Published online before print December 21, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Center for Molecular Medicine and Infectious Diseases, Department of Biomedical Sciences and Pathology, Virginia-Maryland Regional College of Veterinary Medicine, Virginia Polytechnic Institute and State University, Blacksburg, Virginia, USA
2 Correspondence: Center for Molecular Medicine and Infectious Diseases, Virginia-Maryland Regional College of Veterinary Medicine, Virginia Tech, 1410 Prices Fork Road, Blacksburg, VA 24061-0342, USA. E-mail: ansrahmd{at}vt.edu
|
|
|---|
, as estrogen treatment of IFN-
null mice, unlike wild-type mice, did not up-regulate these chemokines. However, addition of recombinant IFN-
resulted in markedly increased secretion of MCP-1 and MCP-5 only in the cells derived from estrogen-treated mice. These studies provide novel data indicating that estrogen may promote inflammatory conditions by altering the levels of chemokines, providing evidence for an additional mechanism by which estrogens can regulate inflammation.
Key Words: inflammation MCP-1 MCP-5 RANTES SDF-1ß eotaxin
|
|
|---|
) chemokines, in which the first two cysteines are separated by one amino acid, are thought to primarily attract neutrophils and include kerotinocyte-derived chemokine (KC; CXCL1) and stromal cell-derived factor-1ß (SDF-1ß; CXCL12) [2
]. Chemokines act on target cells via G-protein-coupled receptors [2
, 4
]. Most chemokines are capable of binding more than one receptor, and receptors generally bind more than one chemokine ligand [2
]. Studies in nonlymphoid tissues have shown that the expression of chemokines is altered by estrogen and that these modifications vary depending on tissue and cell type. For example, spleen endothelial cells cultured with estradiol showed an increase in expression of MCP-1, a potent chemoattractant and activator of macrophages, and dermal endothelial cells showed no increase. The increase in splenic endothelial cells was abrogated if the cells were cocultured with the estrogen receptor (ER) antagonists tamoxifen or ICI 182,780, indicating that this effect is mediated through the ER [5 ]. In humans, increased expression of MCP-1 is associated with endometriosis, an estrogen-dependent disease. Estradiol was found to increase mRNA and protein expression of MCP-1 in endometrial cells in response to IL-1ß [6 ]. In murine macrophage cell lines, ANA-1 and J774A.1, estradiol was shown to inhibit LPS-stimulated MCP-1 mRNA expression [7 ]. Estrogen was also found to down-regulate MCP-1 mRNA and protein expression in a dose-dependent manner in human coronary artery endothelial cells but not in HUVECs [8 ]. Decreasing MCP-1 levels in coronary artery endothelial cells may be a mechanism through which estrogen ameliorates artherosclerosis by reducing macrophage recruitment [8 ]. Estrogen decreases the MCP-1 levels significantly in murine mammary tissue [9 ]. Estrogen also decreased chemotaxis of monocytes to MCP-1 [10 ]. In a model of collagen-induced arthritis using DBA/1LacJ mice, ethinyl estradiol, a synthetic estrogen, was shown to increase MCP-1 expression in the spleen and decrease MCP-1 expression in lymph nodes [11 ]. Furthermore, MCP-1 was increased greater than MCP-5 in lacrimal gland lesions in MRL/MpJ mice, models for Sjögrens syndrome [12 ].
Macrophage recruitment to the uterus is dependent on estrogen and progesterone. MCP-1 and RANTES are expressed in the uterus during early pregnancy in mice and may be involved in macrophage recruitment [13
]. Estrogen and progesterone induce mRNA expression of MCP-1, RANTES, MIP-1
, and KC in mouse uterine tissue, possibly through autocrine/paracrine activities of IL-1. These chemokines may play a role in accumulation of macrophages in the uterus during pregnancy [14
]. RANTES mRNA was increased significantly in spleen tissue from DNA/1LacJ mice induced with bovine type II collagen and treated orally with ethinyl estradiol [11
]. However, estrogen exposure of human keratinocytes in vitro inhibits RANTES production. It is believed that estrogen may suppress the infiltration of Th1 cells into psoriatic skin lesions by inhibiting RANTES production. This inhibition is abrogated by the ER antagonist ICI 182-780 [15
].
TARC is a constitutively expressed chemokine, which has been shown previously to be increased in LPS-treated dendritic cells (DC) by estrogen exposure [16 ]. The eosinophil chemoattractant, eotaxin, has been shown to be increased at the mRNA level in prostate tissue from estrogen-treated male Wistar rats [17 ]. SDF-1ß acts via CXCR4 as a chemotactic and proliferative factor for endothelial cells as well as T and B cells. Treatment of ovarian and breast carcinoma cells with estrogen has been shown to result in dramatic induction of SDF-1ß [18 ]. In a model of acute lung inflammation, levels of another CXC chemokine, KC, were not different in gender or in ovariectomized/intact mice [19 ].
Although there are several studies documenting the role of estrogen in chemokine regulation in nonlymphoid tissues, there is a paucity of fundamental data relating to estrogen regulation of chemokines and their receptors in immune cells. This is a critical gap in the literature, as estrogens are believed to be involved in a wide range of organ and nonorgan-specific autoimmune diseases [20 21 22 23 ] and are thought to be responsible for the increased prevalence of these diseases among females [24 25 26 27 28 29 ]. Therefore, considering that estrogen has notable effects on immunity and autoimmune inflammatory conditions [30 31 32 ], we investigated estrogen regulation of several key chemokines and chemokine receptors using our standard mouse model. For this study, we chose to examine the expression of MCP-1, MCP-5, RANTES, KC, SDF-1ß, TARC, and eotaxin as well as the receptors CCR1, CCR2, CCR3, and CCR4.
|
|
|---|
(bred at Virginia-Maryland Regional College of Veterinary Medicine, Blacksburg, VA, USA) knockout mice on a C57BL/6 background were used. At 45 weeks of age, mice were orchiectomized and surgically implanted with silastic capsules containing 17ß-estradiol or empty (placebo) silastic implants by standard procedures, which have been described extensively previously [33
, 34
]. Briefly, 45 mm silastic medical-grade tubing (0.062 inches internal diameterx0.125 inches outer diameter) was packed with estrogen, and the flanking ends were plugged with sterile wooden plugs and sealed with silicone. The animals were anesthetized with ketamine/xylazine and orchietomized as reported previously. Implants (estrogen or placebo) were surgically placed through an incision on the lower back, and the implants were pushed to the neck region. The surgical wounds were closed with wound clips. Serum levels of 17ß-estradiol (placebo, 8.01 pg/ml±2.3; estrogen, 156.02 pg/ml±16.6; P<0.0001; n=6 each) were confirmed 67 weeks after surgery using an active estradiol EIA kit from Diagnostic Systems Laboratories (Webster, TX, USA), according to the manufacturers instructions. Mice were kept in the Center for Molecular Medicine and Infectious Diseases animal facility, fed a commercial pellet diet devoid of estrogenic hormones (7013 NIH-31 modified 6% mouse/rat-sterilizable diet), given water ad libitum, and housed three to five animals per cage. Mice were killed by cervical dislocation at 12 months after treatment, as per our previous studies [32
, 35
]. The Animal Care Committee at Virginia Polytechnic Institute and State University (Blacksburg, VA, USA) approved all procedures on mice.
Splenic lymphocytes were isolated with ACK-Tris-NH4Cl lysis buffer, per our previous studies, cultured in RPMI-1640 media, devoid of estrogenic phenol red (CellGro, Mediatech, Herndon, VA, USA), and supplemented with steroid-free, 10% charcoal-stripped FBS (Atlanta Biologicals, Atlanta, GA, USA), 2 mM L-glutamine (ICN, Costa Mesa, CA, USA), 50 IU/ml penicillin (Mediatech), 50 µg/ml streptomycin (Mediatech), and nonessential amino acids (Fisher, Pittsburgh, PA, USA). Splenic lymphocytes (500 µL; 5x106 cells/ml) from estrogen- and placebo-treated mice were stimulated for 24 h with 500 µL Con A (10 µg/ml; C0412, Sigma Chemical Co., St. Louis, MO, USA), mouse recombinant (r)IFN-
(10,000 pg/ml; 554587, BD PharMingen, San Jose, CA, USA), or left unstimulated in media alone. All concentrations of reagents have been optimized in our laboratory. Cells were then harvested and used for the following experiments described.
Cytokine array and ELISA
Mouse splenocytes were cultured with Con A, rIFN-
, or media only for 24 h as indicated, after which cells were pelleted, and the supernatants were transferred to a clean tube. Supernatants were stored frozen until use. Cytokine arrays (Ray Biotech, Norcross, GA, USA) were performed according to the manufacturers instructions. The levels of MCP-5 and RANTES (R&D Systems, Minneapolis, MN, USA) and MCP-1 (Endogen, Rockford, IL, USA) were determined using ELISA kits according to the manufacturers instructions.
SearchLight chemokine array
Mouse splenocytes were cultured in Con A or in media alone for 24 h, after which cells were pelleted, and the supernatants were transferred to a clean tube. Supernatants were stored frozen until use. SearchLight mouse chemokine arrays (Pierce Biotechnology, Inc., Rockford, IL, USA) were performed according to the manufacturers instructions and analyzed using a cooled, charged-coupled device camera. In selected studies, kinetic analysis of chemokine levels was determined by culturing Con A-activated cells for 3, 6, and 18 h. Pierce Biotechnology (Woburn, MA, USA) analyzed the kinetic samples.
Western blot analysis for chemokine receptors
Western blots were performed according to our procedures reported previously [33
]. Membranes were incubated with a polyclonal antibody specific to CCR1 (1:4000), CCR2 (1:500), CCR4 (1:1000), or ß-actin (1:8000), diluted in TBS with 0.1% Tween-20 and 5% dried, nonfat milk overnight at 4°C on a shaking platform. Antibodies reactive against CCR1, CCR4, and ß-actin were purchased from Abcam (Cambridge, MA, USA). Antibodies reactive against CCR2 were purchased from GenWay Biotech (San Diego, CA, USA). Membranes were developed using ECL-Plus reagents (Amersham, Piscataway, NJ, USA). Bands were visualized using a Kodak Image Station 440CF.
RNA isolation
RNA was isolated from murine splenocytes (510x106 cells per sample) using TRI Reagent (Molecular Research Center, Inc., Cincinnati, OH, USA) according to the manufacturers instructions. RNA pellets were resuspended in RNase-free water, quantitated using a RiboGreen RNA quantitation kit (Molecular Probes, Eugene, OR, USA), according to the manufacturers instructions, and stored at 80°C until use.
Real-time PCR
Total RNA (500 ng) was used in each reaction. RT and PCR reactions were performed using the QuantiTect SYBR Green RT-PCR kit (Qiagen, Valencia, CA, USA), according to the manufacturers instructions. Real-time PCR was carried out on an iCycler machine (BioRad, Hercules, CA, USA) programmed for 40 cycles of 95°C for 20 s, 58°C for 30 s, and 72°C for 45 s. Primers used were as follows: CCR1: 5'tcttctttatcatcctgttgacgattg 3'gagtaatagcaaatatcagacgcacgg; CCR2: 5'cattaccattctgggctcactatgctg 3'agcaaacacagcatgaacaatagcca; CCR3: 5'ctggtgttcatcatcggcctcct 3'ttcgggctcgaagggcaaac; CCR4: 5'caccaaggaaggtatcaaggcat 3'gctgtagaagcccaccaggtacatc; RANTES: 5'tcaccatatggctcggacacca 3'tgaacccacttcttctctgggttgg; ß-actin: 5'tggaatcctgtggcatccatgaaac 3'taaaacgcagctcagtaacagtccg; MCP-1: 5'tcatgcttctgggcctgctg 3'tctcatttggttccgatccaggtt; and MCP-5: 5'ccacacttctatgcctcctg 3'gctgcttgtgattctcctgt.
Statistical analysis
Statistical analysis was performed using InStat statistical software (GraphPad InStat Version 3.0). Two-tailed Students t-tests or one-way ANOVA and the Tukey-Kramer multiple comparisons tests were used as appropriate to assess the statistical validity of estrogen-induced changes in chemokine expression. All values are expressed as mean and SEM.
|
|
|---|
![]() View larger version (36K): [in a new window] |
Figure 1. MCP-1 and MCP-5 expression by splenocytes from placebo- or estrogen-treated mice cultured for 24 h with Con A (10 µg/mL) or media only. (A) Supernatants from Con A-activated cells were collected for use in a chemiluminescent cytokine array. Solid boxes show duplicate spots for MCP-1. Dashed boxes show duplicate spots for MCP-5. Dotted boxes show positive controls, which are located in the left upper-hand corner and the right lower-hand corner of each blot. The blot shown is representative of five. (B) Graphical representation of the net intensities of the boxed spots shown in A, normalized to the positive control spots, is given and demonstrates marked up-regulation of MCP-1 and MCP-5 by estrogen. The levels of MCP-1 (C) and MCP-5 (E; n=15 each for MCP-1; n=11 each for MCP-5) or with media alone (n=9 each for MCP-1 and MCP-5) were increased significantly (****, P<0.0001; ***, P<0.001; **, P<0.01) in Con A-stimulated samples from estrogen-treated mice, as demonstrated by ELISA. SearchLight results are shown for MCP-1 (D) and MCP-5 (F; MCP-1: n=7 placebo, n=6 estrogen, P=0.0006; MCP-5: n=7 placebo, n=6 estrogen, P=0.0052). Gene expression is shown (G).
|
![]() View larger version (16K): [in a new window] |
Figure 2. RANTES expression by splenocytes from placebo- or estrogen-treated mice cultured for 24 h with Con A (10 µg/mL) or media only. Results from ELISA (A; n=10) and SearchLight (B; n=6 placebo; n=3 estrogen; P=0.3887) assays suggest that estrogen treatment does not alter levels of RANTES in supernatants.
|
![]() View larger version (23K): [in a new window] |
Figure 3. Eotaxin, SDF-1ß, TARC, and KC expression by splenocytes from placebo- or estrogen-treated mice cultured for 24 h with Con A (10 µg/mL). Eotaxin (A) and SDF-1ß (B) were increased in supernatants from Con A-stimulated splenocytes from estrogen-treated mice (eotaxin: n=6 each, P=0.0354; *, P<0.05; SDF-1ß: n=7 placebo, n=6 estrogen, P=0.0098; **, P<0.01). TARC (C; n=7 placebo; n=6 estrogen) appeared to be down-regulated slightly (but not significantly; P=0.4498) in estrogen-treated mice, and no change was observed in KC expression (D; n=7 each; P=0.9987).
|
![]() View larger version (20K): [in a new window] |
Figure 4. Kinetic analysis of MCP-1, MCP-5, RANTES, eotaxin, SDF-1ß, TARC, and KC expression in splenocytes from placebo- or estrogen-treated mice (n=4 each), cultured for 3, 6, and 18 h with Con A (10 µg/mL) or media only, demonstrated that chemokines were expressed at low levels initially, but they tended to increase with stimulation time. Estrogen showed a nonsignificant trend of increasing the expression of MCP-1 (A) and MCP-5 (B) with time. Expression of RANTES (C) and TARC (F) increased with time. However, neither RANTES nor TARC was up-regulated significantly in splenocytes from estrogen-treated mice compared with placebo-treated mice 3, 6, or 18 h. A nonsignificant, increasing trend was observed for estrogen induction of eotaxin (D). SDF-1ß was not altered significantly by estrogen at 3, 6, or 18 h (E). Estrogen tended to decrease expression of KC at 6 and 18 h (G). The decrease in KC expression was significant at 18 h (P<0.001).
|
![]() View larger version (58K): [in a new window] |
Figure 5. Chemokine receptor expression by splenocytes from placebo (P)- or estrogen (E)-treated mice cultured for 24 h with Con A (10 µg/mL) or media only. Neither CCR1 (A) nor CCR2 (B) showed a difference in protein expression between estrogen and placebo mice. Gene expression (C) for CCR1, CCR2, CCR3, and CCR4.
|
Chemokine regulation by estrogen is mediated by IFN-
Other studies, using nonlymphocytic cells, have shown that IFN-
regulates MCP-1 or MCP-5. For example, it has been demonstrated in a human osteoblastic cell line that IFN-
stimulates transcription of MCP-1 [37
]. Another study showed that treatment with IFN-
selectively enhanced the LPS-induced gene expression of MCP-5 in murine macrophage cultures and inhibited LPS-induced expression of MCP-1 and KC [3
]. As we have shown that estrogen treatment of wild-type mice increases the secretion of IFN-
and expression of other IFN-
-inducible, proinflammatory molecules such as inducible NO synthase and cyclooxygenase-2 in activated splenocyte cultures [32
], we decided to examine the role of IFN-
in the estrogen regulation of the selected CC chemokines. IFN-
null mice (IFN-
/) were treated with estrogen or empty placebo implants. Splenocytes from these mice were cultured for 24 h with media, Con A, or Con A supplemented with rIFN-
, after which, culture supernatants were collected and examined by ELISA for chemokine expression. It is interesting that unlike in the wild-type mice (Fig. 1)
, estrogen did not up-regulate the levels of MCP-1 (n=8) and MCP-5 (n=6) in supernatants from Con A-activated splenocyte cultures derived from IFN-
/ mice (Fig. 6
). However, with the addition of rIFN-
, the levels of MCP-1 and MCP-5 increased significantly (****, P<0.0001) but only in samples from estrogen-treated mice (Fig. 6A
and 6B)
. This implies that estrogen treatment of mice in vivo may prime the immune system to respond differently to subsequent exposure to IFN-
. This is a unique finding, demonstrating that a natural, endogenous, soluble substance (i.e., estrogen) can alter the response behavior of splenocytes to IFN-
.
![]() View larger version (13K): [in a new window] |
Figure 6. MCP-1 and MCP-5 expression by splenocytes from placebo- or estrogen-treated IFN- / mice cultured for 24 h with Con A (10 µg/mL) alone, Con A plus rIFN- (10,000 pg/mL), or media only. Estrogen did not up-regulate the levels of MCP-1 (A; n=8) and MCP-5 (B; n=6) in supernatants from Con A-activated splenocyte cultures derived from IFN- / mice, except upon addition of rIFN- and then, only in samples from estrogen-treated mice (****, P<0.0001).
|
|
|
|---|
plays a role in up-regulation of MCP-1 and MCP-5. Results shown here for IFN-
knockout mice show that both of these chemokines are up-regulated significantly at 24 h in estrogen-treated mice upon addition of rIFN-
.
In addition to the above two chemokines, estrogen treatment enhanced secretion of eotaxin and SDF-1ß by activated splenocytes after 24 h of culture with Con A. Our studies about estrogen-induced up-regulation of SDF-1ß secretion by splenocytes are in agreement with estrogen-induced up-regulation of SDF-1ß in breast and ovarian cancer cell lines as well as monkey mammalian epithelial cells [18
, 42
]. In these latter studies, estrogen-induced SDF-1ß is mediated via ER-
. It is likely that a similar mechanism may be operative in splenocytes as well, an aspect that will be investigated in future studies. Our findings of estrogen-induced up-regulation of eotaxin secretion by splenocytes are in agreement with similar findings in rat prostate cells [17
] but differ from studies in preovulatory cells, where estrogen was shown to inhibit eotaxin [43
]. These differences in estrogen up-regulation of eotaxin suggest that estrogen has differential effects on eotaxin secretion in diverse cell types.
We found that other chemokines were unchanged by estrogen treatment. We did not observe a noticeable effect of estrogen on KC secretion by activated splenocytes at 24 h of stimulation. Our findings are analogous to those reported previously, where no difference was found between lung samples from ovary-intact and ovariectomized mice [19 ]. However, one study [13 ] reported that estrogen up-regulated KC mRNA in mouse uterine tissue. The differences in the results reported in the study about uterine tissue and those reported in our present work with splenocytes and those in lung tissues [19 ] may be a result of differences in the types of tissues and in the end-point examined (mRNA in uterine tissue vs. protein in splenocytes). Furthermore, we observed no change in TARC expression at 24 h following estrogen treatment. Unlike results reported for immature DC [16 ], we did not observe an increase in TARC with estrogen exposure. The discrepancy may be a result of differences in experiment design such as in vitro versus in vivo estrogen treatment, stimulation with LPS versus Con A, or the use of purified DC versus mixed splenocyte populations.
Similar to TARC and KC, RANTES remained unaltered in the work reported here in splenocytes from estrogen-treated mice compared with placebo controls. However, studies in keratinocytes demonstrated a decrease in RANTES following in vitro exposure to estrogen [15
]. These results differ with those presented here, as we did not observe an estrogen-mediated change in RANTES expression by splenocytes at any of the culture time-points tested. The variance may be a result of differences in tissues, the different routes of exposure (in vitro vs. in vivo), distinctive types of stimulation (TNF-
vs. Con A), or variation in ER signaling between the two cell types. For example, keratinocytes only express ER-ß. Expression of only one form of the ER in keratinocytes likely results in different signaling compared with what occurs in immune cells, which may express ER-
and ER-ß. Our results are aligned with those reported for preovulatory rat ovary tissue, where RANTES remained relatively unchanged upon treatment with human chorionic gonadotropin [43
]. Therefore, it is likely that estrogen has different immunological effects in diverse tissues within the same individual [22
, 25
].
The kinetic analysis of chemokines at time-points earlier than 24 h of culture revealed that the chemokines studied are expressed only at low levels following 3 h of stimulation with Con A. Generally, the chemokines tended to increase with stimulation time. MCP-1 and MCP-5 demonstrated nonsignificant, increasing biological trends in splenocytes from estrogen-treated mice. Estrogen appears to prime splenocytes, which when activated, differentially release these chemokines. The expression of RANTES, eotaxin, SDF-1ß, and TARC increased with culture time, but there was no difference in the increase observed for estrogen- and placebo-treated mice at 3, 6, or 18 h. Only KC was decreased significantly at an early time-point (18 h) in splenocytes from estrogen-treated mice. It is plausible that the levels of chemokines may be altered differentially in splenocytes from estrogen-treated mice cultured at time-points beyond 24 h.
Female C57BL/6 mice have been reported to have significant increases in CCR1-CCR5 RNA expression on CD4+ T cells compared with male mice [44 ]. Female AKR mice treated in vivo with estrogen following oophorectomy have been shown to have increased CCR1CCR5 RNA expression compared with their controls. Aged C57BL/6 female mice were found to have significant increases only in CCR1, CCR3, and CCR4 [44 ]. In vitro estrogen treatment of monocytes from C3H mice was shown to result in decreased CCR1 and CCR2 surface receptors [10 ]. These results differ somewhat from those reported here, as we did not observe a change in CCR24 mRNA nor did we observe increased protein expression of CCR1 and CCR2. These differences may be a result of differences in experimental models (monocytes vs. splenocytes; C3H mice vs. C57BL/6 mice). However, we did measure a 5.7-fold increase in CCR1 mRNA in estrogen-treated mice compared with placebo-treated mice.
Overall, our studies are the first to show that estrogen selectively regulates the release of chemokines by activated splenocytes. In particular, we noticed that upon activation, estrogen treatment primes splenic lymphocytes to markedly induce MCP-1, MCP-5, eotaxin, and SDF-1ß. It had minimal to no effects on RANTES, TARC, and KC. The precise reasons for these differential effects of estrogen on chemokines are not known. The chemokines studied in this report may be affected differentially by the two major ERs, ER-
and ER-ß. We plan to study this potential mechanism using ER-
, ER-ß, and ER-
ß double-knockout mice as well as small interfering RNA gene-silencing strategies. Our novel findings, regarding the selective effects of estrogen on chemokines, shed new light onto estrogen regulation of proinflammatory molecules and have profound implications to immunity, inflammation, and autoimmunity.
Received June 9, 2006; revised November 10, 2006; accepted December 1, 2006.
|
|
|---|
and MCP-1/JE in mammary tumor formation Endocrine 22,161-168[CrossRef][Medline]
and IL-1ß Clin. Immunol. 115,162-172[CrossRef][Medline]
, and Lupus (Chapter 14) Kluwer Academic/Plenum New York, NY, USA.
expression in hematopoietic cells Eur. J. Immunol. 33,512-521[CrossRef][Medline]
and the sexual dimorphism of autoimmunity Mol. Biol. Med. 7,323-331[Medline]
Endocrinology 147,662-671[CrossRef][Medline]
, IL-2 and IL-4 gene expression and protein synthesis in spleen and thymus of normal C57BL/6 mice Cytokine 14,208-217[CrossRef][Medline]
-stimulated monocyte chemoattractant protein-1 gene transcription J. Immunol. 161,3719-3728
(MIP-1
) in human endometrium throughout the menstrual cycle Br. J. Obstet. Gynaecol. 106,725-730[Medline]
and targets of estrogen receptor action in proliferating monkey mammary epithelial cells Breast Cancer Res. 8,R10[CrossRef][Medline]This article has been cited by other articles:
![]() |
R. Dai, R. A. Phillips, E. Karpuzoglu, D. Khan, and S. A. Ahmed Estrogen Regulates Transcription Factors STAT-1 and NF-{kappa}B to Promote Inducible Nitric Oxide Synthase and Inflammatory Responses J. Immunol., December 1, 2009; 183(11): 6998 - 7005. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Karpuzoglu, R. A. Phillips, R. Dai, C. Graniello, R. M. Gogal Jr., and S. A. Ahmed Signal Transducer and Activation of Transcription (STAT) 4{beta}, a Shorter Isoform of Interleukin-12-Induced STAT4, Is Preferentially Activated by Estrogen Endocrinology, March 1, 2009; 150(3): 1310 - 1320. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Dai, R. A. Phillips, Y. Zhang, D. Khan, O. Crasta, and S. A. Ahmed Suppression of LPS-induced Interferon-{gamma} and nitric oxide in splenic lymphocytes by select estrogen-regulated microRNAs: a novel mechanism of immune modulation Blood, December 1, 2008; 112(12): 4591 - 4597. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Pioli, A. L. Jensen, L. K. Weaver, E. Amiel, Z. Shen, L. Shen, C. R. Wira, and P. M. Guyre Estradiol Attenuates Lipopolysaccharide-Induced CXC Chemokine Ligand 8 Production by Human Peripheral Blood Monocytes J. Immunol., November 1, 2007; 179(9): 6284 - 6290. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||