Accuri C6 Flow Cytometer System
Originally published online as doi:10.1189/jlb.0706433 on November 30, 2006

Published online before print November 30, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.0706433v1
81/3/818    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sroussi, H. Y.
Right arrow Articles by Palefsky, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sroussi, H. Y.
Right arrow Articles by Palefsky, J. M.
(Journal of Leukocyte Biology. 2007;81:818-824.)
© 2007 by Society for Leukocyte Biology

Oxidation of methionine 63 and 83 regulates the effect of S100A9 on the migration of neutrophils in vitro

Herve Y. Sroussi*,1, Jennifer Berline{dagger} and Joel M. Palefsky{dagger}

* Department of Oral Medicine and Diagnostic Sciences, College of Dentistry, University of Illinois at Chicago, Chicago, Illinois, USA; and
{dagger} Department of Medicine, School of Medicine, University of California, San Francisco, California, USA

1 Correspondence: UIC College of Dentistry (M/C 838), 801 S. Paulina St., Room 556, Chicago, IL 60612-7213, USA. E-mail: sroussih{at}uic.edu


arrow
ABSTRACT
 
The calcium-binding proteins S100A8 and S100A9 and their heterocomplex calprotectin are abundant cytosolic constituents in human neutrophils, constitutively expressed by mucosal epithelium and in association with inflammation by epidermal keratinocytes. S100A8 and S100A9 are pleiotropic proteins, which partake in the regulation of leukocyte migration. This study was designed to investigate the effect of S100A9 on neutrophil migration and to explore the mechanisms that regulate this effect. Based on previous results with S100A8, we hypothesized that S100A9 repels neutrophils and that oxidation of S100A9 regulates this function. Using standard Transwell chemotaxis assays and site-directed mutagenesis, we show that S100A9 exerts a chemo-repulsive (fugetactic) effect on peripheral neutrophils, an effect abolished by oxidation of S100A9. After substitution of methionine 63 and 83 for alanine, S100A9 maintained its fugetaxis activity, even in inhibitory, oxidative conditions. Together, the data suggest that S100A9 serves as a molecular switch for oxidative control of inflammation regulated by the oxidation of species-conserved methionine residues. In healthy mucosal tissue, expression of S100A9 by the epithelium may serve to inhibit leukocyte recruitment. However, conditions of oxidative stress, including infection and overgrowth of opportunistic pathogens, may abrogate this activity by neutralizing S100A9 as a result of its oxidative alteration.

Key Words: calprotectin • chemotaxis • fugetaxis


arrow
INTRODUCTION
 
The inflammatory response to tissue injury or infection is characterized by the recruitment of immune response cells from the circulation. This recruitment entails the guided migration of the cells in the extravascular space. Cell movement is guided by gradients of attractant molecules such as chemokines [1 , 2 ]. The effect of chemokines is thought to occur by two parallel mechanisms: enhanced random migration (chemokinesis) and cell movement along a chemical gradient (chemotaxis). Although chemokines generally function as chemoattractants, they may also inhibit migration or even repel leukocytes in a process termed "fugetaxis" [3 ]. The effect of chemokines on leukocyte migration is concentration-dependent, as at concentrations exponentially greater than their chemotactic concentrations, chemokines may also inhibit this migratory process or repel leukocytes [3 ]. Current evidence suggests that fugetaxis may be involved in thymocyte migration in vivo [4 ].

In recent years, innate immunity proteins have been shown to participate in the regulation of leukocyte trafficking, in addition to their documented antimicrobial activity [5 ]. Calprotectin, a protein complex composed of two calcium-binding proteins, S100A8 and S100A9, is constitutively expressed by cells of the innate immune system. Calprotectin represents 45% of neutrophil cytosolic protein weight [6 ] and is induced in epithelial cells in association with stress conditions [7 ]. Calprotectin is found in high concentrations in body fluids such as saliva and serum. Its concentration rises significantly in association with inflammatory conditions [8 9 10 ].

The role of S100A9 in inflammation remains elusive. A gene deletion study of S100A9 has shown that although their calcium flux response to chemokines is impaired [11 ], neutrophils from S100A9–/– mice are capable of chemotactic responses to chemokines, albeit at a reduced level [12 ]. It is unclear whether S100A9 has proinflammatory or anti-inflammatory activities. Although some have reported that S100A9 (and S100A8) is chemotactic to neutrophils [13 ], others have failed to show a similar activity [14 ], and there are concerns that the chemotactic concentrations reported may be too low to be physiologically relevant [15 ]. On the one hand, an increased expression and concentration in association with inflammation would infer a proinflammatory activity, but conversely, an increased expression in synovial membranes of rheumatoid arthritis patients treated with immunosuppressants [16 ] would suggest the opposite.

The mechanism for a S100A9 anti-inflammatory effect is proposed by some to be related to the homology between the C-terminal of S100A9 and the neutrophil-immobilizing factors (NIF) [17 ]. Others have proposed that S100A9 may act to decrease neutrophil phagocytosis and spreading through its HXXXH divalent, cation-binding domain, also found in the S100A9 C-terminal [18 ]. In addition to S100A8 and S100A9, other S100 proteins affect leukocyte migration. Bovine S100A2 and S100A7 (psoriasin) are chemotactic for guinea pig eosinophils and for CD4+ T lymphocytes and neutrophils, respectively [19 ] [20 ]. Lackmann et al. [21 ] described chemotactic activity for the murine homologue of S100A8. Our previous work has documented the fugetactic effect of S100A8 on peripheral neutrophils and demonstrated the ability of S100A8 to act as an anti-inflammatory molecule in vivo [22 ]. Analogous to a report from Harrison et al. [23 ] with murine S100A8, we found that oxidation regulates the effect of human S100A8 on neutrophil migration [22 ]. Substitution to alanine of an interspecies-conserved cysteine conferred functional resistance to oxidation for the chemotactic effect noted by Harrison et al. [23 ] and the fugetactic and anti-inflammatory effect noted in our previous work.

In the present work, we investigated the effect of S100A9 on neutrophil migration and explored the mechanism of the oxidative regulation of S100A9. We hypothesized that S100A9 shared the fugetactic and oxidation sensitivity of S100A8.


arrow
MATERIALS AND METHODS
 
Production and purification of mutant S100A9 proteins
Top10f' Escherichia coli cells (Invitrogen, Carlsbad, CA) transfected with a pGEX2T S100A9 construct were used for production of full-length S100A9. Standard GST protocols from Amersham (Piscataway, NJ) were followed as described previously [24 ]. The sequence of the full-length S100A9 insertion into the pGEX2T vector was confirmed through sequencing. Protein identity was confirmed by its apparent molecular weight on SDS-PAGE after Coomassie blue staining. Wild-type (WT) and mutated S100A9 proteins were also detected by Western blotting using a commercially available mAb for S100A9 (MAC-387 from BMA Biomnedical, Augst, Switzerland). The endotoxin level in the recombinant proteins was below 1 ng/µg S100A9 protein, as measured by limulus amoebocyte lysate assay (Associates of Cap Cod, Falmouth, MA).

Generation of point-directed mutations in WTS100A9
A construct of a pGEX2T vector (Amersham) encoding the GST-WTS100A9 fusion protein was described previously elsewhere [24 ]. The construct was digested with BglII (Roche, Indianapolis, IN) and EspI (MBI Fermentas, Hanover, MD) for 2 h at 37°C. The vector was separated from an ~90-bp double-stranded oligonucleotide by electrophoresis through 2% agarose. The upper band was purified using a Qiagen (Valencia, CA) gel purification kit according to the manufacturer’s recommended protocol. Two synthetic oligonucleotides (Sigma-Aldrich, St. Louis, MO) replaced the oligonucleotide with an identical sequence, except for substitution of methionine 63 by alanine (5'GATCTGCAAAATTTTCTCAAGAAGGAGAATAAGAATGAAAAGGTCATAGAACACACATCG-CCGAGGACCTGGACACAAATGCAGACAAGCAGC3' and 5'TCAGCTGCTTGTCTGCATTTGTGTCCAGGTCCTCGGCGATGTGTTCTATGACCTTTT-CATTCTTATTCTCCTTCTTGAGAAAATTTTGCA3'). The oligonucleotides were annealed and ligated to the linearized, gel-purified construct with T4 DNA ligase (Roche) and incubated overnight at 14°C. The final sequence of the protein-encoding region of the construct was confirmed with DNA sequencing.

Combinatorial mutations of methionine 81 and 83
Mutant S100 proteins were generated with a protocol that involved cut-and-paste constructs and PCR with mismatch primers, in which the desired point-directed mutation was inserted into one of the two PCR primers. Briefly, pGEX2T vectors containing WTS100A9 or Ala63S100A9 inserts were digested with EspI (MBI Fermentas) and AspI (Roche) for 2 h at 37°C. Vectors were separated from a 342-bp oligonucleotide, and the upper band was purified using a Qiagen gel purification kit with the standard protocol recommended by the manufacturer. The PCR products were obtained using a WTS100A9 construct as template and primers 5'TACGTGACTGGGTCATGGCTGCGCCCCGACAC3' in combination with one of three primers containing the mismatched oligonucleotides: 5'CAGCTGAGCCTTCGAGGAGTTCATCGCGCTGATGGCG3', 5'CAGCTGAGCCTTCGAGGAGTTCTCATGCTGGCGGCG3', and 5'CAGCTGAGCCTTCGAGGAGTTCATCGCGCTGGCGGCG3'.

The PCR products were digested with EspI and AspI for 2 h at 37°C, separated on 2% agarose gel, and purified as described previously. The three distinct PCR products were then ligated overnight as described above into the original digested vector. DNA sequencing of the whole protein-coding sequences confirmed every point-directed mutation.

Transwell migration assays
EDTA-anticoagulated whole blood from healthy volunteers was the source of peripheral neutrophils in a protocol approved by the Institutional Review Board at the University of California (San Francisco). Neutrophils were separated on Histopaque 1119 and 1077. RBCs were lysed using hypotonic shock. Purified neutrophils (>95%) were resuspended in RPMI 0.5% BSA at a concentration of 1 million cells per ml. RPMI (100 µl; 100,000 neutrophils) was placed in the upper chamber of a Transwell apparatus (6.5 mm, 3 µm pore, polycarbonate membrane, Corning Costar Inc., Corning, NY). The cells were incubated at 37°C in 5% CO2 for 3 h. Cells, which migrated from the upper to the lower chamber through the filter, were collected and counted using flow cytometry and/or a hemocytometer. A migration ratio was calculated by dividing the number of cells counted in the lower well by the mean number of cells counted in the lower wells of the negative controls in which no chemokines were added.

In some assays, we examined the effect of oxidation upon cell migration. Sodium hypochlorite (NaOCl) is an inorganic, oxidizing agent implicated in inflammation. OCl is generated by myeloperoxidase in neutrophils [25 ] and hence, constitutes a potentially relevant source of reactive oxygen encountered by S100A9 in vivo. Oxidation of S100A9 was performed using 10 µM NaOCl, as shown previously by Harrison et al. [23 ], to inhibit the chemotactic effect of murine S100A8.

Determination of neutrophil cell shape by flow cytometry
Flow cytometry was performed using a protocol modified from Sabroe et al. [26 ]. Neutrophils were isolated as before and resuspended in RPMI with 0.5% BSA at a concentration of 106 cells/ml. Cells were incubated at 37°C for 30 min in a water bath. Cell suspension (90 µl) was then added to polypropylene tubes (Falcon #352052, Fisher Scientific, Pittsburgh, PA) containing 10 µl different chemokines and proteins. Following a 4-min incubation in a 37°C water bath, samples were fixed by the addition of 250 µl of an ice-cold fixative comprising a 1/4 dilution of 1x Cellfix (Becton Dickinson, San Jose, CA) formaldehyde solution in PBS. Cell size was measured by cytometric analysis performed on a FACScan flow cytometer (Becton Dickinson). Changes in forward scatter (FSC) were used to measure shape change in response to chemokines as described previously [26 ].

Data analysis
Data were expressed as mean ± SEM. Statistical analysis was performed using the Student’s t-test. P < 0.05 was considered statistically significant.


arrow
RESULTS
 
Fugetactic effects of S100A9
In the initial set of experiments, we measured the ability of S100A9 to stimulate movement of neutrophils in the Transwell chemotaxis assay. S100A9 was added to the upper or lower chambers of the Transwell to trigger a fugetactic or chemotactic response, respectively (Fig. 1A ). No chemotaxis response was noted with S100A9, despite a clear, dose-sensitive response to the chemokine IL-8, which served as positive control. When S100A9 was added to the upper wells, a reproducible and significant increased migration of the neutrophils was detected (Fig. 1A) . Additional assays were conducted by adding S100A9 in the upper, lower, or in both wells at the concentration with the greatest fugetactic response (10–9 M). In support of a specific fugetaxis effect rather than a chemokinetic effect, no increased migration of neutrophils was noted by the addition of S100A9 at equal concentration in the lower and upper chamber (Fig. 1B) . S100A9-driven fugetaxis was found to be PTX-sensitive (Fig. 1C) .


Figure 1
View larger version (25K):
[in this window]
[in a new window]

 
Figure 1. Transwell migration assays of peripheral neutrophils. (A) Migratory response of neutrophils to S100A9 in the upper or lower chamber of Transwells. One hundred microliters, representing 0.1 million cells, was placed in the upper chamber of a Transwell assay system. Cells that migrated to the lower chambers were counted using flow cytometry. S100A9 was introduced in lower or upper chambers of the Transwell assay at different concentration. The data represent the average of three experiments conducted in duplicate. (B) Partial checkerboard experiment. S100A9 was introduced in the lower, upper, or in both chambers of the Transwell assays at a concentration of 10–9 M. The data represent the average of four experiments performed in duplicate. (*, P≤0.01, compared with control with no chemokine added.) (C) Effect of pertussis toxin (PTX) on neutrophil fugetaxis and chemotaxis. Fugetaxis to S100A9 and chemotaxis to IL-8 were tested following the exposure of neutrophils to different concentrations of PTX. The data represent the average of two experiments conducted in duplicate. (*, P≤0.01, when compared with the migration ratio with no PTX.) (D) Transwell chemotaxis migration of peripheral neutrophils; effect of oxidation on fugetaxis of WTS100A9, which was added to the upper well of the Transwells at a concentration of 10–9 M. Sensitivity of WTS100A9 was tested by exposing the protein to 10 µM OCl for 30 min on ice. A similar concentration of OCl was tested for control. The data represent the average of three experiments performed in duplicate. (*, P≤0.01, compared with untreated, negative control.)

Oxidation of S100A9 causes a loss of fugetactic activity and an irreducible change in electrophoretic mobility
We next examined the effect of oxidation upon fugetaxis. S100A9 was incubated with 10–5 M NaOCl on ice for 30 min and tested for its fugetaxis effect. The data showed that oxidation of S100A9 led to a loss of fugetaxis activity (Fig. 1D) .

In the absence of oxidation, human S100A9 was observed to exist in solution as a mixture of monomers, dimers, trimers, and tetramers (Fig. 2A ). Oxidation of S100A9 with 10–5 M NaOCl caused a change in electrophoretic mobility of the four oligomeric structures. Reduction of S100A9 with 100 mM DTT postoxidation resulted in the formation of monomers but did not reverse the mobility change caused by OCl oxidation (Fig. 2A) . The irreversibility of OCl-induced changes in electrophoretic mobility with DTT suggested that oxidation may have resulted in transformation of methionine residues to nonreducible sulfones.


Figure 2
View larger version (27K):
[in this window]
[in a new window]

 
Figure 2. Effect of oxidation on the electrophoretic mobility of WTS100A9. (A) Western blot analysis of WTS100A9 oxidized with 10 µM NaOCl for 30 min on ice. The SDS-PAGE was run under nonreducing (Lanes 1 and 2) and reducing (Lanes 3 and 4) conditions. WTS100A9 was found to form several species: monomers, dimers, trimers, and tetramers (Lane 1). Oxidation with NaOCl caused a change-up in electrophoretic mobility of each species (Lane 2). Under reducing conditions, WTS100A9 was reduced to smaller oligomers (Lane 3), whereas the electrophoretic mobility change was not changed by reduction (Lane 4). (B) Effect of oxidation on the electrophoretic mobility of mutated S100A9 proteins. Coomassie stained 10% SDS-PAGE of WT (Lanes 1 and 2), Ala63S100A9 (Lanes 3 and 4), Ala6381S100A9 (Lanes 5 and 6), Ala6383S100A9 (Lanes 7 and 8), and Ala638183S100A9 (Lanes 9 and 10). S100A9 proteins were treated with water (Control) or 10 µM NaOCl for 30 min on ice, respectively. The mutant proteins exhibit a change-up in electrophoretic mobility, similar to what was observed with the WT proteins.

Characterization of mutant S100A9 proteins
The change in electrophoretic mobility of oxidized human S100A9 resembled electrophoretic patterns in the murine S100A9 protein exposed to similar experimental conditions [23 ]. Based on the hypothesis that S100A9 was oxidized irreversibly on species-conserved residues, we targeted the three conserved methionine residues (Met63, Met81, and Met83) shared by mouse, rat, and human S100A9 for site-directed mutagenesis (Fig. 3 ). Seven combinatorial, mutated S100A9 proteins, in which Met63, Met81, and/or Met83 were substituted with alanine, were produced and purified. Upon oxidation, the seven mutant proteins displayed a change in electrophoretic mobility similar to that observed with WT protein (Fig. 2B) . No differences in solubility between the different S100A9 proteins were noted prior to or after oxidation of the protein with OCl. Mutation of the three methionine residues, singly or in combination, failed to eliminate the irreversible change observed in SDS-PAGE (data not shown).


Figure 3
View larger version (19K):
[in this window]
[in a new window]

 
Figure 3. Interspecies sequence alignment of human (H), mouse (M), and rat (R) S100A9. The human protein has five or six methionine residues depending on alternative translation of the protein. Three of those residues are conserved between the species (boxed and in red), and three are not (in blue; data adapted from the EF-Hand Calcium-Binding Proteins Data Library, http://structbio.vanderbilt.edu/cabp_database).

Fugetaxis assays of combinatorial mutants of S100A9
The effect of WTS100A9 and its seven mutated variants on the movement of peripheral neutrophils was assayed in a Transwell migration system. WT and mutant proteins exhibited a similar fugetaxis effect on neutrophils (Fig. 4 ). WT or mutant proteins were treated with 10 µM NaOCl and tested for their fugetaxis activity on neutrophils. The S100A9 proteins with substitutions of alanine for Met63 and Met83 (Ala6383S100A9) preserved their fugetaxis effect under these conditions (Fig. 4) . WT proteins and proteins with single substitution of Met63 and/or Met83 had no fugetactic activity under these conditions. S100A9 mutants with substitutions of all three methionines (Ala638183S100A9) produced oxidation-resistant, fugetactic movement comparable with retrograde cell migrations induced by protein with Ala6383S100A9. The protein in which Met81 only was substituted behaved similarly to the WTS100A9 protein and displayed a similar sensitivity to NaOCl oxidation. For the PTX inhibition experiments, cells were preincubated with different concentrations of Bordetella PTX (Sigma-Aldrich) for 30 min at room temperature.


Figure 4
View larger version (17K):
[in this window]
[in a new window]

 
Figure 4. Transwell chemotaxis migration of peripheral neutrophils; effect of oxidation on the fugetaxis triggered by mutated S100A9 proteins. The data represent the average of three experiments performed in duplicate. S100A9 or mutant proteins were exposed to 10 µM NaOCl for 30 min on ice. The proteins were then added to the upper well of the Transwells at a concentration of 10–9 M. *, P ≤ 0.01 (compared with untreated, negative control).

Shape changes in neutrophils induced by S100A9 and mutants
Cell-shape changes triggered by a cytokine are consistent with chemotaxis activity [27 ]. To confirm that substitution of methionine 63 and 83 preserved the fugetactic effect of S100A9, cell-shape changes in neutrophils induced by WT and mutated S100A9 were measured by flow cytometry. Despite prior oxidation of the proteins, S100A9 mutants, in which Met63 and Met83 were substituted with alanine, caused an increase in FSC of neutrophils compared with untreated controls (Fig. 5 ). The results confirm that substitution of alanine for Met63 and Met83 protects the activity of S100A9 from inhibitory effects of oxidation. The cell-shape experiment supported the results of Transwell assays presented above, providing independent evidence that Met63 and Met83 are important in oxidative regulation of S100A9-induced fugetaxis in neutrophils.


Figure 5
View larger version (17K):
[in this window]
[in a new window]

 
Figure 5. Shape change assays of peripheral neutrophils: the effect of oxidized S100A9 protein. The data are representative data from one experiment out of three and conducted in triplicates. FSC is indicated as a percentage of the basal level. WTS100A9 and mutant S100A9 proteins were oxidized by incubation to 10 µM NaOCl for 30 min on ice. *, P ≤ 0.01 (compared with untreated, negative control).

Inhibition of fMLP-driven chemotaxis
Last, we determined the effect of WT and S100A9 mutants on chemotaxis induced by fMLP in neutrophils. fMLP, a bacterial tripeptide, exerts powerful chemoattractant effects on neutrophils, including chemotaxis and chemokinesis [28 ]. S100A9 mutants, in which alanine replaced Met63 and Met83, significantly inhibited the chemotaxis effect of fMLP (Fig. 6 ). Similarly, S100A9 proteins with a single mutation of Met63 inhibited the movement of neutrophils toward fMLP, albeit to a lesser extent.


Figure 6
View larger version (17K):
[in this window]
[in a new window]

 
Figure 6. Transwell chemotaxis assays of peripheral neutrophils: inhibition of fMLP by oxidized S100A9 protein. The data represent the average of three experiments performed in duplicate. WTS100A9 or mutant proteins were exposed to 10 µM NaOCl for 30 min on ice. fMLP was placed on its own or together with S100A9 (or one of the mutant S100A9 proteins) in the lower chamber at a concentration of 10–9 M. *, P ≤ 0.01; #, P ≤ 0.05 (compared with fMLP control).


arrow
DISCUSSION
 
The data presented herein show that S100A9 repelled neutrophils in standard chemotaxis assays and inhibited chemotaxis induced by fMLP, a potent chemotactic factor of bacterial origin. The fugetaxis effect of S100A9 on neutrophil migration was PTX-sensitive, supporting the activation of an {alpha}i trimeric guanosinetriphosphatase. The fugetaxis was also sensitive to the oxidation S100A9. Methionine residues conserved in humans, rats, and mice S100A9 mediated S100A9 sensitivity to oxidation. Substitutions of methionine 63 and 83 to alanine resulted in formation of an oxidation-resistant protein, as shown by three discrete sets of experiments: fugetaxis assays, cell-shape assays, and inhibition of fMLP-driven chemotaxis.

S100A9 molecules with methionine 63 and 83, substituted with alanine, retained their fugetactic effect and their ability to affect cell shape even after treatment with OCl. Substitution of methionine 63 to alanine was sufficient to preserve the antichemotactic effect of S100A9 on fMLP.

The antichemotactic activity of S100A9 on fMLP-driven fugetaxis is in agreement with the effect reported with NIF1 and NIF2 [17 ]. The homology between NIF1/NIF2 and the C-terminal of S100A9 [29 ] suggests that oxidation of methionine 63 and 83 may play a role in the neutrophil-immobilizing function of S100A9 by altering the conformation of its C-terminal.

The concentration of S100A9, which resulted in in vitro fugetaxis, was in the nanomolar range. Although this concentration is reported to be physiologically relevant in serum [30 ], the narrowness of the concentration range at which S100A9 exerts fugetactic activity invites further investigation into the biological relevance of S100A9 fugetaxis in inflammation. Our study did not confirm the chemotaxis activity of S100A9 observed by Ryckman et al. [13 ]. Chemotaxis was observed at subphysiological concentration [15 ], lower than the concentrations at which we documented fugetaxis. Nonetheless, our study together with that Ryckman et al. [13 ] suggest a dual chemotaxis, fugetaxis response at a lower and higher concentration of S100A9 as noted with other chemokines [31 ].

Whether S100A9 acts as a proinflammatory chemotactic agent, as an anti-inflammatory fugetactic agent, or both remains elusive. The apparent discrepancy between data supporting pro- or anti-inflammatory activities for S100A9 was not resolved by the null-mutation studies in mice [12 ], which did not display gross differences in inflammatory responses [12 ]. The data in this report support an anti-inflammatory function for S100A9. Whereas the expression and serum levels of S100A9 are shown to increase with inflammation, our report indicates that its function may be anti-inflammatory.

Similarities exist between the fugetactic effects of S100A9 and S100A8 [22 ], including the role of oxidation in inhibiting it. In addition to those functional similarities, S100A8 and S100A9 have been observed to form together a number of quaternary structures [32 ]. Calprotectin [33 ] and the cystic fibrosis antigen [34 ] are two examples of protein structures. The formation of calprotectin is biologically preferred over the formation of homogenous structures [35 ]. Although the heterocomplex formation is required for certain functions such as the transport of arachidonic acid [36 ] and the induction of NADPH oxidase [37 ], it also inhibits functions such as those associated with increased neutrophil adhesion [14 ]. Functional inhibition through heterocomplex formation complicates the interpretation of studies linking concentrations or expression of calprotectin with inflammatory states. Nonetheless, reports showing that the S100A8 and S100A9 proteins are present as individual proteins under certain inflammatory conditions [38 , 39 ] indicate that both proteins may act as separate entities, whatever those function(s) may be. Adding to the complexity of the regulation of S100A9 through heterocomplex formation with S100A8, an issue not studied in this work, gene deletion studies of S100A9 demonstrate the concomitant absence of S100A8 protein expression. This finding is remarkable in light of the lethal phenotype associated with S100A8 deletion [40 ].

Protein oxidation and particularly, methionine oxidation, has been associated previously with reduction or elimination of biological activity [41 42 43 ]. For example, oxidation is linked to a loss or gain in enzyme activity (e.g., {alpha}-1-antitrypsin/elastase) and to inhibition of protein function (e.g., fibrinogen/fibrin clotting). An additional example of a protein whose functions are regulated by oxidation is the inhibitory protein I{kappa}B{alpha}. The oxidation of a methionine at Position 45 in I{kappa}B{alpha} represents a mechanism regulating its function. Oxidation of Met45 in I{kappa}B{alpha} leads to a change in electrophoretic mobility similar to the one we observed upon oxidation of S100A9. Conversely, the substitution of all three interspecies-conserved methionine did not affect the electrophoresis of S100A9. We hypothesize that other nonconserved methionine residues may explain those findings or alternatively, one or more nonmethionine residues may also undergo nonreversible changes upon oxidation.

It is not clear how oxidation of specific methionine residues affects the biological activity of S100A9. Oxidation may destabilize peptide structure as reported with methionine oxidation of other proteins [41 ]. Substitution of methionine with alanine may protect S100A9 against oxidative destabilization of its structure [44 ].

Finally, as a consequence of the biologically relevant activities of S100A9, the mutants of S100A9 described in this work suggest a new class of agents, potentially applicable to targeted therapeutic attempts to down-regulate the immune response. Future studies with S100A9 factors in animal disease models may be of value to develop new categories of immune suppressants.

Received July 5, 2006; accepted November 2, 2006.


arrow
REFERENCES
 
    1
  1. Wilkinson, P. C. (1990) How do leucocytes perceive chemical gradients? FEMS Microbiol. Immunol. 2,303-311[Medline]
  2. 2
  3. Foxman, E. F., Campbell, J. J., Butcher, E. C. (1997) Multistep navigation and the combinatorial control of leukocyte chemotaxis J. Cell Biol. 139,1349-1360[Abstract/Free Full Text]
  4. 3
  5. Zlatopolskiy, A., Laurence, J. (2001) "Reverse gear" cellular movement mediated by chemokines Immunol. Cell Biol. 79,340-344[CrossRef][Medline]
  6. 4
  7. Poznansky, M. C., Olszak, I. T., Evans, R. H., Wang, Z., Foxall, R. B., Olson, D. P., Weibrecht, K., Luster, A. D., Scadden, D. T. (2002) Thymocyte emigration is mediated by active movement away from stroma-derived factors J. Clin. Invest. 109,1101-1110[CrossRef][Medline]
  8. 5
  9. Yang, D., Chertov, O., Bykovskaia, S. N., Chen, Q., Buffo, M. J., Shogan, J., Anderson, M., Schroder, J. M., Wang, J. M., Howard, O. M., Oppenheim, J. J. (1999) ß-Defensins: linking innate and adaptive immunity through dendritic and T cell CCR6 Science 286,525-528[Abstract/Free Full Text]
  10. 6
  11. Edgeworth, J., Gorman, M., Bennett, R., Freemont, P., Hogg, N. (1991) Identification of p8,14 as a highly abundant heterodimeric calcium binding protein complex of myeloid cells J. Biol. Chem. 266,7706-7713[Abstract/Free Full Text]
  12. 7
  13. Gabrielsen, T. O., Dale, I., Brandtzaeg, P., Hoel, P. S., Fagerhol, M. K., Larsen, T. E., Thune, P. O. (1986) Epidermal and dermal distribution of a myelomonocytic antigen (L1) shared by epithelial cells in various inflammatory skin diseases J. Am. Acad. Dermatol. 15,173-179[Medline]
  14. 8
  15. Lugering, N., Stoll, R., Kucharzik, T., Burmeister, G., Sorg, C., Domschke, W. (1995) Serum 27E10 antigen: a new potential marker for staging HIV disease Clin. Exp. Immunol. 101,249-253[Medline]
  16. 9
  17. Lugering, N., Stoll, R., Kucharzik, T., Schmid, K. W., Rohlmann, G., Burmeister, G., Sorg, C., Domschke, W. (1995) Immunohistochemical distribution and serum levels of the Ca(2+)-binding proteins MRP8, MRP14 and their heterodimeric form MRP8/14 in Crohn’s disease Digestion 56,406-414[Medline]
  18. 10
  19. Muller, F., Froland, S. S., Aukrust, P., Fagerhol, M. K. (1994) Elevated serum calprotectin levels in HIV-infected patients: the calprotectin response during ZDV treatment is associated with clinical events J. Acquir. Immune Defic. Syndr. 7,931-939
  20. 11
  21. McNeill, E., Conway, S. J., Roderick, H. L., Bootman, M. D., Hogg, N. (2006) Defective chemoattractant-induced calcium signaling in S100A9 null neutrophils Cell Calcium Epub ahead of print
  22. 12
  23. Hobbs, J. A., May, R., Tanousis, K., McNeill, E., Mathies, M., Gebhardt, C., Henderson, R., Robinson, M. J., Hogg, N. (2003) Myeloid cell function in MRP-14 (S100A9) null mice Mol. Cell. Biol. 23,2564-2576[Abstract/Free Full Text]
  24. 13
  25. Ryckman, C., Vandal, K., Rouleau, P., Talbot, M., Tessier, P. A. (2003) Proinflammatory activities of S100: proteins S100A8, S100A9, and S100A8/A9 induce neutrophil chemotaxis and adhesion J. Immunol. 170,3233-3242[Abstract/Free Full Text]
  26. 14
  27. Newton, R. A., Hogg, N. (1998) The human S100 protein MRP-14 is a novel activator of the ß 2 integrin Mac-1 on neutrophils J. Immunol. 160,1427-1435[Abstract/Free Full Text]
  28. 15
  29. Roth, J., Vogl, T., Sunderkotter, C., Sorg, C. (2003) Chemotactic activity of S100A8 and S100A9 J. Immunol. 171,5651[Free Full Text]
  30. 16
  31. Hsu, K., Passey, R. J., Endoh, Y., Rahimi, F., Youssef, P., Yen, T., Geczy, C. L. (2005) Regulation of S100A8 by glucocorticoids J. Immunol. 174,2318-2326[Abstract/Free Full Text]
  32. 17
  33. Watt, K. W., Brightman, I. L., Goetzl, E. J. (1983) Isolation of two polypeptides comprising the neutrophil-immobilizing factor of human leukocytes Immunology 48,79-86[Medline]
  34. 18
  35. Pagano, R. L., Sampaio, S. C., Juliano, L., Juliano, M. A., Giorgi, R. (2005) The C-terminus of murine S100A9 inhibits spreading and phagocytic activity of adherent peritoneal cells Inflamm. Res. 54,204-210[CrossRef][Medline]
  36. 19
  37. Komada, T., Araki, R., Nakatani, K., Yada, I., Naka, M., Tanaka, T. (1996) Novel specific chemtactic receptor for S100L protein on guinea pig eosinophils Biochem. Biophys. Res. Commun. 220,871-874[CrossRef][Medline]
  38. 20
  39. Jinquan, T., Vorum, H., Larsen, C. G., Madsen, P., Rasmussen, H. H., Gesser, B., Etzerodt, M., Honore, B., Celis, J. E., Thestrup-Pedersen, K. (1996) Psoriasin: a novel chemotactic protein J. Invest. Dermatol. 107,5-10[CrossRef][Medline]
  40. 21
  41. Lackmann, M., Rajasekariah, P., Iismaa, S. E., Jones, G., Cornish, C. J., Hu, S., Simpson, R. J., Moritz, R. L., Geczy, C. L. (1993) Identification of a chemotactic domain of the pro-inflammatory S100 protein CP-10 J. Immunol. 150,2981-2991[Abstract]
  42. 22
  43. Sroussi, H. Y., Berline, J., Dazin, P., Green, P., Palefsky, J. M. (2006) S100A8 triggers oxidation-sensitive repulsion of neutrophils J. Dent. Res. 85,829-833[Abstract/Free Full Text]
  44. 23
  45. Harrison, C. A., Raftery, M. J., Walsh, J., Alewood, P., Iismaa, S. E., Thliveris, S., Geczy, C. L. (1999) Oxidation regulates the inflammatory properties of the murine S100 protein S100A8 J. Biol. Chem. 274,8561-8569[Abstract/Free Full Text]
  46. 24
  47. Tugizov, S., Berline, J., Herrera, R., Penaranda, M. E., Nakagawa, M., Palefsky, J. (2005) Inhibition of human papillomavirus type 16 E7 phosphorylation by the S100 MRP-8/14 protein complex J. Virol. 79,1099-1112[Abstract/Free Full Text]
  48. 25
  49. Hazell, L. J., Baernthaler, G., Stocker, R. (2001) Correlation between intima-to-media ratio, apolipoprotein B-100, myeloperoxidase, and hypochlorite-oxidized proteins in human atherosclerosis Free Radic. Biol. Med. 31,1254-1262[CrossRef][Medline]
  50. 26
  51. Sabroe, I., Hartnell, A., Jopling, L. A., Bel, S., Ponath, P. D., Pease, J. E., Collins, P. D., Williams, T. J. (1999) Differential regulation of eosinophil chemokine signaling via CCR3 and non-CCR3 pathways J. Immunol. 162,2946-2955[Abstract/Free Full Text]
  52. 27
  53. Bryan, S. A., Jose, P. J., Topping, J. R., Wilhelm, R., Soderberg, C., Kertesz, D., Barnes, P. J., Williams, T. J., Hansel, T. T., Sabroe, I. (2002) Responses of leukocytes to chemokines in whole blood and their antagonism by novel CC-chemokine receptor 3 antagonists Am. J. Respir. Crit. Care Med. 165,1602-1609[Abstract/Free Full Text]
  54. 28
  55. Dalpiaz, A., Spisani, S., Biondi, C., Fabbri, E., Nalli, M., Ferretti, M. E. (2003) Studies on human neutrophil biological functions by means of formyl-peptide receptor agonists and antagonists Curr. Drug Targets Immune Endocr. Metabol. Disord. 3,33-42[CrossRef][Medline]
  56. 29
  57. Freemont, P., Hogg, N., Edgeworth, J. (1989) Sequence identity Nature 339,516[Medline]
  58. 30
  59. Hermani, A., Hess, J., De Servi, B., Medunjanin, S., Grobholz, R., Trojan, L., Angel, P., Mayer, D. (2005) Calcium-binding proteins S100A8 and S100A9 as novel diagnostic markers in human prostate cancer Clin. Cancer Res. 11,5146-5152[Abstract/Free Full Text]
  60. 31
  61. Poznansky, M. C., Olszak, I. T., Foxall, R., Evans, R. H., Luster, A. D., Scadden, D. T. (2000) Active movement of T cells away from a chemokine Nat. Med. 6,543-548[CrossRef][Medline]
  62. 32
  63. Teigelkamp, S., Bhardwaj, R. S., Roth, J., Meinardus-Hager, G., Karas, M., Sorg, C. (1991) Calcium-dependent complex assembly of the myeloic differentiation proteins MRP-8 and MRP-14 J. Biol. Chem. 266,13462-13467[Abstract/Free Full Text]
  64. 33
  65. Yui, S., Mikami, M., Yamazaki, M. (1995) Purification and characterization of the cytotoxic factor in rat peritoneal exudate cells: its identification as the calcium binding protein complex, calprotectin J. Leukoc. Biol. 58,307-316[Abstract]
  66. 34
  67. Andersson, K. B., Sletten, K., Berntzen, H. B., Dale, I., Brandtzaeg, P., Jellum, E., Fagerhol, M. K. (1988) The leucocyte L1 protein: identity with the cystic fibrosis antigen and the calcium-binding MRP-8 and MRP-14 macrophage components Scand. J. Immunol. 28,241-245[CrossRef][Medline]
  68. 35
  69. Hunter, M. J., Chazin, W. J. (1998) High level expression and dimer characterization of the S100 EF-hand proteins, migration inhibitory factor-related proteins 8 and 14 J. Biol. Chem. 273,12427-12435[Abstract/Free Full Text]
  70. 36
  71. Kerkhoff, C., Sorg, C., Tandon, N. N., Nacken, W. (2001) Interaction of S100A8/S100A9-arachidonic acid complexes with the scavenger receptor CD36 may facilitate fatty acid uptake by endothelial cells Biochemistry 40,241-248[CrossRef][Medline]
  72. 37
  73. Doussiere, J., Bouzidi, F., Vignais, P. V. (2002) The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils Eur. J. Biochem. 269,3246-3255[Medline]
  74. 38
  75. Goebeler, M., Roth, J., Burwinkel, F., Vollmer, E., Bocker, W., Sorg, C. (1994) Expression and complex formation of S100-like proteins MRP8 and MRP14 by macrophages during renal allograft rejection Transplantation 58,355-361[Medline]
  76. 39
  77. Frosch, M., Vogl, T., Waldherr, R., Sorg, C., Sunderkotter, C., Roth, J. (2004) Expression of MRP8 and MRP14 by macrophages is a marker for severe forms of glomerulonephritis J. Leukoc. Biol. 75,198-206[Abstract/Free Full Text]
  78. 40
  79. Passey, R. J., Williams, E., Lichanska, A. M., Wells, C., Hu, S., Geczy, C. L., Little, M. H., Hume, D. A. (1999) A null mutation in the inflammation-associated S100 protein S100A8 causes early resorption of the mouse embryo J. Immunol. 163,2209-2216[Abstract/Free Full Text]
  80. 41
  81. Vogt, W. (1995) Oxidation of methionyl residues in proteins: tools, targets, and reversal Free Radic. Biol. Med. 18,93-105[CrossRef][Medline]
  82. 42
  83. Brot, N., Weissbach, H. (1991) Biochemistry of methionine sulfoxide residues in proteins Biofactors 3,91-96[Medline]
  84. 43
  85. Bigelow, D. J., Squier, T. C. (2005) Redox modulation of cellular signaling and metabolism through reversible oxidation of methionine sensors in calcium regulatory proteins Biochim. Biophys. Acta 1703,121-134[Medline]
  86. 44
  87. Kim, Y. H., Berry, A. H., Spencer, D. S., Stites, W. E. (2001) Comparing the effect on protein stability of methionine oxidation versus mutagenesis: steps toward engineering oxidative resistance in proteins Protein Eng. 14,343-347[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
S. Y. Lim, M. J. Raftery, J. Goyette, K. Hsu, and C. L. Geczy
Oxidative modifications of S100 proteins: functional regulation by redox
J. Leukoc. Biol., September 1, 2009; 86(3): 577 - 587.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. C. Flanders, B. M. Ho, P. R. Arany, C. Stuelten, M. Mamura, M. O. Paterniti, A. Sowers, J. B. Mitchell, and A. B. Roberts
Absence of Smad3 Induces Neutrophil Migration after Cutaneous Irradiation: Possible Contribution to Subsequent Radioprotection
Am. J. Pathol., July 1, 2008; 173(1): 68 - 76.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.0706433v1
81/3/818    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sroussi, H. Y.
Right arrow Articles by Palefsky, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sroussi, H. Y.
Right arrow Articles by Palefsky, J. M.