Published online before print November 30, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
* Department of Oral Medicine and Diagnostic Sciences, College of Dentistry, University of Illinois at Chicago, Chicago, Illinois, USA; and
Department of Medicine, School of Medicine, University of California, San Francisco, California, USA
1 Correspondence: UIC College of Dentistry (M/C 838), 801 S. Paulina St., Room 556, Chicago, IL 60612-7213, USA. E-mail: sroussih{at}uic.edu
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: calprotectin • chemotaxis • fugetaxis
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In recent years, innate immunity proteins have been shown to participate in the regulation of leukocyte trafficking, in addition to their documented antimicrobial activity [5 ]. Calprotectin, a protein complex composed of two calcium-binding proteins, S100A8 and S100A9, is constitutively expressed by cells of the innate immune system. Calprotectin represents 45% of neutrophil cytosolic protein weight [6 ] and is induced in epithelial cells in association with stress conditions [7 ]. Calprotectin is found in high concentrations in body fluids such as saliva and serum. Its concentration rises significantly in association with inflammatory conditions [8 9 10 ].
The role of S100A9 in inflammation remains elusive. A gene deletion study of S100A9 has shown that although their calcium flux response to chemokines is impaired [11 ], neutrophils from S100A9–/– mice are capable of chemotactic responses to chemokines, albeit at a reduced level [12 ]. It is unclear whether S100A9 has proinflammatory or anti-inflammatory activities. Although some have reported that S100A9 (and S100A8) is chemotactic to neutrophils [13 ], others have failed to show a similar activity [14 ], and there are concerns that the chemotactic concentrations reported may be too low to be physiologically relevant [15 ]. On the one hand, an increased expression and concentration in association with inflammation would infer a proinflammatory activity, but conversely, an increased expression in synovial membranes of rheumatoid arthritis patients treated with immunosuppressants [16 ] would suggest the opposite.
The mechanism for a S100A9 anti-inflammatory effect is proposed by some to be related to the homology between the C-terminal of S100A9 and the neutrophil-immobilizing factors (NIF) [17 ]. Others have proposed that S100A9 may act to decrease neutrophil phagocytosis and spreading through its HXXXH divalent, cation-binding domain, also found in the S100A9 C-terminal [18 ]. In addition to S100A8 and S100A9, other S100 proteins affect leukocyte migration. Bovine S100A2 and S100A7 (psoriasin) are chemotactic for guinea pig eosinophils and for CD4+ T lymphocytes and neutrophils, respectively [19 ] [20 ]. Lackmann et al. [21 ] described chemotactic activity for the murine homologue of S100A8. Our previous work has documented the fugetactic effect of S100A8 on peripheral neutrophils and demonstrated the ability of S100A8 to act as an anti-inflammatory molecule in vivo [22 ]. Analogous to a report from Harrison et al. [23 ] with murine S100A8, we found that oxidation regulates the effect of human S100A8 on neutrophil migration [22 ]. Substitution to alanine of an interspecies-conserved cysteine conferred functional resistance to oxidation for the chemotactic effect noted by Harrison et al. [23 ] and the fugetactic and anti-inflammatory effect noted in our previous work.
In the present work, we investigated the effect of S100A9 on neutrophil migration and explored the mechanism of the oxidative regulation of S100A9. We hypothesized that S100A9 shared the fugetactic and oxidation sensitivity of S100A8.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Generation of point-directed mutations in WTS100A9
A construct of a pGEX2T vector (Amersham) encoding the GST-WTS100A9 fusion protein was described previously elsewhere [24
]. The construct was digested with BglII (Roche, Indianapolis, IN) and EspI (MBI Fermentas, Hanover, MD) for 2 h at 37°C. The vector was separated from an 
90-bp double-stranded oligonucleotide by electrophoresis through 2% agarose. The upper band was purified using a Qiagen (Valencia, CA) gel purification kit according to the manufacturer’s recommended protocol. Two synthetic oligonucleotides (Sigma-Aldrich, St. Louis, MO) replaced the oligonucleotide with an identical sequence, except for substitution of methionine 63 by alanine (5'GATCTGCAAAATTTTCTCAAGAAGGAGAATAAGAATGAAAAGGTCATAGAACACACATCG-CCGAGGACCTGGACACAAATGCAGACAAGCAGC3' and 5'TCAGCTGCTTGTCTGCATTTGTGTCCAGGTCCTCGGCGATGTGTTCTATGACCTTTT-CATTCTTATTCTCCTTCTTGAGAAAATTTTGCA3'). The oligonucleotides were annealed and ligated to the linearized, gel-purified construct with T4 DNA ligase (Roche) and incubated overnight at 14°C. The final sequence of the protein-encoding region of the construct was confirmed with DNA sequencing.
Combinatorial mutations of methionine 81 and 83
Mutant S100 proteins were generated with a protocol that involved cut-and-paste constructs and PCR with mismatch primers, in which the desired point-directed mutation was inserted into one of the two PCR primers. Briefly, pGEX2T vectors containing WTS100A9 or Ala63S100A9 inserts were digested with EspI (MBI Fermentas) and AspI (Roche) for 2 h at 37°C. Vectors were separated from a 342-bp oligonucleotide, and the upper band was purified using a Qiagen gel purification kit with the standard protocol recommended by the manufacturer. The PCR products were obtained using a WTS100A9 construct as template and primers 5'TACGTGACTGGGTCATGGCTGCGCCCCGACAC3' in combination with one of three primers containing the mismatched oligonucleotides: 5'CAGCTGAGCCTTCGAGGAGTTCATCGCGCTGATGGCG3', 5'CAGCTGAGCCTTCGAGGAGTTCTCATGCTGGCGGCG3', and 5'CAGCTGAGCCTTCGAGGAGTTCATCGCGCTGGCGGCG3'.
The PCR products were digested with EspI and AspI for 2 h at 37°C, separated on 2% agarose gel, and purified as described previously. The three distinct PCR products were then ligated overnight as described above into the original digested vector. DNA sequencing of the whole protein-coding sequences confirmed every point-directed mutation.
Transwell migration assays
EDTA-anticoagulated whole blood from healthy volunteers was the source of peripheral neutrophils in a protocol approved by the Institutional Review Board at the University of California (San Francisco). Neutrophils were separated on Histopaque 1119 and 1077. RBCs were lysed using hypotonic shock. Purified neutrophils (>95%) were resuspended in RPMI 0.5% BSA at a concentration of 1 million cells per ml. RPMI (100 µl; 100,000 neutrophils) was placed in the upper chamber of a Transwell apparatus (6.5 mm, 3 µm pore, polycarbonate membrane, Corning Costar Inc., Corning, NY). The cells were incubated at 37°C in 5% CO2 for 3 h. Cells, which migrated from the upper to the lower chamber through the filter, were collected and counted using flow cytometry and/or a hemocytometer. A migration ratio was calculated by dividing the number of cells counted in the lower well by the mean number of cells counted in the lower wells of the negative controls in which no chemokines were added.
In some assays, we examined the effect of oxidation upon cell migration. Sodium hypochlorite (NaOCl) is an inorganic, oxidizing agent implicated in inflammation. OCl is generated by myeloperoxidase in neutrophils [25 ] and hence, constitutes a potentially relevant source of reactive oxygen encountered by S100A9 in vivo. Oxidation of S100A9 was performed using 10 µM NaOCl, as shown previously by Harrison et al. [23 ], to inhibit the chemotactic effect of murine S100A8.
Determination of neutrophil cell shape by flow cytometry
Flow cytometry was performed using a protocol modified from Sabroe et al. [26
]. Neutrophils were isolated as before and resuspended in RPMI with 0.5% BSA at a concentration of 106 cells/ml. Cells were incubated at 37°C for 30 min in a water bath. Cell suspension (90 µl) was then added to polypropylene tubes (Falcon #352052, Fisher Scientific, Pittsburgh, PA) containing 10 µl different chemokines and proteins. Following a 4-min incubation in a 37°C water bath, samples were fixed by the addition of 250 µl of an ice-cold fixative comprising a 1/4 dilution of 1x Cellfix (Becton Dickinson, San Jose, CA) formaldehyde solution in PBS. Cell size was measured by cytometric analysis performed on a FACScan flow cytometer (Becton Dickinson). Changes in forward scatter (FSC) were used to measure shape change in response to chemokines as described previously [26
].
Data analysis
Data were expressed as mean ± SEM. Statistical analysis was performed using the Student’s t-test. P < 0.05 was considered statistically significant.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
 View larger version (25K): [in a new window] |
Figure 1. Transwell migration assays of peripheral neutrophils. (A) Migratory response of neutrophils to S100A9 in the upper or lower chamber of Transwells. One hundred microliters, representing 0.1 million cells, was placed in the upper chamber of a Transwell assay system. Cells that migrated to the lower chambers were counted using flow cytometry. S100A9 was introduced in lower or upper chambers of the Transwell assay at different concentration. The data represent the average of three experiments conducted in duplicate. (B) Partial checkerboard experiment. S100A9 was introduced in the lower, upper, or in both chambers of the Transwell assays at a concentration of 10–9 M. The data represent the average of four experiments performed in duplicate. (*, P 0.01, compared with control with no chemokine added.) (C) Effect of pertussis toxin (PTX) on neutrophil fugetaxis and chemotaxis. Fugetaxis to S100A9 and chemotaxis to IL-8 were tested following the exposure of neutrophils to different concentrations of PTX. The data represent the average of two experiments conducted in duplicate. (*, P0.01, when compared with the migration ratio with no PTX.) (D) Transwell chemotaxis migration of peripheral neutrophils; effect of oxidation on fugetaxis of WTS100A9, which was added to the upper well of the Transwells at a concentration of 10–9 M. Sensitivity of WTS100A9 was tested by exposing the protein to 10 µM OCl for 30 min on ice. A similar concentration of OCl was tested for control. The data represent the average of three experiments performed in duplicate. (*, P0.01, compared with untreated, negative control.)
|
In the absence of oxidation, human S100A9 was observed to exist in solution as a mixture of monomers, dimers, trimers, and tetramers (Fig. 2A ). Oxidation of S100A9 with 10–5 M NaOCl caused a change in electrophoretic mobility of the four oligomeric structures. Reduction of S100A9 with 100 mM DTT postoxidation resulted in the formation of monomers but did not reverse the mobility change caused by OCl oxidation (Fig. 2A) . The irreversibility of OCl-induced changes in electrophoretic mobility with DTT suggested that oxidation may have resulted in transformation of methionine residues to nonreducible sulfones.
 View larger version (27K): [in a new window] |
Figure 2. Effect of oxidation on the electrophoretic mobility of WTS100A9. (A) Western blot analysis of WTS100A9 oxidized with 10 µM NaOCl for 30 min on ice. The SDS-PAGE was run under nonreducing (Lanes 1 and 2) and reducing (Lanes 3 and 4) conditions. WTS100A9 was found to form several species: monomers, dimers, trimers, and tetramers (Lane 1). Oxidation with NaOCl caused a change-up in electrophoretic mobility of each species (Lane 2). Under reducing conditions, WTS100A9 was reduced to smaller oligomers (Lane 3), whereas the electrophoretic mobility change was not changed by reduction (Lane 4). (B) Effect of oxidation on the electrophoretic mobility of mutated S100A9 proteins. Coomassie stained 10% SDS-PAGE of WT (Lanes 1 and 2), Ala63S100A9 (Lanes 3 and 4), Ala6381S100A9 (Lanes 5 and 6), Ala6383S100A9 (Lanes 7 and 8), and Ala638183S100A9 (Lanes 9 and 10). S100A9 proteins were treated with water (Control) or 10 µM NaOCl for 30 min on ice, respectively. The mutant proteins exhibit a change-up in electrophoretic mobility, similar to what was observed with the WT proteins.
|
 View larger version (19K): [in a new window] |
Figure 3. Interspecies sequence alignment of human (H), mouse (M), and rat (R) S100A9. The human protein has five or six methionine residues depending on alternative translation of the protein. Three of those residues are conserved between the species (boxed and in red), and three are not (in blue; data adapted from the EF-Hand Calcium-Binding Proteins Data Library, http://structbio.vanderbilt.edu/cabp_database).
|
 View larger version (17K): [in a new window] |
Figure 4. Transwell chemotaxis migration of peripheral neutrophils; effect of oxidation on the fugetaxis triggered by mutated S100A9 proteins. The data represent the average of three experiments performed in duplicate. S100A9 or mutant proteins were exposed to 10 µM NaOCl for 30 min on ice. The proteins were then added to the upper well of the Transwells at a concentration of 10–9 M. *, P 0.01 (compared with untreated, negative control).
|
 View larger version (17K): [in a new window] |
Figure 5. Shape change assays of peripheral neutrophils: the effect of oxidized S100A9 protein. The data are representative data from one experiment out of three and conducted in triplicates. FSC is indicated as a percentage of the basal level. WTS100A9 and mutant S100A9 proteins were oxidized by incubation to 10 µM NaOCl for 30 min on ice. *, P 0.01 (compared with untreated, negative control).
|
 View larger version (17K): [in a new window] |
Figure 6. Transwell chemotaxis assays of peripheral neutrophils: inhibition of fMLP by oxidized S100A9 protein. The data represent the average of three experiments performed in duplicate. WTS100A9 or mutant proteins were exposed to 10 µM NaOCl for 30 min on ice. fMLP was placed on its own or together with S100A9 (or one of the mutant S100A9 proteins) in the lower chamber at a concentration of 10–9 M. *, P 0.01; #, P 0.05 (compared with fMLP control).
|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
i trimeric guanosinetriphosphatase. The fugetaxis was also sensitive to the oxidation S100A9. Methionine residues conserved in humans, rats, and mice S100A9 mediated S100A9 sensitivity to oxidation. Substitutions of methionine 63 and 83 to alanine resulted in formation of an oxidation-resistant protein, as shown by three discrete sets of experiments: fugetaxis assays, cell-shape assays, and inhibition of fMLP-driven chemotaxis. S100A9 molecules with methionine 63 and 83, substituted with alanine, retained their fugetactic effect and their ability to affect cell shape even after treatment with OCl. Substitution of methionine 63 to alanine was sufficient to preserve the antichemotactic effect of S100A9 on fMLP.
The antichemotactic activity of S100A9 on fMLP-driven fugetaxis is in agreement with the effect reported with NIF1 and NIF2 [17 ]. The homology between NIF1/NIF2 and the C-terminal of S100A9 [29 ] suggests that oxidation of methionine 63 and 83 may play a role in the neutrophil-immobilizing function of S100A9 by altering the conformation of its C-terminal.
The concentration of S100A9, which resulted in in vitro fugetaxis, was in the nanomolar range. Although this concentration is reported to be physiologically relevant in serum [30 ], the narrowness of the concentration range at which S100A9 exerts fugetactic activity invites further investigation into the biological relevance of S100A9 fugetaxis in inflammation. Our study did not confirm the chemotaxis activity of S100A9 observed by Ryckman et al. [13 ]. Chemotaxis was observed at subphysiological concentration [15 ], lower than the concentrations at which we documented fugetaxis. Nonetheless, our study together with that Ryckman et al. [13 ] suggest a dual chemotaxis, fugetaxis response at a lower and higher concentration of S100A9 as noted with other chemokines [31 ].
Whether S100A9 acts as a proinflammatory chemotactic agent, as an anti-inflammatory fugetactic agent, or both remains elusive. The apparent discrepancy between data supporting pro- or anti-inflammatory activities for S100A9 was not resolved by the null-mutation studies in mice [12 ], which did not display gross differences in inflammatory responses [12 ]. The data in this report support an anti-inflammatory function for S100A9. Whereas the expression and serum levels of S100A9 are shown to increase with inflammation, our report indicates that its function may be anti-inflammatory.
Similarities exist between the fugetactic effects of S100A9 and S100A8 [22 ], including the role of oxidation in inhibiting it. In addition to those functional similarities, S100A8 and S100A9 have been observed to form together a number of quaternary structures [32 ]. Calprotectin [33 ] and the cystic fibrosis antigen [34 ] are two examples of protein structures. The formation of calprotectin is biologically preferred over the formation of homogenous structures [35 ]. Although the heterocomplex formation is required for certain functions such as the transport of arachidonic acid [36 ] and the induction of NADPH oxidase [37 ], it also inhibits functions such as those associated with increased neutrophil adhesion [14 ]. Functional inhibition through heterocomplex formation complicates the interpretation of studies linking concentrations or expression of calprotectin with inflammatory states. Nonetheless, reports showing that the S100A8 and S100A9 proteins are present as individual proteins under certain inflammatory conditions [38 , 39 ] indicate that both proteins may act as separate entities, whatever those function(s) may be. Adding to the complexity of the regulation of S100A9 through heterocomplex formation with S100A8, an issue not studied in this work, gene deletion studies of S100A9 demonstrate the concomitant absence of S100A8 protein expression. This finding is remarkable in light of the lethal phenotype associated with S100A8 deletion [40 ].
Protein oxidation and particularly, methionine oxidation, has been associated previously with reduction or elimination of biological activity [41
42
43
]. For example, oxidation is linked to a loss or gain in enzyme activity (e.g., -1-antitrypsin/elastase) and to inhibition of protein function (e.g., fibrinogen/fibrin clotting). An additional example of a protein whose functions are regulated by oxidation is the inhibitory protein I
B. The oxidation of a methionine at Position 45 in IB represents a mechanism regulating its function. Oxidation of Met45 in IB leads to a change in electrophoretic mobility similar to the one we observed upon oxidation of S100A9. Conversely, the substitution of all three interspecies-conserved methionine did not affect the electrophoresis of S100A9. We hypothesize that other nonconserved methionine residues may explain those findings or alternatively, one or more nonmethionine residues may also undergo nonreversible changes upon oxidation.
It is not clear how oxidation of specific methionine residues affects the biological activity of S100A9. Oxidation may destabilize peptide structure as reported with methionine oxidation of other proteins [41 ]. Substitution of methionine with alanine may protect S100A9 against oxidative destabilization of its structure [44 ].
Finally, as a consequence of the biologically relevant activities of S100A9, the mutants of S100A9 described in this work suggest a new class of agents, potentially applicable to targeted therapeutic attempts to down-regulate the immune response. Future studies with S100A9 factors in animal disease models may be of value to develop new categories of immune suppressants.
Received July 5, 2006; accepted November 2, 2006.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
 |
|
 |
|
  S. Y. Lim, M. J. Raftery, J. Goyette, K. Hsu, and C. L. Geczy Oxidative modifications of S100 proteins: functional regulation by redox J. Leukoc. Biol., September 1, 2009; 86(3): 577 - 587. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. C. Flanders, B. M. Ho, P. R. Arany, C. Stuelten, M. Mamura, M. O. Paterniti, A. Sowers, J. B. Mitchell, and A. B. Roberts Absence of Smad3 Induces Neutrophil Migration after Cutaneous Irradiation: Possible Contribution to Subsequent Radioprotection Am. J. Pathol., July 1, 2008; 173(1): 68 - 76. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
