PeproTech Inc.
Originally published online as doi:10.1189/jlb.0406293 on December 21, 2006

Published online before print December 21, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0406293v1
81/3/766    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lepisto, A. J.
Right arrow Articles by Hendricks, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lepisto, A. J.
Right arrow Articles by Hendricks, R. L.
(Journal of Leukocyte Biology. 2007;81:766-774.)
© 2007 by Society for Leukocyte Biology

Expression and function of the OX40/OX40L costimulatory pair during herpes stromal keratitis

Andrew J. Lepisto*,{dagger}, Min Xu{ddagger}, Hideo Yagita§, Andrew D. Weinberg|| and Robert L. Hendricks*,¶,#,1

Departments of
* Ophthalmology,
Immunology, and
# Molecular Genetics and Biochemistry and
{dagger} Graduate Program in Immunology, School of Medicine, University of Pittsburgh, Pittsburgh, Pennsylvania, USA;
{ddagger} Department of Surgery, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA;
§ Department of Immunology, Juntendo University School of Medicine, Bunkyo-ku, Tokyo, Japan; and
|| Earl A. Chiles Research Institute, Providence Medical Center, Portland, Oregon, USA

1 Correspondence: Eye and Ear Institute, 203 Lothrop Street, Room 922, Pittsburgh, PA 15213, USA. E-mail: hendricksrr{at}upmc.edu


arrow
ABSTRACT
 
Herpes stromal keratitis (HSK) is an immunopathological disease regulated by Th1 CD4 T cells, which require APC and costimulation within the infected cornea to mediate disease. Recent studies suggest the OX40:OX40 ligand (OX40L) interaction enhances effector cell cytokine secretion at inflammatory sites. OX40+ cells were detected in HSV-1-infected mouse corneas as early as 3 days postinfection (dpi), prior to the onset of HSK, and their frequency increased through 15 dpi, when all mice exhibited severe HSK. OX40L+ cells were first detected at 7 dpi, coincident with the initiation of HSK. It is interesting that the OX40L+ cells did not coexpress MHC Class II or the dendritic cell (DC) marker CD11c. Our findings demonstrate rapid infiltration of activated (OX40+) CD4+ T cells into HSV-1-infected corneas and expression of OX40L on MHC Class II-negative cells but surprisingly, not on MHC Class II+ CD11c+ DC, which are present in the infected corneas and required for HSK. Moreover, neither local nor systemic treatment of mice with a blocking antibody to OX40L or with a blocking fusion protein altered the course of HSK significantly, possibly as a result of a lack of OX40L expression on functional APC.

Key Words: HSV-1 • CD4 • mouse • cornea • immunopathology


arrow
INTRODUCTION
 
HSV-1 corneal infections can lead to a potentially blinding eye disease, termed herpes stromal keratitis (HSK), which is a leading infectious cause of corneal blindness in industrialized countries. HSK is a T cell-regulated disease, as evidenced by the failure of T cell-deficient athymic nude mice to develop disease unless they are reconstituted with T cells from immunologically normal mice [1 , 2 ]. The primary involvement of Th1 CD4+ T cells in HSK was defined further by the observations that CD4+ T cells producing a Th1 cytokine pattern are found within HSK lesions [3 4 5 6 ] and that HSK can be abrogated by depletion of CD4+ T cells or neutralization of Th1 cytokines [3 , 4 ]. The Th1 cytokines regulate the infiltration and activation of polymorphonuclear leukocytes, which appear to be the proximal mediators of corneal tissue destruction [4 ]. In addition, an important role for corneal Langerhans cells in induction of the HSV-1-specific CD4+ T cell response in lymphoid organs and their restimulation within the infected cornea has been established [7 ]. Consistent with the need for restimulation of Th1 T cells within the infected cornea is the observation that local blockade of B7.1/CD28 costimulatory interactions within the cornea ameliorates HSK [8 ].

The 4-1BB/4-1BBL costimulatory pathway has also been successfully targeted for therapeutic intervention in murine HSK [9 ]. In that study, inhibition of the inducible 4-1BB/4-1BBL costimulatory pathway inhibited CD4+ T cell infiltration into infected corneas, resulting in reduced HSK. A possible additional role for this costimulatory pathway within the infected cornea was not addressed. Other candidate-inducible costimulatory pairs, which might be targeted for the alleviation of HSK, include the CD40/CD154 and OX40/OX40 ligand (OX40L) costimulatory pairs. The interaction of CD40 [a member of the TNF receptor (TNFR) superfamily] on APC with CD154 on activated CD4+ T cells regulates APC production of IL-12 and IL-18, cytokines that induce IFN-{gamma} production and push naïve CD4+ T cells into the Th1 differentiation pathway [10 11 12 ]. This reciprocal activation produces the robust Th1 CD4+ T cell response that is required for the eradication of many viral and bacterial infections. Although blocking CD40/CD154 costimulation does reduce the Th1 response and enhance the Th2 response of HSV-1-specific CD4+ T cells in the draining lymph nodes (DLN) following HSV-1 corneal infection, CD4+ T cells infiltrating the cornea still produced Th1 cytokines exclusively, and the severity of HSK was only reduced modestly [13 ]. These observations demonstrated distinct costimulatory requirements of HSV-1-specific CD4+ T cells in the cornea and lymphoid organs and that CD40/CD154 costimulation apparently plays a minor or partially redundant role in restimulation of the Th1 response within HSV-1-infected corneas.

Expression of OX40 (TNFR superfamily member) is limited to activated CD4 and CD8 T cells in mice and humans [14 15 16 17 ]. OX40L (also a TNFR superfamily member) is expressed on dendritic cells (DC) [17 , 18 ], B cells [19 ], endothelial cells [20 ], macrophages [21 ], and T cells [22 ]. OX40 and OX40L belong to the group of inducible, costimulatory molecules and are expressed only after activation of T cells and APC, respectively [15 16 17 18 ].

An attractive feature of OX40:OX40L as a target for immune modulation lies in the finding that OX40 is expressed on activated T cells isolated from inflammatory sites in a number of immunoinflammatory diseases including experimental allergic encephalomyelitis (EAE), rheumatoid arthritis (RA), and graft versus host disease (GVHD) [21 , 23 , 24 ]. Manipulation of OX40:OX40L interactions (by blocking OX40:OX40L binding or selectively depleting OX40-expressing cells) represents a potentially powerful method for locally down-modulating a harmful immune response without causing systemic suppression of the immune system [25 , 26 ]. In support of this theory, blockade of OX40:OX40L interactions resulted in an alleviation of several inflammatory diseases in mice including RA, EAE, and GVHD [21 , 23 , 27 ].

We examined the possible therapeutic benefits of blocking the OX40/OX40L costimulatory interaction in HSK. We report interesting kinetics and distribution of these molecules within the HSV-1-infected cornea but no therapeutic efficacy of blocking their interaction.


arrow
MATERIALS AND METHODS
 
Mice and virus infection
Female, wild-type BALB/c mice (Frederick Cancer Research Center, MD, USA) were used at 6–8 weeks of age in all experiments. Mice were anesthetized by i.m. injection of 2 mg ketamine hydrochloride and 0.04 mg xylazine (Pheonix Scientific, St. Joseph, MO, USA) in 0.2 ml HBSS (BioWhittaker, Walkersville, MD, USA). Topical corneal infection was performed by scarification of the central cornea 15 times with a sterile, 30-gauge needle in a criss-cross pattern and applying 3 µl RPMI (BioWhittaker, Rockland, ME, USA) containing 105 PFU HSV-1. The RE strain of HSV-1 was grown in Vero cells, and intact virions were purified on OptiPrepTM gradients according to the manufacturer’s instructions (Accurate Chemical and Scientific Corp., Westbury, NY, USA) and stored at –80°C. The viral titer, expressed as pfu of HSV-1, was determined in a standard virus plaque assay. All experimental procedures were reviewed and approved by the University of Pittsburgh Institutional Animal Care and Use Committee (PA, USA) and were in adherence with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research.

OX40L transfectants
L5178Y cells were stably transfected with OX40L and maintained as described previously [28 ].

In vivo OX40/OX40L blockade
Two approaches were used to block the OX40/OX40L interaction in vivo. Both treatments involved reagents that were used successfully to block inflammation in other models [29 ]. In one approach, mice received 0.5 mg anti-OX40L antibody (Clone RM134L) i.p. for systemic treatment or subconjunctivally for local treatment. The RM134L hybridoma was generated and characterized as described [28 ], and mAb was prepared using a CellMax HF Quad bioreactor (Spectrum Labs, Rancho Dominguez, CA, USA). In an alternative approach, mice received subconjunctival injections of 10 µg of an OX40-Fc fusion protein at 6, 8, 10, 12, 14, 16, and 18 days postinfection (dpi).

Monitoring of HSV-1 corneal and skin disease
Corneal disease was monitored in a masked manner by slit-lamp examination on alternate days after HSV-1 corneal infection. By 2 dpi, BALB/c mice uniformly exhibited dendritic-shaped corneal epithelial lesions, which healed by 4 dpi. HSK was characterized by corneal opacity and neovascularization beginning ~7 dpi. Opacity and neovascularization developed concurrently and were monitored by slit-lamp examination. HSK was scored on the basis of opacity as follows: 1+, mild corneal haze; 2+, moderate opacity; 3+, severe opacity obscuring the iris; or 4+, corneal perforation.

Immunohistochemistry of corneal whole mounts
Whole corneas were prepared and stained as described previously [30 ]. Briefly, excised corneas were trimmed of any attached lens, conjunctiva, iris, and limbal tissue. The corneal epithelium was peeled away after a 20-min incubation at 37°C in PBS containing 20 mM EDTA. The following general staining procedure was used for all antibodies except CD11c and OX40L. The corneal stromas were fixed for 30 min at 4°C in 1% paraformaldehyde (PFA)-PBS (Electron Microscopy Sciences, Fort Washington, PA, USA), washed with PBS, and then blocked for 20 min at 37°C with 10 µg/ml Fc-block [antimouse CD16/CD32 (Fc{gamma}III/IIR), BD PharMingen, San Diego, CA, USA], diluted in PBS containing 3% BSA, 0.25% gelatin, 5 mM EDTA, and 0.025% Nonidet P-40, a nonionic detergent (BGEN). Corneal tissue was then incubated overnight at 4°C with 100 µL primary antibody (1–5 µg/mL) diluted in PBS-BGEN. The tissues were washed extensively with PBS, and those stained with fluorescently labeled, primary antibody were fixed again with 1–4% paraformaldehyde-PBS for 30 min at 4°C, rinsed with PBS, placed on slides, mounted with Immu-Mount mounting medium (Shandon, Pittsburgh, PA, USA), and coverslipped. Tissues, which were reacted with a biotinylated primary antibody, were incubated with 100 µL fluorescently labeled streptavidin (1–2.5 µg/mL), diluted in PBS-BGEN for 1 h at 37°C, washed with PBS, and then fixed and mounted as described above.

For visualization of CD11c staining, tyramide amplification was performed with a kit (TSA Direct, NEN, Boston, MA, USA) according to the manufacturer’s recommendations. For OX40L staining, the corneas were fixed in 1% PFA, washed with PBS, blocked with normal goat serum for 20 min at 37°C, and incubated with OX40-human Fc fusion protein at 1 µg/ml for 1 h at 37°C. After five, 5 min PBS washes, corneas were treated with goat antihuman IgG biotin for 1 h at 37°C, washed in PBS, incubated with streptavidin-Cy3 at 37°C for 1 h, washed five times in PBS, and mounted on slides using Immu-Mount.

The following reagents were used for staining corneal whole mounts: anti-CD4 FITC (Clone RM4-5 purchased from Caltag, S. San Francisco, CA, USA), biotin anti-OX40 (Clone OX-86 from BD PharMingen), OX40-human Fc fusion protein (kindly provided by A. D. Weinberg, Oregon Health Science University, Portland, USA), FITC-labeled anti-CD45 (Clone 30-F11 from BD PharMingen), Alexafluor 488-labeled anti-MHC Class II (Clone M5/114.15.2/TIB-120, labeled in-house), and CD11c (Clone HL3, used according to the tyramide amplification specifications, TSA Direct).

All slides were examined by fluorescence microscopy on a 1 x 70 microscope (Olympus, Tokyo, Japan) equipped with a confocal imaging system (Radiance Plus, Bio-Rad, Hercules, CA, USA). Digital images were captured using the scanning confocal laser and the accompanying software (Lasersharp 2000, Bio-Rad).

Preparation of corneal and DLN single cell suspensions
Corneas were removed and incubated with PBS-EDTA to separate the epithelial layer. Individual corneal stromas were rinsed, cut into quarters, treated with collagenase Type I (84 units/cornea, Sigma Chemical Co., St. Louis, MO, USA) for 1.5–2 h at 37°C, and triturated until no apparent tissue fragments remained. The single cell suspension of each cornea was then filtered through a 35-µm cell strainer cap (Becton Dickinson Labware, Franklin Lakes, NJ, USA) and washed. The DLN (cervical and submandibular) were excised, dispersed into single cell suspensions by filtering through a 40-µm cell strainer, and then counted in a hemocytometer.

Quantification of leukocyte populations in corneal and DLN cell suspensions
Single cell suspensions of individual corneas (one cornea/tube) or 1 x 106 DLN cells were incubated with Fc block to prevent nonspecific binding of fluoresceinated mAb and then stained for 30 min at 4°C. The following staining reagents were used: biotin anti-OX40 (Clone OX-86), FITC labeled anti-CD4 (Clone RM4-5), PE-labeled antimouse I-A/I-E (Clone M5/114.15.2), and biotin anti-OX40L (Clone RM134L) and streptavidin APC, all purchased from BD PharMingen. Streptavidin Cy3 was purchased from Jackson Immunoresearch Laboratories (West Grove, PA, USA). After staining, cells were fixed in 1% paraformaldahyde and analyzed on a FACSAria (Becton Dickinson, San Jose, CA, USA) using FACSDiva data analysis software.

RT-PCR for OX40L mRNA
Individual corneas were removed as described above. The corneas or OX40L-transfected cells [28 ] (positive control) were placed in 1.5 ml microfuge tubes with sterile PBS and a sterile stainless steel bead and were disrupted mechanically using a Retsch MM300 Mixermill (Catalog Number 85110, Qiagen, Valencia, CA, USA). Total RNA was purified from the extracts using a Qiagen RNeasy kit. The eluted RNA was treated with the Ambion DNase kit and reverse-transcribed (using Superscript RT, Invitrogen, Carlsbad, CA, USA), and the resulting cDNA was amplified using a Gold RNA PCR kit (Applied Biosystems, Foster City, CA, USA). The OX40L-specific primers (OX40L Primer #1: ATGGAAGGGGAAGGGGTTCAACC; OX40L Primer #2: TCACAGTGGTACTTGGTTCACAG) were purchased from Sigma-Genosys (St. Louis, MO, USA) and produced an OX40L fragment of 596 bp, as reported previously [31 , 32 ]. Each sample was run without RT as a negative control.


arrow
RESULTS
 
OX40 but not OX40L is expressed in the DLN following ocular HSV-1 infection
DLN were excised at various times after HSV-1 corneal infection, and single cell suspensions were stained simultaneously for CD4 and OX40 (Fig. 1 ). Flow cytometric analysis revealed that OX40 was expressed exclusively on CD4+ T cells. Prior to infection, ~10% of CD4+ T cells in the DLN expressed OX40, and that frequency remained constant at all times tested following infection. However, CD4+ T cell expansion in the DLN following infection resulted in a dramatic increase in the absolute number of OX40+ cells as early as 3 dpi.


Figure 1
View larger version (21K):
[in this window]
[in a new window]

  		Figure 1. OX40 is expressed on CD4+ T cells in the DLN, which were removed from noninfected BALB/c mice or at 3, 5, 7, 9, or 11 days after HSV-1 corneal infection. DLN cells were stained simultaneously for CD4 and OX40 and analyzed by flow cytometry. Representative dot plots of CD4 versus isotype control (A) or CD4 versus OX40 (B). The percentage of CD4+ T cells expressing OX40 is shown in the upper right quadrants.

DLN cells were also stained simultaneously for MHC Class II and OX40L (Fig. 2 ). OX40L+ cells were not detectable before or after infection (Fig. 2B) . To insure the efficacy of our staining protocol, OX40L-transfected L5178Y cells were stained using an identical protocol. As expected, these cells uniformly showed strong staining for OX40L (Fig. 2C) .


Figure 2
View larger version (17K):
[in this window]
[in a new window]

  		Figure 2. OX40L is not expressed in the DLN before or after HSV-1 corneal infection. DLN were removed from noninfected BALB/c mice or at 3, 5, 7, 9, or 11 days after HSV-1 corneal infection. DLN cells were stained simultaneously for OX40L and MHC Class II and analyzed by flow cytometry. Data are presented as representative dot plots of MHC Class II versus isotype control (A) or MHC Class II versus OX40L (B). No OX40L+ cells were detected in the DLN in this or a repeat experiment. As a positive control, OX40L-transfected L5178Y cells were stained similarly, and a representative histogram shows strong staining for OX40L (C).

OX40 is expressed on CD4+ T cells that infiltrate HSV-1-infected mouse corneas
To evaluate a potential role for OX40 in HSK, whole mounts of corneal stromas were prepared at various times after HSV-1 corneal infection and were stained simultaneously for OX40 and for CD4. It is surprising that within 3 dpi, OX40+ CD4+ T cells were detectable in the corneal stroma, suggesting a rapid infiltration of activated CD4+ T cells (Fig. 3A 3C, and 3E ). The accumulation of OX40+ CD4+ T cells increased through 15 dpi (Fig. 3B and 3D) . Virtually all of the OX40+ cells costained for CD4, suggesting that OX40 expression is largely restricted to CD4+ T cells as seen in the DLN (Fig. 1) . To quantify OX40 expression on CD4+ T cells in the cornea, corneas with HSK were excised at 3 or 15 dpi, digested with collagenase, stained simultaneously with anti-CD4 and anti-OX40 mAb, and analyzed by flow cytometry (Fig. 3C and 3D) . Flow analysis confirmed that OX40 was expressed exclusively on CD4+ T cells in infected corneas and established a frequency of OX40 expression on CD4+ T cells of 1% at 3 dpi and 15% at 15 dpi.


Figure 3
View larger version (35K):
[in this window]
[in a new window]

  		Figure 3. OX40+ CD4+ T cells are present in the infected cornea as early as 3 dpi. The corneas of BALB/c mice were excised at 3 (A, C, E) or 15 (B, D) days after HSV-1 corneal infection. The epithelium was removed, and whole mounts of corneal stroma were stained simultaneously with FITC-conjugated anti-CD4 (green) and Cy3-conjugated anti-OX40 (red) followed by confocal microscopic examination. In merged images (A, B), cells that coexpress CD4 and OX40 appear yellow. Alternatively, the corneal stromas were dispersed into single cell suspensions, which were stained with FITC-conjugated anti-CD4 and Cy3-conjugated anti-OX40 and analyzed by flow cytometry. A representative dot plot (D) shows nearly exclusive expression of OX40 on CD4+ T cells at 15 dpi, and only ~1% of CD4+ T cells expressed OX40 at 3 dpi (C). The percentage of CD4+ T cells that express OX40 is shown in the upper right quadrants. Costaining of CD4 and CD3 at 3 dpi confirmed that virtually all CD4+ cells coexpressed CD3 and were thus T cells (E). (C, D, E) Cells shown were first gated on forward/side-scatter and then on CD45+ cells.

OX40L is expressed on nonconventional APC in HSV-1-infected corneas
OX40L expression on APC can be the limiting factor in OX40/OX40L costimulation [26 ], prompting an analysis of OX40L expression in HSV-1-infected corneas. OX40L expression was assessed initially by RT-PCR analysis of total RNA extracted from corneas with HSK. As illustrated in Figure 4A , OX40L mRNA was readily detectable in corneas at or near the peak of HSK severity at 15 dpi, with no expression in uninfected corneas (Fig. 4B) . The phenotype of OX40L-expressing cells was determined by immunofluorescence staining of corneal whole mounts. OX40L+ cells were first detected in the infected corneas at 7 dpi and increased in number through 15 dpi. All OX40L+ cells coexpressed CD45, suggesting bone marrow derivation (Fig. 4C) . However, OX40L+ cells failed to coexpress MHC Class II (Fig. 4D) or the DC marker CD11c (Fig. 4E) . Thus, although OX40+ CD4+ T cells and OX40L+ hematopoietic cells were simultaneously present in infected corneas, and the presence of the latter coincided with the onset of HSK (7 dpi), the involvement of OX40/OX40L costimulation in CD4+ T cell activation during HSK remained in doubt as a result of the lack of MHC Class II expression on OX40L+ cells.


Figure 4
View larger version (54K):
[in this window]
[in a new window]

  		Figure 4. OX40L is expressed on a population of CD45+, MHC Class II–, CD11c– cells in the corneal stroma. Total RNA was extracted from corneas, which were excised 15 days after corneal infection (A) or from uninfected eyes (B), and OX40L transcripts were expanded by RT-PCR. As a positive control, total RNA extracted from OX40L-transfected L5178Y cells was similarly analyzed. To control for DNA contamination, each sample was subjected to PCR without RT. All samples from infected corneas showed the expected 596 bp OX40L product, and no OX40L transcripts were detected in uninfected corneas. Alternatively, corneas were excised at 7 (C) or 15 (D, E) days after HSV-1 infection, and corneal stromal flat mounts were stained simultaneously with anti-OX40L-Cy3 and anti-CD45 FITC (C), anti-MHC Class II Alexafluor 488 (D), or anti-CD11c FITC (E). In merged confocal images, cells coexpressing OX40L with another marker appear yellow, revealing the phenotype of OX40L-positive cells in the corneal stroma to be CD45+, MHC Class II–, CD11c–. (C) Original magnification is x40; (D, E) original magnification is x20.

OX40/OX40L interactions are not required for HSK development
To determine if OX40/OX40L signaling was important during the early stages of HSK development, 0.5 mg of a blocking antibody to OX40L (RM134L) was administered systemically to mice on 1, 3, 5, and 7 dpi. Corneal eye swabs obtained at 2–10 dpi revealed no effect of treatment on viral clearance from the corneas, and anti-OX40L-treated and control mice showed complete clearance of infectious HSV-1 by 8 dpi (data not shown). This treatment regimen failed to influence the incidence (100%), kinetics, or severity of HSK (Fig. 5 ).


Figure 5
View larger version (21K):
[in this window]
[in a new window]

  		Figure 5. Systemic treatment with an antagonist anti-OX40L antibody does not alter HSK. The corneas of BALB/c mice were infected with 105 PFU HSV-1 RE strain, followed by i.p. injections of 0.5 mg anti-OX40L mAb (RM134L) on 1, 3, 5, and 7 dpi. Corneas were examined using a slit-lamp biomicroscope every other day starting at 7 dpi and scored for HSK severity. HSK incidence was 100% for both treatment groups. Data are recorded as mean ± SEM (n=5 mice/group) HSK severity. The anti-OX40L mAb treatment did not influence HSK severity significantly, as assessed by a Student’s t test (P>0.05).

To address the possibility that OX40/OX40L interactions are required during the development of HSK within the cornea, mice were treated subconjunctivally with an anti-OX40L mAb (Fig. 6A 6B 6C ) or with an OX40-Fc fusion protein (Fig. 6D ) [21 ]. Treatments were initiated on 7 dpi and then continued every other day through 19 dpi. The anti-OX40L mAb was diffusely present throughout the treated corneas, as assessed by immunohistochemical staining of paraffin sections for rat IgG (Fig. 6A and 6B) . However, in both treatments, this local blockade of OX40/OX40L interaction during HSK development failed to influence the incidence or severity of HSK (Fig. 6C and 6D) . To insure that the anti-OX40L mAb used in our studies maintained specificity, we demonstrated its ability to block binding of a commercially available anti-OX40L mAb to OX40L-transfected L5178Y cells (Fig. 7 ).


Figure 6
View larger version (32K):
[in this window]
[in a new window]

  		Figure 6. Local treatment with an antagonist anti-OX40L mAb within the cornea does not alter HSK. The corneas of BALB/c mice were infected with 105 PFU HSV-1 RE strain, followed by subconjunctival injections of PBS or 50 µg anti-OX40L mAb (RM134L) on 7, 9, 11, 13, 15, and 17 dpi. Some corneas from animals treated with RM134L were excised at 19 dpi, embedded in paraffin, sectioned, and stained with an Alexafluor 546-conjugated, anti-rat IgG mAb. Corneas of mice that were treated with anti-OX40L mAb showed strong staining for rat IgG, mainly in the anterior stroma (A), whereas corneas of PBS-treated, control mice showed only mild background staining (B). Corneas of the remaining mice were examined using a slit-lamp biomicroscope every other day starting at 7 dpi and scored for HSK severity. Data are recorded as mean ± SEM (n=5 mice/group) HSK severity (C). Alternatively, mice were treated with a blocking fusion protein consisting of OX40 coupled to mouse Fc [21 ] on 6, 8, 10, 12, 14, 16, and 18 dpi (D), and HSK severity was monitored. HSK incidence was 100% in both treatment groups.


Figure 7
View larger version (13K):
[in this window]
[in a new window]

  		Figure 7. RM134L is specific for OX40L. OX40L-transfected L5178Y cells were preincubated for 30 min with the indicated concentrations of the RM134L mAb, which was used for in vivo blocking studies, and were then stained with 0.5 µg of a commercially available, biotinylated, anti-OX40L antibody followed by streptavidin PE. Purified RM134L mAb blocked staining with the biotinylated OX40L in a dose-dependent manner.


arrow
DISCUSSION
 
The expansion, retention, and cytokine secretion of effector T cells at sites of infection and inflammation often involve TCR signaling through recognition of antigenic epitopes on local APC. Although costimulation is generally considered to be more important for the activation of naïve T cells within the lymphoid organs, a growing literature supports the concept that in some cases, costimulation is also important when effector cells are restimulated at sites of antigenic challenge [33 ]. Thus, although some costimulatory molecules are expressed on naïve T cells, other inducible, costimulatory molecules are expressed exclusively after T cell activation and differentiation into effector cells.

Our previous studies established that CD4 T cells that infiltrate HSV-1-infected mouse corneas require B7.1:CD28 costimulation to mediate HSK [8 ]. This provided the first demonstration that effector T cells require costimulation within an inflammatory site in vivo [33 ]. However, CD28 is constitutively expressed on CD4+ and most CD8+ T cells and is required for effective activation of naïve T cells [34 ]. Several studies have demonstrated that T cells play a protective [35 , 36 ] and an immunopathological role [33 , 37 ] during HSV-1 infections. Thus, targeting the CD28/B7 costimulatory pathway would not only inhibit the undesirable effector response of HSV-1-specific CD4+ T cells in the cornea but could potentially abrogate their protective response at other anatomical sites by inhibiting the inductive phase of the T cell response to HSV-1 in the lymphoid organs.

A more attractive alternative would be to target an inducible, costimulatory molecule, which is expressed only on activated T cells, and direct treatment to the site of immunopathology so as to reduce inflammation without affecting the protective cells present at other sites. Targeting an inducible, costimulatory molecule would also spare naive T cells, which may be necessary to combat other simultaneous infections. Ideally, this costimulatory molecule would be expressed only on pathogenic T cells that infiltrate the cornea and mediate HSK. The following considerations suggested that the OX40/OX40L costimulatory pair would be an ideal target for HSK therapy: The OX40 molecule is expressed primarily on activated CD4 T cells [25 , 29 ], which appear to be the main orchestrators of HSK; blockade of OX40/OX40L interactions has been used successfully to alleviate numerous inflammatory diseases [21 , 23 , 25 , 27 , 38 ]; although not universally observed [39 ], in some systems, OX40/OX40L blockade spared CD8 T cell responses, which in HSV-1-infected mice, are important for controlling virus replication in sensory ganglia and maintaining the virus in a latent state [40 , 41 ]; and OX40 delivers a costimulatory signal to T cells that is as potent a stimulus as CD28 signaling, which has been shown to be necessary for HSK [8 , 25 ].

Our observation that CD4+ OX40+ cells were present in HSV-1-infected corneas as early as 3 dpi and accumulated in concert with HSK development provided initial support for a potential contribution of OX40/OX40L costimulation in HSK. The presence of activated CD4+ T cells expressing an inducible, costimulatory molecule in infected corneas as early as 3 dpi was an unexpected finding. The notion that these CD4+ effector T cells migrated from the DLN to the cornea is consistent with the observed, rapid expansion of OX40+ CD4+ T cells in the DLN during the first 3 days after corneal infection. However, the alternative possibility that naïve or memory CD4+ T cells infiltrated and were activated within the microenvironment of the infected cornea cannot be formally excluded. Nonetheless, the potential early involvement of activated CD4+ T cells in HSV-1-infected corneas is suggested. In support of this view, CD4+ T cell-deficient mice show delayed clearance of HSV-1 from the infected corneas as early as 4 dpi [42 , 43 ], suggesting some involvement of CD4+ T cells in controlling early HSV-1 replication in the cornea. Moreover, a possible role for CD4+ T cells in establishing an environment within the infected cornea, which favors subsequent development of HSK, is the subject of current investigation.

By 15 dpi, infected corneas of BALB/c mice uniformly develop severe HSK in our model. At this time, OX40+ cells represented 15% of the CD4+ T cells present in the cornea. OX40 expression does not identify all activated CD4+ T cells, as 25% of the CD4+ T cells in the cornea at this time express the CD69 activation marker [42 ]. However, the frequency of OX40+ cells does closely approximate that of HSV-1-specific CD4+ T cells in the cornea, as defined by IFN-{gamma} production following HSV-1 stimulation [42 ]. Based on these observations, we tentatively suggest that OX40 expression might require TCR signaling, whereas CD69 might reflect antigen-specific and bystander activation. Additional studies will be required to substantiate this hypothesis.

The concept that OX40/OX40L costimulation is required for CD4+ T cell immunopathology in HSV-1-infected corneas received further initial support from the observed appearance of OX40L+ CD45+ cells at the onset of HSK. However, a cautionary note arose when OX40L+ cells failed to coexpress MHC Class II. Although it is theoretically possible for costimulatory signals to be delivered in trans, this would require simultaneous interaction of a CD4+ T cell with a MHC Class II-positive APC capable of presenting antigenic epitopes and an OX40L+ cell capable of delivering a costimulatory signal by ligating OX40 on the T cell. Moreover, previous studies established an important role for Langerhans cells in activating CD4+ T cells in HSV-1-infected corneas [7 ], and the OX40L+ cells also lacked coexpression of the Langerhans cell marker, CD11c.

Two blocking strategies were used to definitively assess the requirement for OX40/OX40L costimulation in HSK. We initially used a systemic treatment regimen with an antagonist anti-OX40L mAb, which has been used successfully to reduce the inflammation associated with EAE [44 ], colitis [45 ], GVHD [27 ], and RA [23 ]. Systemic treatment was initiated 1 dpi, and the last treatment was administered at the onset of HSK on 7 dpi. Treatment had no effect on the incidence, kinetics, or severity of HSK development. Thus, OX40/OX40L interaction is not required for the initiation of HSK. This was not a particularly surprising finding, as OX40L was never detected in the DLN, OX40L was not detected in the cornea until 7 dpi, and OX40/OX40L interaction is typically found to be involved in the effector phase of immunopathological responses [29 ].

A second treatment approach was to inject a blocking reagent locally (subconjunctivally) during the period of HSK development. Subconjunctival injections have been used successfully to achieve diffusion of mAb throughout the cornea in this and previous studies [8 ]. Even when a dose of 50 µg mAb or 10 µg OX40-Fc fusion protein was administered every other day from 7 dpi to 19 dpi, no effect on the incidence or severity of HSK was observed. The fact that the anti-OX40L mAb, penetrated effectively into the central cornea following subconjunctival injection, was shown to block binding of a commercially available anti-OX40L mAb to OX40L-transfected cells in vitro and yet failed to influence the development of HSK provides compelling evidence that OX40/OX40L costimulation is not required for this CD4+ T cell-regulated, inflammatory process.

Although our studies failed to establish a requirement for OX40/OX40L costimulation in HSK, a contribution of this costimulatory pair cannot be ruled out. The involvement of costimulatory pathways at inflammatory sites is likely to prove quite complex. For instance, redundancy in the costimulatory pathways that operate in this immunoinflammatory disease might obfuscate the effect of blocking any one pathway. Moreover, further characterization of the OX40L+, CD45+, MHC Class II–, CD11c– population in the infected corneas could prove to be quite interesting. A network of MHC Class II-negative macrophages has been described in normal murine corneal stromas, although their functional relevance has yet to be determined [30 , 46 ]. Although OX40L was not detected in normal corneas, resident corneal macrophages might acquire OX40L expression following infection. If confirmed, this phenotypic change would encourage further investigation of the possible immunoregulatory properties of these cells in the cornea. Another intriguing question raised by our findings is why infiltrating DC, which have been shown to express MHC Class II and the inducible costimulatory molecules B7.1 and B7.2 [8 ], fail to express OX40L within the HSV-1-infected cornea and in the lymph nodes draining the cornea. Is OX40L expression on corneal DC modulated by the virus? Alternatively, might the microenvironment of the cornea influence expression of costimulatory molecules on DC? The answers to these questions could provide a better understanding of the immune response in the cornea in general, and of the immune response to HSV-1 in particular.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by grants RO1 EY010359 and P30-EY08098 from the National Eye Institute, National Institutes of Health (Bethesda, MD, USA), by an unrestricted research grant (R. L. H.) from Research to Prevent Blindness, Inc. (New York, NY, USA), and by a grant from the Eye and Ear Foundation of Pittsburgh (PA, USA; to R. L. H.).

Received April 26, 2006; revised October 20, 2006; accepted October 22, 2006.


arrow
REFERENCES
 
    1
  1. Metcalf, J. F., Hamilton, D. S., Reichert, R. W. (1979) Herpetic keratitis in athymic (nude) mice Infect. Immun. 26,1164-1171[Abstract/Free Full Text]
    2. 2
  2. Russell, R. G., Nasisse, M. P., Larsen, H. S., Rouse, B. T. (1984) Role of T-lymphocytes in the pathogenesis of herpetic stromal keratitis Invest. Ophthalmol. Vis. Sci. 25,938-944[Abstract/Free Full Text]
    3. 3
  3. Hendricks, R. L., Tumpey, T. M., Finnegan, A. (1992) IFN-{gamma} and IL-2 are protective in the skin but pathologic in the corneas of HSV-1-infected mice J. Immunol. 149,3023-3028[Abstract]
    4. 4
  4. Tang, Q., Hendricks, R. L. (1996) Interferon {gamma} regulates platelet endothelial cell adhesion molecule 1 expression and neutrophil infiltration into herpes simplex virus-infected mouse corneas J. Exp. Med. 184,1435-1447[Abstract/Free Full Text]
    5. 5
  5. Tang, Q., Chen, W., Hendricks, R. L. (1997) Proinflammatory functions of IL-2 in herpes simplex virus corneal infection J. Immunol. 158,1275-1283[Abstract]
    6. 6
  6. Niemialtowski, M. G., Rouse, B. T. (1992) Predominance of Th1 cells in ocular tissues during herpetic stromal keratitis J. Immunol. 149,3035-3039[Abstract]
    7. 7
  7. Hendricks, R. L., Janowicz, M., Tumpey, T. M. (1992) Critical role of corneal Langerhans cells in the CD4- but not CD8-mediated immunopathology in herpes simplex virus-1-infected mouse corneas J. Immunol. 148,2522-2529[Abstract]
    8. 8
  8. Chen, H., Hendricks, R. L. (1998) B7 costimulatory requirements of T cells at an inflammatory site J. Immunol. 160,5045-5052[Abstract/Free Full Text]
    9. 9
  9. Seo, S. K., Park, H. Y., Choi, J. H., Kim, W. Y., Kim, Y. H., Jung, H. W., Kwon, B., Lee, H. W., Kwon, B. S. (2003) Blocking 4-1BB/4-1BB ligand interactions prevents herpetic stromal keratitis J. Immunol. 171,576-583[Abstract/Free Full Text]
    10. 10
  10. Koch, F., Stanzl, U., Jennewein, P., Janke, K., Heufler, C., Kämpgen, E., Romani, N., Schuler, G. (1996) High level IL-12 production by murine dendritic cells: upregulation via MHC class II and CD40 molecules and downregulation by IL-4 and IL-10 J. Exp. Med. 184,741-746[Abstract/Free Full Text]
    11. 11
  11. Cella, M., Scheidegger, D., Palmer-Lehmann, K., Lane, P., Lanzavecchia, A., Alber, G. (1996) Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation J. Exp. Med. 184,747-752[Abstract/Free Full Text]
    12. 12
  12. Karni, A., Koldzic, D. N., Bharanidharan, P., Khoury, S. J., Weiner, H. L. (2002) IL-18 is linked to raised IFN-{gamma} in multiple sclerosis and is induced by activated CD4(+) T cells via CD40-CD40 ligand interactions J. Neuroimmunol. 125,134-140[CrossRef][Medline]
    13. 13
  13. Xu, M., Lepisto, A. J., Hendricks, R. L. (2004) CD154 signaling regulates the Th1 response to herpes simplex virus-1 and inflammation in infected corneas J. Immunol. 173,1232-1239[Abstract/Free Full Text]
    14. 14
  14. Mallett, S., Fossum, S., Barclay, A. N. (1990) Characterization of the MRC OX40 antigen of activated CD4 positive T lymphocytes—a molecule related to nerve growth factor receptor EMBO J. 9,1063-1068[Medline]
    15. 15
  15. Latza, U., Durkop, H., Schnittger, S., Ringeling, J., Eitelbach, F., Hummel, M., Fonatsch, C., Stein, H. (1994) The human OX40 homolog: cDNA structure, expression and chromosomal assignment of the ACT35 antigen Eur. J. Immunol. 24,677-683[Medline]
    16. 16
  16. Calderhead, D. M., Buhlmann, J. E., van den Eertwegh, A. J., Claassen, E., Noelle, R. J., Fell, H. P. (1993) Cloning of mouse Ox40: a T cell activation marker that may mediate T-B cell interactions J. Immunol. 151,5261-5271[Abstract]
    17. 17
  17. Ohshima, Y., Tanaka, Y., Tozawa, H., Takahashi, Y., Maliszewski, C., Delespesse, G. (1997) Expression and function of OX40 ligand on human dendritic cells J. Immunol. 159,3838-3848[Abstract]
    18. 18
  18. Brocker, T., Gulbranson-Judge, A., Flynn, S., Riedinger, M., Raykundalia, C., Lane, P. (1999) CD4 T cell traffic control: in vivo evidence that ligation of OX40 on CD4 T cells by OX40-ligand expressed on dendritic cells leads to the accumulation of CD4 T cells in B follicles Eur. J. Immunol. 29,1610-1616[CrossRef][Medline]
    19. 19
  19. Murata, K., Ishii, N., Takano, H., Miura, S., Ndhlovu, L. C., Nose, M., Noda, T., Sugamura, K. (2000) Impairment of antigen-presenting cell function in mice lacking expression of OX40 ligand J. Exp. Med. 191,365-374[Abstract/Free Full Text]
    20. 20
  20. Imura, A., Hori, T., Imada, K., Ishikawa, T., Tanaka, Y., Maeda, M., Imamura, S., Uchiyama, T. (1996) The human OX40/gp34 system directly mediates adhesion of activated T cells to vascular endothelial cells J. Exp. Med. 183,2185-2195[Abstract/Free Full Text]
    21. 21
  21. Weinberg, A. D., Wegmann, K. W., Funatake, C., Whitham, R. H. (1999) Blocking OX-40/OX-40 ligand interaction in vitro and in vivo leads to decreased T cell function and amelioration of experimental allergic encephalomyelitis J. Immunol. 162,1818-1826[Abstract/Free Full Text]
    22. 22
  22. Baum, P. R., Gayle, R. B., III, Ramsdell, F., Srinivasan, S., Sorensen, R. A., Watson, M. L., Seldin, M. F., Baker, E., Sutherland, G. R., Clifford, K. N. (1994) Molecular characterization of murine and human OX40/OX40 ligand systems: identification of a human OX40 ligand as the HTLV-1-regulated protein gp34 EMBO J. 13,3992-4001[Medline]
    23. 23
  23. Yoshioka, T., Nakajima, A., Akiba, H., Ishiwata, T., Asano, G., Yoshino, S., Yagita, H., Okumura, K. (2000) Contribution of OX40/OX40 ligand interaction to the pathogenesis of rheumatoid arthritis Eur. J. Immunol. 30,2815-2823[CrossRef][Medline]
    24. 24
  24. Tittle, T. V., Weinberg, A. D., Steinkeler, C. N., Maziarz, R. T. (1997) Expression of the T-cell activation antigen, OX-40, identifies alloreactive T cells in acute graft-versus-host disease Blood 89,4652-4658[Abstract/Free Full Text]
    25. 25
  25. Sugamura, K., Ishii, N., Weinberg, A. D. (2004) Therapeutic targeting of the effector T-cell co-stimulatory molecule OX40 Nat. Rev. Immunol. 4,420-431[CrossRef][Medline]
    26. 26
  26. Weinberg, A. D., Vella, A. T., Croft, M. (1998) OX-40: life beyond the effector T cell stage Semin. Immunol. 10,471-480[CrossRef][Medline]
    27. 27
  27. Tsukada, N., Akiba, H., Kobata, T., Aizawa, Y., Yagita, H., Okumura, K. (2000) Blockade of CD134 (OX40)-CD134L interaction ameliorates lethal acute graft-versus-host disease in a murine model of allogeneic bone marrow transplantation Blood 95,2434-2439[Abstract/Free Full Text]
    28. 28
  28. Akiba, H., Oshima, H., Takeda, K., Atsuta, M., Nakano, H., Nakajima, A., Nohara, C., Yagita, H., Okumura, K. (1999) CD28-independent costimulation of T cells by OX40 ligand and CD70 on activated B cells J. Immunol. 162,7058-7066[Abstract/Free Full Text]
    29. 29
  29. Weinberg, A. D. (2002) OX40: targeted immunotherapy—implications for tempering autoimmunity and enhancing vaccines Trends Immunol. 23,102-109[CrossRef][Medline]
    30. 30
  30. Brissette-Storkus, C. S., Reynolds, S. A., Lepisto, A. J., Hendricks, R. L. (2002) Identification of a novel macrophage population in the normal mouse corneal stroma Invest. Ophthalmol. Vis. Sci. 43,2264-2271[Abstract/Free Full Text]
    31. 31
  31. Flynn, S., Toellner, K. M., Raykundalia, C., Goodall, M., Lane, P. (1998) CD4 T cell cytokine differentiation: the B cell activation molecule, OX40 ligand, instructs CD4 T cells to express interleukin 4 and upregulates expression of the chemokine receptor, Blr-1 J. Exp. Med. 188,297-304[Abstract/Free Full Text]
    32. 32
  32. Yu, S., Medling, B., Yagita, H., Braley-Mullen, H. (2001) Characteristics of inflammatory cells in spontaneous autoimmune thyroiditis of NOD.H-2h4 mice J. Autoimmun. 16,37-46[CrossRef][Medline]
    33. 33
  33. Xu, M., Lepisto, A. J., Hendricks, R. L. (2002) Co-stimulatory requirements of effector T cells at inflammatory sites DNA Cell Biol. 21,461-465[CrossRef][Medline]
    34. 34
  34. Greenwald, R. J., Freeman, G. J., Sharpe, A. H. (2005) The B7 family revisited Annu. Rev. Immunol. 23,515-548[CrossRef][Medline]
    35. 35
  35. Khanna, K. M., Lepisto, A. J., Decman, V., Hendricks, R. L. (2004) Immune control of herpes simplex virus during latency Curr. Opin. Immunol. 16,463-469[CrossRef][Medline]
    36. 36
  36. Khanna, K. M., Lepisto, A. J., Hendricks, R. L. (2004) Immunity to latent viral infection: many skirmishes but few fatalities Trends Immunol. 25,230-234[CrossRef][Medline]
    37. 37
  37. Biswas, P. S., Rouse, B. T. (2005) Early events in HSV keratitis—setting the stage for a blinding disease Microbes Infect. 7,799-810[Medline]
    38. 38
  38. Higgins, L. M., McDonald, S. A., Whittle, N., Crockett, N., Shields, J. G., MacDonald, T. T. (1999) Regulation of T cell activation in vitro and in vivo by targeting the OX40-OX40 ligand interaction: amelioration of ongoing inflammatory bowel disease with an OX40-IgG fusion protein, but not with an OX40 ligand-IgG fusion protein J. Immunol. 162,486-493[Abstract/Free Full Text]
    39. 39
  39. Bansal-Pakala, P., Halteman, B. S., Cheng, M. H., Croft, M. (2004) Costimulation of CD8 T cell responses by OX40 J. Immunol. 172,4821-4825[Abstract/Free Full Text]
    40. 40
  40. Khanna, K. M., Bonneau, R. H., Kinchington, P. R., Hendricks, R. L. (2003) Herpes simplex virus-specific memory CD8+ T cells are selectively activated and retained in latently infected sensory ganglia Immunity 18,593-603[CrossRef][Medline]
    41. 41
  41. Liu, T., Khanna, K. M., Chen, X., Fink, D. J., Hendricks, R. L. (2000) CD8(+) T cells can block herpes simplex virus type 1 (HSV-1) reactivation from latency in sensory neurons J. Exp. Med. 191,1459-1466[Abstract/Free Full Text]
    42. 42
  42. Lepisto, A. J., Frank, G. M., Xu, M., Stuart, P. M., Hendricks, R. L. (2006) CD8 T cells mediate transient herpes stromal keratitis in CD4-deficient mice Invest. Ophthalmol. Vis. Sci. 47,3400-3409[Abstract/Free Full Text]
    43. 43
  43. Ghiasi, H., Cai, S., Perng, G. C., Nesburn, A. B., Wechsler, S. L. (2000) Both CD4+ and CD8+ T cells are involved in protection against HSV-1 induced corneal scarring Br. J. Ophthalmol. 84,408-412[Abstract/Free Full Text]
    44. 44
  44. Nohara, C., Akiba, H., Nakajima, A., Inoue, A., Koh, C. S., Ohshima, H., Yagita, H., Mizuno, Y., Okumura, K. (2001) Amelioration of experimental autoimmune encephalomyelitis with anti-OX40 ligand monoclonal antibody: a critical role for OX40 ligand in migration, but not development, of pathogenic T cells J. Immunol. 166,2108-2115[Abstract/Free Full Text]
    45. 45
  45. Malmstrom, V., Shipton, D., Singh, B., Al Shamkhani, A., Puklavec, M. J., Barclay, A. N., Powrie, F. (2001) CD134L expression on dendritic cells in the mesenteric lymph nodes drives colitis in T cell-restored SCID mice J. Immunol. 166,6972-6981[Abstract/Free Full Text]
    46. 46
  46. Hamrah, P., Zhang, Q., Liu, Y., Dana, M. R. (2002) Novel characterization of MHC class II-negative population of resident corneal Langerhans cell-type dendritic cells Invest. Ophthalmol. Vis. Sci. 43,639-646[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
M. Walch, S. K. Rampini, I. Stoeckli, S. Latinovic-Golic, C. Dumrese, H. Sundstrom, A. Vogetseder, J. Marino, D. L. Glauser, M. van den Broek, et al.
Involvement of CD252 (CD134L) and IL-2 in the Expression of Cytotoxic Proteins in Bacterial- or Viral-Activated Human T Cells
J. Immunol., June 15, 2009; 182(12): 7569 - 7579.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0406293v1
81/3/766    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lepisto, A. J.
Right arrow Articles by Hendricks, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lepisto, A. J.
Right arrow Articles by Hendricks, R. L.