|
|
||||||||
Published online before print December 6, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



* Section on Immunology and Immunogenetics and
|| Genetics and Epidemiology, Joslin Diabetes Center, and
¶ Center for Neurologic Diseases, Brigham and Womens Hospital, Harvard Medical School, Boston, Massachusetts, USA;
Department of Internal Medicine, Polyclinic of the Hospitaller Brothers of St. John, Budapest, Hungary;
Department of Immunology and Biotechnology, Faculty of Medicine, University of Pecs, Pecs, Hungary; and
III. Department of Medicine, Bajcsy-Zsilinszky Hospital, Budapest, Hungary
1 Correspondence: Section on Immunology and Immunogenetics, Joslin Diabetes Center, One Joslin Place, Boston, MA, 02215, USA. E-mail: tihamer.orban{at}joslin.harvard.edu
| ABSTRACT |
|---|
|
|
|---|
-chain with 6B11-FITC and V
24-PE. After sorting the V
24+6B11+ cells, the generated iNKT clones were characterized. We tested CD4, CD8, and CD161 expression and IL-4 and IFN-
production on TCR stimulation. The CD4+ population among the iNKT cells was decreased significantly in ltT1DM versus ndT1DM, ltT2DM, or H individuals. The T1DM iNKT cell cytokine profile markedly shifted to the Th1 direction. There was no difference in the frequency of iNKT cells in PBMC among the different patient groups. The decrease in the CD4+ population among the iNKT cells and their Th1 shift indicates dysfunction of these potentially important regulatory cells in T1DM.
Key Words: autoimmunity V
24+6B11+ cells cytokines
| INTRODUCTION |
|---|
|
|
|---|
24J
Q
-chain (V
14J
18 in mice) without nucleotide insertions. Thus, these cells are referred to as invariant NKT (iNKT) cells. They are also known as Type I or classical NKT cells [1
]. The invariant V
24J
Q
-chain preferentially pairs with the Vß11 ß-chain in humans [2
].
The invariant germ-line TCR, expressed by these iNKT cells, is unique, as it interacts with the nonclassical MHC molecule CD1d. The subset of NKT cells with diverse or semi-invariant
-chains is Type II or nonclassical NKT cells, which are also CD1d-dependent. Mice lacking CD1d or the J
18 of the TCR
-chain have no iNKT cells. One of the candidates for natural ligand presented by CD1d to the NKT cells is thought to be a GPI [3
]. Others reported that a lysosomal glycosphingolipid (isoglobotrichexosyl-ceramide) may be the endogenous ligand of the iNKT cells [4
]. After TCR stimulation, iNKT cells can rapidly produce large quantities of Th1 cytokines (IFN-
) as well as Th2 cytokines (IL-4) [5
]. Secreted cytokines can affect the differentiation of naive T cells and can also influence the inflammatory or anti-inflammatory response, thereby contributing to the innate and adaptive immune responses [6
]. Specifically, iNKT cells have an important role, not only in innate or early immune response but also in tumor surveillance and in adaptive immune regulation [5
]. The iNKT cells are defective in NOD mice [7
] and may also be defective in some human autoimmune diseases, such as Type 1 diabetes mellitus (T1DM), sclerosis multiplex, systemic sclerosis, systemic lupus erythematosus, and rheumatoid arthritis [8
]. Recently, there has been great interest in the possible applications of iNKT cells as a therapeutic modality for treating autoimmune diseases and malignancies [9
, 10
].
The origin and development of iNKT cells are currently the subject of intensive research. Current data indicate that the thymus is involved in early iNKT cell development [11 ]. In mice, the peripheral distribution of iNKT cells varies between organs. For example, in the liver, 3040% of T cells are iNKT cells and in bone marrow, only 2030%. The data about human iNKT cell frequencies in different tissues are essentially limited to blood; however, some results indicate that iNKT cells are also present in the liver [12 13 14 15 ].
In humans, the iNKT cells are segregated into three subsets: CD4+, CD4CD8 [double-negative (DN)], and CD8+ [2 ]. In mice, there are only two subsets: CD4+ and DN. Experimental human data suggest that upon stimulation, the CD4+ subset produces relatively more IL-4 than the DN subset [16 ]. This may indicate a more prominent, immune-regulatory function for the CD4+ than for the DN or CD8+ subgroups.
The CD161 (NKR-P1) is a NK locus encoded on a C-type lectin, and its expression is dependent on the maturation level of the iNKT cell [17 ]. The CD161 may function as a costimulatory molecule for TCR-mediated recognition of CD1d by human iNKT cells [18 ].
The data about iNKT cell frequency in human T1DM are contradictory. The frequency of iNKT cells has been reported to decrease [19
, 20
], increase [21
], or remain unaltered [16
] in the peripheral blood of T1DM patients as compared with control subjects. In these studies, different combinations of TCR-specific antibodies [V
24, Vß11, CD3, 6B11 (antibody against the invariant part of the TCR
-chain)], different surface markers (CD161, CD56), and
-galactosyl-ceramide (
-GalCer)-loaded tetramer (CD1d tetramer) were used to identify iNKT cells. The application of these diverse methods may be the source of the inconsistent findings, as the different methods may identify different populations [1
, 8
, 22
, 23
].
We aimed to study the frequency and the function of different iNKT cell subgroups in patients with T1DM. We concluded that the V
24/6B11 costaining, described earlier by Exley, Wilson, and co-workers [24
, 25
], is a reliable method to detect iNKT cells. We used this costaining to single cell-sort the V
24+6B11+ cells. We characterized the clones by CD4, CD8, and CD161 expression and measured the IL-4 and IFN-
production upon TCR stimulation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
The frozen PBMC were thawed, washed twice with PBS, and stained with 6B11-FITC (1:20 dilution, BD Biosciences PharMingen, San Diego, CA, USA) and V
24-PE (1:50 dilution, Beckman Coulter, Fullerton, CA, USA). Both antibody preparations were dialyzed in sterile PBS using Slide-A-Lyzer dialysis cassettes (Pierce, Rockford, IL, USA). The staining media consisted of PBS and 0.5% heat-inactivated, human AB serum (Omega). Ten million cells, in 0.5 ml staining media, were incubated on ice for 30 min with labeled antibodies. The V
24- and 6B11-positive cells were sorted (FACSVantage cell sorter, Becton Dickinson, San Jose, CA, USA) into 96-well, round-bottom, polystyrene plates (Corning, Corning, NY, USA). The plates were prepared with irradiated (4000 rad), allogenic feeder cells (150,000/wells) and media [200 µl/wells (RPMI-1640, supplemented with 1% 1 M HEPES, 1% sodium pyruvate, 1% glutamate, 1% penicillin/streptomycin, all from BioWhittaker Cambrex, Walkersville, MD, USA), 1% MEM (amino acid solution from Gibco, Invitrogen, Grand Island, NY, USA), and 5% heat-inactivated, human AB serum (Omega)] with 20 U/ml recombinant (r)IL-2 (TecinTM Teceleukin Bulk Ro 23-6019, National Cancer Institute-Frederick, Frederick, MD, USA) and 3 µg/mL PHA-P (Remel Inc., Lenexa, KS, USA). Every 2nd day, 100 µl media was replaced containing 40 U/ml rIL-2. No NKT cell-specific stimulation was used. The surviving clones became visible after 911 days of culturing.
Second staining of the NKT cell clones
The surviving clones were cultured and divided into new wells over 810 additional days to get 0.52 x 106 cells from each clone. During this culturing phase, we did not use NKT cell-specific stimulation. The media were supplemented with 40 U/ml rIL-2. The clones were restained with V
24-FITC, Vß11-PE (Beckman Coulter), CD4-FITC, CD8-PECy5, 6B11-PE, and CD161-PE (all from BD Biosciences PharMingen) and were measured by Beckman Coulter XL FACS (Beckman Coulter). FITC-labeled antibody preparations were used in 1:20; PE-labeled antibodies were used in 1:50 dilutions. FACS results were analyzed with WinMDI 2.8. The percentage of cells with identical staining was evaluated to verify the purity of each clone.
RNA extraction
After thawing the clones, the RNA extraction was carried out using RNAEasy Microkit® (Qiagen GmbH, Hilden, Germany) according to the manufacturers protocol (including DNase digestion). The matrix-bounded RNA was resuspended in diethylpyrocarbonate-treated water and quantified at 260 nm. The quality of the total RNA was confirmed by 1% agarose gel analysis.
RT-PCR and sequencing
The cDNA was produced from the total RNA with Superscript II RT (Invitrogen, Carlsbad, CA, USA) in 25 µl reactions with random hexamers following the manufacturers protocol. The resulting cDNA was stored at 20ºC. Primers were designed around the V-J-C rearrangement region of the
-chain of the TCR [29
, 30
]. Forward primer (V
24 region-specific): 5'-GATATACAGCAACTCTGGATGCA-3'; reverse primer (C region-specific): 5'-GGCAGACAGACTTGTCACTGGAT-3'. PCR was performed on the cDNA using Platinum® Taq DNA polymerase (Invitrogen) in 50 µl reactions, according to the manufacturers protocol. Final primer concentration of 10 µM was used to amplify the DNA. The annealing temperature was 52ºC. The cDNA quality was confirmed in all cases by using GAPDH as a housekeeping gene. Amplified DNA was visualized on 2% agarose gels containing 1 µg/ml ethidium bromide, run in 0.5x Tris-boric acid-EDTA buffer (45 mM Tris-borate, 1 mM EDTA, pH 8.0). DNA templates (230 bp) were recovered from PCR products with a QIAquickTM PCR purification kit (Qiagen GmbH), and quality was confirmed by 2% agarose gel analysis before sequencing. Templates were sequenced with a ABI3100 sequencer from both sides with forward and reverse primers.
Measurement of cytokine production by ELISA
Round-bottom polystyrene plates (Corning) were coated with 1 µg/ml anti-CD3 (
-CD3; Exalpha Biologicals Inc., Watertown, MA, USA) in 50 µl/well PBS at 37°C for 2 h. We cultured the iNKT cells (50,000/well) from all of the clones that yielded enough cells to run the stimulation assay with and without
-CD3 in duplicate for a total of 24 h. After 4 and 24 h, the supernatants were taken out for cytokine ELISA. The antibodies and standards for IL-4 and IFN-
were purchased from BD Biosciences PharMingen and used according to the manufacturers protocol. Avidin-peroxidase conjugate and 3,4,5-trimethoxybenzoic acid substrate (all from BD Biosciences PharMingen) were used to develop the assay.
Statistical analysis
Statistical analysis was performed by StatView for Windows 5.0.1. (SAS Institute Inc., Cary, NC, USA). Group comparisons for data with normal distribution were performed by one-way ANOVA and Scheffe post hoc tests; in case of non-Gaussian distribution, the Kruskal-Wallis test was used, followed by the Mann-Whitney U test with Bonferroni correction of the
as post hoc analysis. Results are expressed as mean ± SEM; P < 0.05 was considered statistically significant.
| RESULTS |
|---|
|
|
|---|
24-PE, the double-positive cells were single cell-sorted into 96-well plates. Because of the low frequency of iNKT cells, we used at least 10 million cells for each frequency analysis and sorting (Fig. 1A
). To check the reproducibility, we stained the same samples at two different times and FACS analyzed them using two different instruments. The correlation between the frequencies of the iNKT cells was r = 0.97 (Fig. 1B)
.
|
20 days of culturing, each of the generated clones contained 0.52 million cells. The survival rate of the sorted cells was between 5% and 25%.
Confirmation of the invariant TCR of the clones by second staining and by RT-PCR and sequencing
All clones were restained with V
24-FITC, and 80% (285/354) were positive. All of the randomly selected, V
24-positive clones were also 6B11-positive (67/67; Fig. 2A
). The V
24-negative clones were excluded from the following characterization, or they were used as negative controls.
|
24-positive and from five V
24-negative clones. The produced cDNA quality was confirmed in all cases (GAPDH was used as a housekeeping gene). Using the V
24 region-specific forward primer and the C region-specific reverse primer, 230 bp DNA templates were recovered from all V
24+ clones (52/52), but there was no relevant PCR product from any of the V
24 negative clones. The sequence of the templates in all of the clones (52/52) showed the canonical TCR sequence: TGTGTGGTGAGCGACAGAGGCTCAACC, Cys-Val-Val-Ser-Asp-Arg-Gly-Ser-Thr.
The frequency of the iNKT cells
As we confirmed the V
24 and 6B11 costaining technique to be reproducible and as it identifies iNKT cells with a high positive predictive value, we used it to measure the iNKT cell frequency in PBMC. There was a wide range in the percentage of V
24+ and 6B11+ cells (0.0020.4%) among the lymphocytes; however, there was no difference among the subject groups (Fig. 3
).
|
24-positive clones were characterized by the expression of Vß11, CD4, CD8, and CD161. Figure 2B
2C
2D
2E
2F
, shows representative examples of different clones. Table 2
shows the detailed characterization of the clones. As expected, the majority of the iNKT cells had the most common (Vß11) ß-chain, and there was no significant difference among the different sets of patients. The expression of CD161 was highly variable, without significant difference among the different sets of patients. On the iNKT cells, the expression of CD4 was frequent among H subjects, ltT2DM, and ndT1DM patients and was found reduced significantly (one-way ANOVA, P=0.0032; Scheffe post hoc test, HltT1DM, P=0.0181; ndT1DMltT1DM, P=0.0376; ltT1DMltT2DM, P=0.0082) in ltT1DM patients (Fig. 4A
). As the frequency of the clones positive for these surface characteristics was calculated from a limited number of clones for each patient, we also confirmed these findings with direct staining from PBMC. We used only three samples with high iNKT cell frequency from each patient group, as it is technically difficult to calculate the ratios of the iNKT cell subpopulations in PBMC with low iNKT cell frequency. After staining with the same stains that we used for sorting and frequency measurement (V
24, 6B11) and with CD4-PECy5, we gated on the V
24+6B11+ cells and measured the CD4+ ratio. The results were similar (one-way ANOVA, P=0.0007; Scheffe post hoc test, HltT1DM, P=0.0017; ndT1DMltT1DM, P=0.0023; ltT2DMltT1DM, P=0.0091; Fig. 4B
and 4C
).
|
|
Cytokine production of the clones
After TCR stimulation of the iNKT cell (50,000/well) clones, IL-4 and IFN-
production was measured by ELISA from the supernatant. There was no correlation among the stimulation index values measured by H3-methylthymidine incorporation and the cytokine production (data not shown). Only clones from the T1DM groups (the ndT1DM and ltT1DM) produced more IFN-
than the mean + 3 SD of the IFN-
values of the H iNKT cell clones, suggesting that the T1DM clones are higher IFN-
producers (Fig. 5
).
|
The iNKT cells of ndT1DM patients produced more IFN-
than those of the H and ltT2DM subjects (HndT1DM, P=0.0054; ndT1DMltT2DM, P=0.0006; Fig. 6A
). Among the ndT1DM iNKT clones, the CD4+ ones produced more IFN-
than those of the ltT1DM and ltT2DM groups (P=0.0024 and P=0.0126, respectively), and the CD4CD8 (DN) clones of the ndT1DM group produced more than those of the H group (P=0.036). In the ltT1DM group, significantly higher IFN-
production of the CD4+ clones was found compared with the DN cells (P=0.0399; Fig. 6B
).
|
| DISCUSSION |
|---|
|
|
|---|
-GalCer-loaded CD1d tetramer was designed to be a specific and sensitive method to identify iNKT cells [32
]. Lee et al. [16
] reported high specificity of this tetramer in identifying iNKT cells in conjunction with V
24 staining. However, others have suggested that not only the iNKT cells but also other V
24-negative T cells with diverse V
and Vß TCR chains could recognize the
-GalCer-loaded CD1d tetramer [17
, 22
, 23
].
We confirmed by two independent techniques that the V
24/6B11 costaining is a reliable method to detect iNKT cells. Eighty percent of the clones obtained this way were subsequently confirmed to be iNKT cells. The remaining 20% represented unspecific binding and also other technical challenges (insufficiency of the sorting and possible contamination with other cells during the culturing period, among others). There was no correlation between the V
24+6B11+ cell frequency in PBMC and the effectiveness of the sorting (data not shown). The reproducibility of this method was r = 0.97. We tested the specificity of this method with two independent techniques (second staining and RT-PCR/sequencing of the invariant part of the TCR). These independent confirmations support the notion that the method using this double-staining (V
24 and 6B11) identifies iNKT cells reliably; thus, it is well-suited for studying these cells from human peripheral blood.
We did not find differences in the V
24+6B11+ cell frequency among the H, ndT1DM, ltT1DM, and ltT2DM subjects. By including not only the H but also the ltT2DM patient group as controls, we could rule out the effect of glucose homeostasis on these results.
There is also contradictory data about ratios of the iNKT cell subpopulations. Previous studies have reported the ratios in wide ranges: DN, 1771%; CD4+, 2590%; CD8+, 155% [33 , 34 ]. They used different methods to detect iNKT cells and/or used different techniques to expand them [17 , 35 , 36 ].
Similar to most of the reports about the CD8+ cell frequency, in our experiments, the CD8+ subpopulation frequency was low. There was no significant difference among the patient sets. However, the CD4+ ratio of the iNKT clones was decreased significantly in ltT1DM patients. This result was confirmed using direct staining of the nonmanipulated PBMC. There was also a tendency of a lower CD4+ ratio in the ndT1DM patients compared with the H or ltT2DM subjects. The reason for this finding is unclear. One might hypothesize that the current technology is not sensitive enough to detect the decreased CD4+ ratio early in the course of the disease, or there is a slow, continuous decrease of the CD4+ cells in T1DM. It is not likely to be connected to glucose homeostasis or insulin treatment, as it was not observed in the ltT2DM group.
There are limitations to direct staining and cloning approaches. For example, when the CD4+ ratio was calculated from the clones, the relatively low numbers of the clones could influence this ratio. Similarly, the direct measurement can be technologically difficult because of the low frequency of iNKT cells. However, there was no correlation between the original V
24+6B11+ cell frequency and the number of yielded clones. As expanding or cloning the cells can result in a biased population, we confirmed the decrease of the CD4+ iNKT cell population directly from PBMC.
In T1DM, especially in ndT1DM, the iNKT clones produced more IFN-
than in H or ltT2DM patients. This was also the case when we looked at the subpopulations (CD4+ and DN) separately.
It has been reported in healthy individuals and in T1DM patients that CD4+ iNKT cells produce relatively more IL-4 than the DN cells. The dominant IL-4 production suggests a possible regulatory effect of the CD4+ subpopulation [16 , 35 ]. In our dataset, there was no significant difference in IL-4 production between the CD4+ and DN iNKT clones in any of the subject groups.
Conversely, among the T1DM iNKT cells, the DN clones produced more IFN-
than the CD4+ clones. Our clones were prestimulated during the cloning, which can influence the cytokine production; however, the CD4+ and DN clones were stimulated the same way. Our results are in agreement with previous publications that the DN iNKT cells produce more Th1 cytokines.
There has been little published regarding CD8+ iNKT cell function. We studied 14 clones and found that they are low producers of IL-4 and IFN-
cytokines (data not shown). Although we analyzed a large number of iNKT cell clones (285), the number of CD8+ clones in each of the subject groups was too low to be included in the functional statistical analysis.
The significantly decreased CD4+ population, which favors the Th1 shift itself, and the increased IFN-
production of the total iNKT cell population, which is independent from the ratios of the subpopulations, cause a strong Th1 bias. These findings underline the importance of the Th1/Th2 theory and support the notion of Th1 bias in T1DM.
In conclusion, we identified a reliable and effective method to study iNKT cells in humans using 6B11/V
24 costaining, which we confirmed with two independent methods (second staining and PCR/sequencing). Using these techniques, we compared the frequency of V
24+6B11+ cells in PBMC and found no difference among ndT1DM, ltT1DM, ltT2DM, and H subjects. We characterized a large number (285) of iNKT clones, which produced significantly more Th1 cytokines in the ndT1DM group, signifying a Th1 bias in T1DM. We determined the ratios of the iNKT cell subpopulations and observed a decrease of the CD4+ ratio in ltT1DM patients.
| ACKNOWLEDGEMENTS |
|---|
Received November 1, 2006; revised November 9, 2006; accepted November 10, 2006.
| REFERENCES |
|---|
|
|
|---|
14i NKT cell lineage from double-positive thymocyte precursors Immunity 22,705-716[CrossRef][Medline]
24-J
Q and 
T cell receptor bearing cells Hum. Immunol. 60,20-31[CrossRef][Medline]
24-J
Q-independent, CD1d-restricted recognition of
-galactosylceramide by human CD4(+) and CD8
ß(+) T lymphocytes J. Immunol. 168,5514-5520
24 J
Q T cell receptor
chains J. Exp. Med. 188,867-876
24J
Q T cells in type 1 diabetes Nature 391,177-181[CrossRef][Medline]
24(+) vß11(+) T-cells observed in type 1 diabetes Diabetes Care 25,1818-1823
production by invariant NK T cells in advanced cancer J. Immunol. 167,4046-4050
/ß T cells demonstrates preferential use of several V ß genes and an invariant TCR
chain J. Exp. Med. 178,1-16
24-J
Q TCR
are CD4 and heterogeneous with respect to TCR ß expression Hum. Immunol. 48,63-67[CrossRef][Medline]
24+CD8+ NK T cells activated by
-galactosylceramide-pulsed monocyte-derived dendritic cells J. Immunol. 168,3140-3144
specifies a dendritic cell subtype capable of enhanced induction of iNKT cell expansion Immunity 21,95-106[CrossRef][Medline]This article has been cited by other articles:
![]() |
A. Yamaura, C. Hotta, M. Nakazawa, L. Van Kaer, and M. Minami Human invariant V{alpha}24+ natural killer T cells acquire regulatory functions by interacting with IL-10-treated dendritic cells Blood, April 15, 2008; 111(8): 4254 - 4263. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wu and L. V. Kaer Role of NKT Cells in the Digestive System. II. NKT cells and diabetes Am J Physiol Gastrointest Liver Physiol, November 1, 2007; 293(5): G919 - G922. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |