for 30 s, and 72°C for 45 s. Primers used were as follows: CCR1: 5'tcttctttatcatcctgttgacgattg 3'gagtaatagcaaatatcagacgcacgg; CCR2: 5'cattaccattctgggctcactatgctg 3'agcaaacacagcatgaacaatagcca; CCR3: 5'ctggtgttcatcatcggcctcct 3'ttcgggctcgaagggcaaac; CCR4: 5'caccaaggaaggtatcaaggcat 3'gctgtagaagcccaccaggtacatc; RANTES: 5'tcaccatatggctcggacacca 3'tgaacccacttcttctctgggttgg; ß-actin: 5'tggaatcctgtggcatccatgaaac 3'taaaacgcagctcagtaacagtccg; MCP-1: 5'tcatgcttctgggcctgctg 3'tctcatttggttccgatccaggtt; and MCP-5: 5'ccacacttctatgcctcctg 3'gctgcttgtgattctcctgt.

Statistical analysis
Statistical analysis was performed using InStat statistical software (GraphPad InStat Version 3.0). Two-tailed Student’s t-tests or one-way ANOVA and the Tukey-Kramer multiple comparisons tests were used as appropriate to assess the statistical validity of estrogen-induced changes in chemokine expression. All values are expressed as mean and SEM.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Estrogen treatment of mice markedly up-regulates secretion of MCP-1 and MCP-5 levels by activated splenocytes at 24 h
In our initial studies, using a multiple cytokine array blot as a quick screen, we found that the chemokines MCP-1 and MCP-5 were up-regulated in supernatants from Con A-activated splenocyte cultures derived from estrogen-treated mice, compared with placebo-treated, control mice (Fig. 1A ). The densitometry results for this representative blot are given in Figure 1B . They show that MCP-1 and MCP-5 are up-regulated dramatically in supernatants from estrogen-treated mice compared with placebo-treated mice. We therefore chose to examine these two chemokines in more detail. Splenocytes isolated from estrogen- or placebo-treated mice were cultured with the T cell mitogen Con A (n=15 each for MCP-1; n=11 each for MCP-5) or with media alone (n=9 each for MCP-1 and MCP-5) for 24 h. Supernatants from these cultures were examined for chemokine levels using a specific ELISA. The levels of MCP-1 and MCP-5 were markedly increased (****, P<0.0001; ***, P<0.001, **, P<0.01, respectively) in the culture supernatants from Con A-activated splenocytes of estrogen-treated mice compared with placebo-treated controls (Fig. 1C and 1E) . Activation of splenocytes from estrogen-treated mice was necessary for increased secretion of MCP-1 and MCP-5, as these chemokines were not induced in unstimulated (media-only) cultures. Results using a SearchLight mouse chemokine array provide additional support for up-regulation of MCP-1 and MCP-5 by estrogen. As shown in Figure 1 , D and F, this assay demonstrated significant up-regulation of MCP-1 (n=7 placebo; n=6 estrogen; P=0.0006) and MCP-5 (n=7 placebo; n=6 estrogen; P=0.0052) in supernatants of activated splenocytes from estrogen-treated mice. It is important to note that the ELISA and SearchLight assays were performed on samples from different groups of mice and that the same results were achieved in both groups. In addition, the effects of estrogen exposure on gene expression of MCP-1 and MCP-5 were examined using real-time PCR (Fig. 1G) . As is standard practice, changes greater than twofold were considered to be significant. The mRNA expression of MCP-1, but not MCP-5, appears to be up-regulated in Con A-activated splenocytes from estrogen-treated mice, compared with placebo controls (3.03 and 1.7, respectively).


Figure 1
View larger version (36K):
[in this window]
[in a new window]

 
Figure 1. MCP-1 and MCP-5 expression by splenocytes from placebo- or estrogen-treated mice cultured for 24 h with Con A (10 µg/mL) or media only. (A) Supernatants from Con A-activated cells were collected for use in a chemiluminescent cytokine array. Solid boxes show duplicate spots for MCP-1. Dashed boxes show duplicate spots for MCP-5. Dotted boxes show positive controls, which are located in the left upper-hand corner and the right lower-hand corner of each blot. The blot shown is representative of five. (B) Graphical representation of the net intensities of the boxed spots shown in A, normalized to the positive control spots, is given and demonstrates marked up-regulation of MCP-1 and MCP-5 by estrogen. The levels of MCP-1 (C) and MCP-5 (E; n=15 each for MCP-1; n=11 each for MCP-5) or with media alone (n=9 each for MCP-1 and MCP-5) were increased significantly (****, P<0.0001; ***, P<0.001; **, P<0.01) in Con A-stimulated samples from estrogen-treated mice, as demonstrated by ELISA. SearchLight results are shown for MCP-1 (D) and MCP-5 (F; MCP-1: n=7 placebo, n=6 estrogen, P=0.0006; MCP-5: n=7 placebo, n=6 estrogen, P=0.0052). Gene expression is shown (G).

 
Estrogen treatment has no effect on RANTES at 24 h
The expression of RANTES was measured using ELISA and SearchLight in different batches of mice. Results from both assays suggest that estrogen treatment does not alter levels of RANTES in supernatants, regardless of culture with media only or stimulation with Con A. ELISA results (n=10) are shown in Figure 2A . SearchLight results (n=6 placebo; n=3 estrogen; P=0.3887) are shown in Figure 2B .


Figure 2
View larger version (16K):
[in this window]
[in a new window]

 
Figure 2. RANTES expression by splenocytes from placebo- or estrogen-treated mice cultured for 24 h with Con A (10 µg/mL) or media only. Results from ELISA (A; n=10) and SearchLight (B; n=6 placebo; n=3 estrogen; P=0.3887) assays suggest that estrogen treatment does not alter levels of RANTES in supernatants.

 
At 24 h, estrogen treatment selectively up-regulates eotaxin and SDF-1ß, but not TARC or KC
Further analysis with a SearchLight chemokine array revealed that additional chemokines are also regulated selectively by estrogen. Eotaxin (P=0.0354) and SDF-1ß (P=0.0098) were increased in supernatants from Con A-stimulated splenocytes from estrogen-treated mice (Fig. 3A and 3B , respectively; eotaxin: n=6 each; SDF-1ß: n=7 placebo, n=6 estrogen). However, TARC (Fig. 3C ; n=7 placebo; n=6 estrogen; P=0.4498) and KC expression (Fig. 3D ; n=7 each; P=0.9987) were not changed noticeably by estrogen. This again demonstrates that estrogen exposure does not lead to an increase in all chemokines but instead, that the expression of chemokines is altered selectively by estrogen.


Figure 3
View larger version (23K):
[in this window]
[in a new window]

 
Figure 3. Eotaxin, SDF-1ß, TARC, and KC expression by splenocytes from placebo- or estrogen-treated mice cultured for 24 h with Con A (10 µg/mL). Eotaxin (A) and SDF-1ß (B) were increased in supernatants from Con A-stimulated splenocytes from estrogen-treated mice (eotaxin: n=6 each, P=0.0354; *, P<0.05; SDF-1ß: n=7 placebo, n=6 estrogen, P=0.0098; **, P<0.01). TARC (C; n=7 placebo; n=6 estrogen) appeared to be down-regulated slightly (but not significantly; P=0.4498) in estrogen-treated mice, and no change was observed in KC expression (D; n=7 each; P=0.9987).

 
Kinetics of chemokine secretion
To determine whether estrogen altered the levels of selected chemokines (MCP-1, MCP-5, RANTES, eotaxin, SDF-1ß, TARC, and KC) at a time-point earlier than 24 h, we performed a kinetic analysis of Con A-activated samples cultured for 3, 6, and 18 h using SearchLight (Fig. 4 ). In general, the levels of chemokines were low at the initial culture time-point (3 h) but increased with Con A stimulation time (6 and 18 h). As shown in Figure 4 , A and B, estrogen showed a biological trend of increasing the expression of MCP-1 and MCP-5 with time. However, MCP-1 and MCP-5 were not increased significantly by estrogen at 18 h, suggesting that 24 h may be required for the significant induction shown in Figure 1 . Expression of RANTES and TARC increased with time in placebo- and estrogen-treated mice, as shown in Figure 4C and 4F , respectively. However, RANTES and TARC were not up-regulated significantly in splenocytes from estrogen-treated mice compared with placebo-treated mice at any time-point. These results are consistent with the data shown in Figure 2 (RANTES) and Figure 3C (TARC), suggesting that estrogen does not alter the expression of RANTES or TARC significantly in splenocytes. A nonsignificant, increasing trend was observed for estrogen induction of eotaxin expression with time, as shown in Figure 4D . These results suggest that a longer period of culture may be required for observation of the significant induction of eotaxin shown in Figure 3A for estrogen-treated mice. SDF-1ß was not altered significantly by estrogen at 3, 6, or 18 h, (Fig. 4E) . Unlike the results observed for several other chemokines, estrogen tended to decrease expression of KC at 6 and 18 h. The decrease in KC expression, shown in Figure 4G by splenocytes from estrogen-treated mice compared with their placebo-treated counterparts, was significant at 18 h (P<0.001). The results of the kinetic analysis demonstrate that all chemokines were expressed at low levels for early time-points and confirm the selective regulation of chemokine by estrogen.


Figure 4
View larger version (20K):
[in this window]
[in a new window]

 
Figure 4. Kinetic analysis of MCP-1, MCP-5, RANTES, eotaxin, SDF-1ß, TARC, and KC expression in splenocytes from placebo- or estrogen-treated mice (n=4 each), cultured for 3, 6, and 18 h with Con A (10 µg/mL) or media only, demonstrated that chemokines were expressed at low levels initially, but they tended to increase with stimulation time. Estrogen showed a nonsignificant trend of increasing the expression of MCP-1 (A) and MCP-5 (B) with time. Expression of RANTES (C) and TARC (F) increased with time. However, neither RANTES nor TARC was up-regulated significantly in splenocytes from estrogen-treated mice compared with placebo-treated mice 3, 6, or 18 h. A nonsignificant, increasing trend was observed for estrogen induction of eotaxin (D). SDF-1ß was not altered significantly by estrogen at 3, 6, or 18 h (E). Estrogen tended to decrease expression of KC at 6 and 18 h (G). The decrease in KC expression was significant at 18 h (P<0.001).

 
Chemokine receptor expression in splenic lymphoid cells is not altered by estrogen treatment
We next examined the expression of the chemokine receptors that are involved in mediating the effects of some of these chemokines. MCP-1 and MCP-5 bind to CCR2. RANTES has been shown to bind to CCR1, CCR3, CCR4, and CCR5. We chose to examine the effect of estrogen treatment on the expression of CCR1, CCR2, and CCR4 by Western blot analysis. We were unable to examine the expression of CCR3 and CCR5, as specific antibodies against these receptors are not available at this time. Our data show that CCR1 is up-regulated by Con A stimulation; however, there is no apparent effect of estrogen treatment on the protein levels detected by Western blot. (Fig. 5A ). CCR2 protein expression was also unchanged (Fig. 5B) , and CCR4 was undetectable in our experiments (data not shown).


Figure 5
View larger version (58K):
[in this window]
[in a new window]

 
Figure 5. Chemokine receptor expression by splenocytes from placebo (P)- or estrogen (E)-treated mice cultured for 24 h with Con A (10 µg/mL) or media only. Neither CCR1 (A) nor CCR2 (B) showed a difference in protein expression between estrogen and placebo mice. Gene expression (C) for CCR1, CCR2, CCR3, and CCR4.

 
We also used real-time PCR to determine mRNA levels of CCR1, CCR2, CCR3, and CCR4 (Fig. 5C) . The gene expression of chemokine receptor CCR1 appears to be up-regulated in activated splenocytes from estrogen-treated mice, and the expression levels of CCR2, CCR3, and CCR4 appear to be down-regulated. These results are in disagreement with the data obtained for protein expression levels; however, this is not surprising, as it is known that gene expression levels and protein expression levels do not necessarily correlate in estrogen regulation of chemokines in mice [36 ].

Chemokine regulation by estrogen is mediated by IFN-{gamma}
Other studies, using nonlymphocytic cells, have shown that IFN-{gamma} regulates MCP-1 or MCP-5. For example, it has been demonstrated in a human osteoblastic cell line that IFN-{gamma} stimulates transcription of MCP-1 [37 ]. Another study showed that treatment with IFN-{gamma} selectively enhanced the LPS-induced gene expression of MCP-5 in murine macrophage cultures and inhibited LPS-induced expression of MCP-1 and KC [3 ]. As we have shown that estrogen treatment of wild-type mice increases the secretion of IFN-{gamma} and expression of other IFN-{gamma}-inducible, proinflammatory molecules such as inducible NO synthase and cyclooxygenase-2 in activated splenocyte cultures [32 ], we decided to examine the role of IFN-{gamma} in the estrogen regulation of the selected CC chemokines. IFN-{gamma} null mice (IFN-{gamma} /) were treated with estrogen or empty placebo implants. Splenocytes from these mice were cultured for 24 h with media, Con A, or Con A supplemented with rIFN-{gamma}, after which, culture supernatants were collected and examined by ELISA for chemokine expression. It is interesting that unlike in the wild-type mice (Fig. 1) , estrogen did not up-regulate the levels of MCP-1 (n=8) and MCP-5 (n=6) in supernatants from Con A-activated splenocyte cultures derived from IFN-{gamma} / mice (Fig. 6 ). However, with the addition of rIFN-{gamma}, the levels of MCP-1 and MCP-5 increased significantly (****, P<0.0001) but only in samples from estrogen-treated mice (Fig. 6A and 6B) . This implies that estrogen treatment of mice in vivo may prime the immune system to respond differently to subsequent exposure to IFN-{gamma}. This is a unique finding, demonstrating that a natural, endogenous, soluble substance (i.e., estrogen) can alter the response behavior of splenocytes to IFN-{gamma}.


Figure 6
View larger version (13K):
[in this window]
[in a new window]

 
Figure 6. MCP-1 and MCP-5 expression by splenocytes from placebo- or estrogen-treated IFN-{gamma} / mice cultured for 24 h with Con A (10 µg/mL) alone, Con A plus rIFN-{gamma} (10,000 pg/mL), or media only. Estrogen did not up-regulate the levels of MCP-1 (A; n=8) and MCP-5 (B; n=6) in supernatants from Con A-activated splenocyte cultures derived from IFN-{gamma} / mice, except upon addition of rIFN-{gamma} and then, only in samples from estrogen-treated mice (****, P<0.0001).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Leukocyte migration in the uterus is known to increase in the secretory phase of the menstrual cycle, and this increase in cell mobility to thought to be secondary to chemokine secretion by stromal cells within the endometrium [38 ], which is known to secrete MCP-1 and RANTES [39 40 41 ]. Levels of MCP-1 rise during the proliferative phase of the menstrual cycle [4 , 41 ]. In this study, we show that estrogen also up-regulates MCP-1 levels in activated splenocytes at 24 h of culture with Con A. Likewise, there was a marked increase in the levels of MCP-5 in Con A-activated splenocytes from estrogen-treated mice compared with similar cultures from placebo-treated, control mice. This is a significant finding, as MCP-1 and MCP-5 are involved in recruiting macrophages and other leukocytes to sites of inflammation. The data presented here suggest that IFN-{gamma} plays a role in up-regulation of MCP-1 and MCP-5. Results shown here for IFN-{gamma} knockout mice show that both of these chemokines are up-regulated significantly at 24 h in estrogen-treated mice upon addition of rIFN-{gamma}.

In addition to the above two chemokines, estrogen treatment enhanced secretion of eotaxin and SDF-1ß by activated splenocytes after 24 h of culture with Con A. Our studies about estrogen-induced up-regulation of SDF-1ß secretion by splenocytes are in agreement with estrogen-induced up-regulation of SDF-1ß in breast and ovarian cancer cell lines as well as monkey mammalian epithelial cells [18 , 42 ]. In these latter studies, estrogen-induced SDF-1ß is mediated via ER-{alpha}. It is likely that a similar mechanism may be operative in splenocytes as well, an aspect that will be investigated in future studies. Our findings of estrogen-induced up-regulation of eotaxin secretion by splenocytes are in agreement with similar findings in rat prostate cells [17 ] but differ from studies in preovulatory cells, where estrogen was shown to inhibit eotaxin [43 ]. These differences in estrogen up-regulation of eotaxin suggest that estrogen has differential effects on eotaxin secretion in diverse cell types.

We found that other chemokines were unchanged by estrogen treatment. We did not observe a noticeable effect of estrogen on KC secretion by activated splenocytes at 24 h of stimulation. Our findings are analogous to those reported previously, where no difference was found between lung samples from ovary-intact and ovariectomized mice [19 ]. However, one study [13 ] reported that estrogen up-regulated KC mRNA in mouse uterine tissue. The differences in the results reported in the study about uterine tissue and those reported in our present work with splenocytes and those in lung tissues [19 ] may be a result of differences in the types of tissues and in the end-point examined (mRNA in uterine tissue vs. protein in splenocytes). Furthermore, we observed no change in TARC expression at 24 h following estrogen treatment. Unlike results reported for immature DC [16 ], we did not observe an increase in TARC with estrogen exposure. The discrepancy may be a result of differences in experiment design such as in vitro versus in vivo estrogen treatment, stimulation with LPS versus Con A, or the use of purified DC versus mixed splenocyte populations.

Similar to TARC and KC, RANTES remained unaltered in the work reported here in splenocytes from estrogen-treated mice compared with placebo controls. However, studies in keratinocytes demonstrated a decrease in RANTES following in vitro exposure to estrogen [15 ]. These results differ with those presented here, as we did not observe an estrogen-mediated change in RANTES expression by splenocytes at any of the culture time-points tested. The variance may be a result of differences in tissues, the different routes of exposure (in vitro vs. in vivo), distinctive types of stimulation (TNF-{alpha} vs. Con A), or variation in ER signaling between the two cell types. For example, keratinocytes only express ER-ß. Expression of only one form of the ER in keratinocytes likely results in different signaling compared with what occurs in immune cells, which may express ER-{alpha} and ER-ß. Our results are aligned with those reported for preovulatory rat ovary tissue, where RANTES remained relatively unchanged upon treatment with human chorionic gonadotropin [43 ]. Therefore, it is likely that estrogen has different immunological effects in diverse tissues within the same individual [22 , 25 ].

The kinetic analysis of chemokines at time-points earlier than 24 h of culture revealed that the chemokines studied are expressed only at low levels following 3 h of stimulation with Con A. Generally, the chemokines tended to increase with stimulation time. MCP-1 and MCP-5 demonstrated nonsignificant, increasing biological trends in splenocytes from estrogen-treated mice. Estrogen appears to prime splenocytes, which when activated, differentially release these chemokines. The expression of RANTES, eotaxin, SDF-1ß, and TARC increased with culture time, but there was no difference in the increase observed for estrogen- and placebo-treated mice at 3, 6, or 18 h. Only KC was decreased significantly at an early time-point (18 h) in splenocytes from estrogen-treated mice. It is plausible that the levels of chemokines may be altered differentially in splenocytes from estrogen-treated mice cultured at time-points beyond 24 h.

Female C57BL/6 mice have been reported to have significant increases in CCR1-CCR5 RNA expression on CD4+ T cells compared with male mice [44 ]. Female AKR mice treated in vivo with estrogen following oophorectomy have been shown to have increased CCR1–CCR5 RNA expression compared with their controls. Aged C57BL/6 female mice were found to have significant increases only in CCR1, CCR3, and CCR4 [44 ]. In vitro estrogen treatment of monocytes from C3H mice was shown to result in decreased CCR1 and CCR2 surface receptors [10 ]. These results differ somewhat from those reported here, as we did not observe a change in CCR2–4 mRNA nor did we observe increased protein expression of CCR1 and CCR2. These differences may be a result of differences in experimental models (monocytes vs. splenocytes; C3H mice vs. C57BL/6 mice). However, we did measure a 5.7-fold increase in CCR1 mRNA in estrogen-treated mice compared with placebo-treated mice.

Overall, our studies are the first to show that estrogen selectively regulates the release of chemokines by activated splenocytes. In particular, we noticed that upon activation, estrogen treatment primes splenic lymphocytes to markedly induce MCP-1, MCP-5, eotaxin, and SDF-1ß. It had minimal to no effects on RANTES, TARC, and KC. The precise reasons for these differential effects of estrogen on chemokines are not known. The chemokines studied in this report may be affected differentially by the two major ERs, ER-{alpha} and ER-ß. We plan to study this potential mechanism using ER-{alpha}, ER-ß, and ER-{alpha}ß double-knockout mice as well as small interfering RNA gene-silencing strategies. Our novel findings, regarding the selective effects of estrogen on chemokines, shed new light onto estrogen regulation of proinflammatory molecules and have profound implications to immunity, inflammation, and autoimmunity.


    ACKNOWLEDGEMENTS
 
This work was supported by the National Institutes of Health (1 RO1 AI051880-04A1). The authors thank Tyson Brummer for preparation of implants and assistance with surgeries. We also thank Lynn Heffron and the animal care staff. The authors appreciate the assistance of Lynia Woburn at Pierce Biotechnology for performing the SearchLight assay on the kinetic samples.


    FOOTNOTES
 
1 These authors contributed equally to this work. Back

Received June 9, 2006; revised November 10, 2006; accepted December 1, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Rollins, B. J. (1997) Chemokines Blood 90,909-928[Free Full Text]
  2. Haelens, A., Wuyts, A., Proost, P., Struyf, S., Opdenakker, G., van Damme, J. (1996) Leukocyte migration and activation by murine chemokines Immunobiology 195,499-521[Medline]
  3. Kopydlowski, K. M., Salkowski, C. A., Cody, M. J., van Rooijen, N., Major, J., Hamilton, T. A., Vogel, S. N. (1999) Regulation of macrophage chemokine expression by lipopolysaccharide in vitro and in vivo J. Immunol. 163,1537-1544[Abstract/Free Full Text]
  4. Kayisli, U. A., Mahutte, N. G., Arici, A. (2002) Uterine chemokines in reproductive physiology and pathology Am. J. Reprod. Immunol. 47,213-221[Medline]
  5. Murphy, H. S., Sun, Q., Murphy, B. A., Mo, R., Huo, J., Chen, J., Chensue, S. W., Adams, M., Richardson, B. C., Yung, R. (2004) Tissue-specific effect of estradiol on endothelial cell-dependent lymphocyte recruitment Microvasc. Res. 68,273-285[CrossRef][Medline]
  6. Boucher, A., Mourad, W., Mailloux, J., Lemay, A., Akoum, A. (2000) Ovarian hormones modulate monocyte chemotactic protein-1 expression in endometrial cells of women with endometriosis Mol. Hum. Reprod. 6,618-626[Abstract/Free Full Text]
  7. Frazier-Jessen, M. R., Kovacs, E. J. (1995) Estrogen modulation of JE/monocyte chemoattractant protein-1 mRNA expression in murine macrophages J. Immunol. 154,1838-1845[Abstract]
  8. Seli, E., Pehlivan, T., Selam, B., Garcia-Velasco, J. A., Arici, A. (2002) Estradiol down-regulates MCP-1 expression in human coronary artery endothelial cells Fertil. Steril. 77,542-547[CrossRef][Medline]
  9. Fanti, P., Nazareth, M., Bucelli, R., Mineo, M., Gibbs, K., Kumin, M., Grzybek, K., Hoeltke, J., Raiber, L., Poppenberg, K., Janis, K., Schwach, C., Aronica, S. M. (2003) Estrogen decreases chemokine levels in murine mammary tissue: implications for the regulatory role of MIP-1 {alpha} and MCP-1/JE in mammary tumor formation Endocrine 22,161-168[CrossRef][Medline]
  10. Janis, K., Hoeltke, J., Nazareth, M., Fanti, P., Poppenberg, K., Aronica, S. M. (2004) Estrogen decreases expression of chemokine receptors, and suppresses chemokine bioactivity in murine monocytes Am. J. Reprod. Immunol. 51,22-31
  11. Subramanian, S., Tovey, M., Afentoulis, M., Krogstad, A., Vandenbark, A. A., Offner, H. (2005) Ethinyl estradiol treats collagen-induced arthritis in DBA/1LacJ mice by inhibiting the production of TNF-{alpha} and IL-1ß Clin. Immunol. 115,162-172[CrossRef][Medline]
  12. Akpek, E. K., Jabs, D. A., Gerard, H. C., Prendergast, R. A., Hudson, A. P., Lee, B., Whittum-Hudson, J. A. (2004) Chemokines in autoimmune lacrimal gland disease in MRL/MpJ mice Invest. Ophthalmol. Vis. Sci. 45,185-190[Abstract/Free Full Text]
  13. Wood, G. W., Hausmann, E., Choudhuri, R. (1997) Relative role of CSF-1, MCP-1/JE, and RANTES in macrophage recruitment during successful pregnancy Mol. Reprod. Dev. 46,62-69[CrossRef][Medline]
  14. Wood, G. W., Hausmann, E. H., Kanakaraj, K. (1999) Expression and regulation of chemokine genes in the mouse uterus during pregnancy Cytokine 11,1038-1045[CrossRef][Medline]
  15. Kanda, N., Watanabe, S. (2003) 17ß-Estradiol inhibits the production of RANTES in human keratinocytes J. Invest. Dermatol. 120,420-427[CrossRef][Medline]
  16. Bengtsson, A. K., Ryan, E. J., Giordano, D., Magaletti, D. M., Clark, E. A. (2004) 17ß-Estradiol (E2) modulates cytokine and chemokine expression in human monocyte-derived dendritic cells Blood 104,1404-1410[Abstract/Free Full Text]
  17. Harris, M. T., Feldberg, R. S., Lau, K. M., Lazarus, N. H., Cochrane, D. E. (2000) Expression of proinflammatory genes during estrogen-induced inflammation of the rat prostate Prostate 44,19-25[CrossRef][Medline]
  18. Hall, J. M., Korach, K. S. (2003) Stromal cell-derived factor 1, a novel target of estrogen receptor action, mediates the mitogenic effects of estradiol in ovarian and breast cancer cells Mol. Endocrinol. 17,792-803[Abstract/Free Full Text]
  19. Speyer, C. L., Rancilio, N. J., McClintock, S. D., Crawford, J. D., Gao, H., Sarma, J. V., Ward, P. A. (2005) Regulatory effects of estrogen on acute lung inflammation in mice Am. J. Physiol. Cell Physiol. 288,C881-C890[Abstract/Free Full Text]
  20. Lahita, R. G. (2000) Sex hormones and systemic lupus erythematosus Rheum. Dis. Clin. North Am. 26,951-968[CrossRef][Medline]
  21. Whitacre, C. C., Reingold, S. C., O’Looney, P. A. (1999) A gender gap in autoimmunity Science 283,1277-1278[Free Full Text]
  22. Ansar Ahmed, S., Hissong, B. D., Verthelyi, D., Donner, K., Becker, K., Karpuzoglu-Sahin, E. (1999) Gender and risk of autoimmune diseases: possible role of estrogenic compounds Environ. Health Perspect. 107(Suppl. 5),681-686[Medline]
  23. Ansar Ahmed, S., Karpuzo-Sahin, E. (2005) Estrogen, Interferon-{gamma}, and Lupus (Chapter 14) Kluwer Academic/Plenum New York, NY, USA.
  24. Lahita, R. G. (2000) Gender and the immune system J. Gend. Specif. Med. 3,19-22[Medline]
  25. Ansar Ahmed, S., Talal, N. (1990) Sex hormones and the immune system—part 2 Animal data. Baillieres Clin. Rheumatol. 4,13-31
  26. Talal, N., Ansar Ahmed, S. (1988) Sex hormones, CD5+ (Lyl+) B-cells, and autoimmune diseases Isr. J. Med. Sci. 24,725-728[Medline]
  27. Grossman, C. J. (1984) Regulation of the immune system by sex steroids Endocr. Rev. 5,435-455[CrossRef][Medline]
  28. Lahita, R. G. (1997) Effects of gender on the immune system. Implications for neuropsychiatric systemic lupus erythematosus Ann. N. Y. Acad. Sci. 823,247-251[CrossRef][Medline]
  29. Gilmore, W., Weiner, L. P., Correale, J. (1997) Effect of estradiol on cytokine secretion by proteolipid protein-specific T cell clones isolated from multiple sclerosis patients and normal control subjects J. Immunol. 158,446-451[Abstract]
  30. Maret, A., Coudert, J. D., Garidou, L., Foucras, G., Gourdy, P., Krust, A., Dupont, S., Chambon, P., Druet, P., Bayard, F., Guery, J. C. (2003) Estradiol enhances primary antigen-specific CD4 T cell responses and Th1 development in vivo. Essential role of estrogen receptor {alpha} expression in hematopoietic cells Eur. J. Immunol. 33,512-521[CrossRef][Medline]
  31. Sarvetnick, N., Fox, H. S. (1990) Interferon-{gamma} and the sexual dimorphism of autoimmunity Mol. Biol. Med. 7,323-331[Medline]
  32. Karpuzoglu, E., Fenaux, J. B., Phillips, R. A., Lengi, A. J., Elvinger, F., Ansar Ahmed, S. (2006) Estrogen up-regulates inducible nitric oxide synthase, nitric oxide, and cyclooxygenase-2 in splenocytes activated with T cell stimulants: role of interferon-{gamma} Endocrinology 147,662-671[Abstract/Free Full Text]
  33. Karpuzoglu-Sahin, E., Zhi-Jun, Y., Lengi, A., Sriranganathan, N., Ansar Ahmed, S. (2001) Effects of long-term estrogen treatment on IFN-{gamma}, IL-2 and IL-4 gene expression and protein synthesis in spleen and thymus of normal C57BL/6 mice Cytokine 14,208-217[CrossRef][Medline]
  34. Ansar Ahmed, S., Verthelyi, D. (1993) Antibodies to cardiolipin in normal C57BL/6J mice: induction by estrogen but not dihydrotestosterone J. Autoimmun. 6,265-279[CrossRef][Medline]
  35. Lengi, A. J., Phillips, R. A., Karpuzoglu, E., Ansar Ahmed, S. (2006) 17ß-Estradiol downregulates interferon regulatory factor-1 (IRF-1) in murine splenocytes J. Mol. Endocrinol. 37,421-432[Abstract/Free Full Text]
  36. Chen, G., Gharib, T. G., Huang, C. C., Taylor, J. M., Misek, D. E., Kardia, S. L., Giordano, T. J., Iannettoni, M. D., Orringer, M. B., Hanash, S. M., Beer, D. G. (2002) Discordant protein and mRNA expression in lung adenocarcinomas Mol. Cell. Proteomics 1,304-313[Abstract/Free Full Text]
  37. Valente, A. J., Xie, J. F., Abramova, M. A., Wenzel, U. O., Abboud, H. E., Graves, D. T. (1998) A complex element regulates IFN-{gamma}-stimulated monocyte chemoattractant protein-1 gene transcription J. Immunol. 161,3719-3728[Abstract/Free Full Text]
  38. DeLoia, J. A., Stewart-Akers, A. M., Brekosky, J., Kubik, C. J. (2002) Effects of exogenous estrogen on uterine leukocyte recruitment Fertil. Steril. 77,548-554[CrossRef][Medline]
  39. Akiyama, M., Okabe, H., Takakura, K., Fujiyama, Y., Noda, Y. (1999) Expression of macrophage inflammatory protein-1{alpha} (MIP-1{alpha}) in human endometrium throughout the menstrual cycle Br. J. Obstet. Gynaecol. 106,725-730[Medline]
  40. Hornung, D., Ryan, I. P., Chao, V. A., Vigne, J. L., Schriock, E. D., Taylor, R. N. (1997) Immunolocalization and regulation of the chemokine RANTES in human endometrial and endometriosis tissues and cells J. Clin. Endocrinol. Metab. 82,1621-1628[Abstract/Free Full Text]
  41. Jones, R. L., Kelly, R. W., Critchley, H. O. (1997) Chemokine and cyclooxygenase-2 expression in human endometrium coincides with leukocyte accumulation Hum. Reprod. 12,1300-1306[Abstract/Free Full Text]
  42. Dimitrakakis, C., Zhou, J., Wang, J., Matyakhina, L., Mezey, E., Wood, J. X., Wang, D., Bondy, C. (2006) Co-expression of estrogen receptor-{alpha} and targets of estrogen receptor action in proliferating monkey mammary epithelial cells Breast Cancer Res. 8,R10[CrossRef][Medline]
  43. Wong, K. H., Negishi, H., Adashi, E. Y. (2002) Expression, hormonal regulation, and cyclic variation of chemokines in the rat ovary: key determinants of the intraovarian residence of representatives of the white blood cell series Endocrinology 143,784-791[Abstract/Free Full Text]
  44. Mo, R., Chen, J., Grolleau-Julius, A., Murphy, H. S., Richardson, B. C., Yung, R. L. (2005) Estrogen regulates CCR gene expression and function in T lymphocytes J. Immunol. 174,6023-6029[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
BloodHome page
R. Dai, R. A. Phillips, Y. Zhang, D. Khan, O. Crasta, and S. A. Ahmed
Suppression of LPS-induced Interferon-{gamma} and nitric oxide in splenic lymphocytes by select estrogen-regulated microRNAs: a novel mechanism of immune modulation
Blood, December 1, 2008; 112(12): 4591 - 4597.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. A. Pioli, A. L. Jensen, L. K. Weaver, E. Amiel, Z. Shen, L. Shen, C. R. Wira, and P. M. Guyre
Estradiol Attenuates Lipopolysaccharide-Induced CXC Chemokine Ligand 8 Production by Human Peripheral Blood Monocytes
J. Immunol., November 1, 2007; 179(9): 6284 - 6290.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0606391v1
81/4/1065    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lengi, A. J.
Right arrow Articles by Ahmed, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lengi, A. J.
Right arrow Articles by Ahmed, S. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS