Journal of Leukocyte Biology eBioscience full spectrum cell analysis
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.0406278 on September 13, 2006

Published online before print September 13, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0406278v1
81/3/642    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saïdi, H.
Right arrow Articles by Bélec, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saïdi, H.
Right arrow Articles by Bélec, L.
(Journal of Leukocyte Biology. 2007;81:642-653.)
© 2007 by Society for Leukocyte Biology

IFN-{gamma}-activated monocytes weakly produce HIV-1 but induce the recruitment of HIV-sensitive T cells and enhance the viral production by these recruited T cells

Héla Saïdi1, Giuliana Magri, Cedric Carbonneil, Nadine Nasreddine, Mary Réquena and Laurent Bélec

Université Paris V, Unité INSERM U743 "Immunologie Humaine," Equipe "Immunité et Biothérapie Muqueuse," Centres de Recherches Biomédicales des Cordeliers, Paris, France

1 Correspondence: Centre de Recherches Biomédicales des Cordeliers, Unité INSERM U743 Equipe "Immunité et Biothérapie Muqueuse," 15 rue de l’Ecole de Médecine, 75270 Paris, Cedex 06, France. E-mail: hela.saidi{at}u430.bhdc.jussieu.fr

ABSTRACT

The ability of macrophages to adapt to changing cytokine environments results in the dominance of a particular functional phenotype of macrophages, which would play a significant role in HIV pathogenesis. In comparison with untreated macrophages (M0), we examined the role of macrophages derived from IFN-{gamma}-activated monocytes (M1) in the HIV spread. We show that M0 and M1 bind with the same efficiency HIV-1 with a predominant role of C-type lectins in the R5-HIV attachment and of the heparan sulfate proteoglycans in the X4-HIV attachment. Despite similar levels of R5- and X4-HIV DNA, M1 replicates and weakly transmits the virus to activated T cells by releasing CXCR4- and CCR5-interacting chemokines. The blockade of dendritic cell-specific ICAM-3-grabbing nonintegrin expressed on M1 by mAb does not interfere with the viral transfer. Uninfected M1 recruits HIV-sensitive T cells efficiently and releases soluble factors, enhancing the viral production by these recruited cells. This study highlights the role of IFN-{gamma} to induce a population of macrophages that archive HIV-1 within a latent stage and cause the persistence of the virus by favoring the recruitment of T cells or enhancing the viral replication in infected CD4+ T cells.

Key Words: adsorption • infection • transfer • cytokines • chemokines

INTRODUCTION

Macrophages play a central role in defense and in the control of infections by destroying invading pathogens directly or by secreting cytokines able to activate other arms of the innate or adaptive immune response. In HIV infection, macrophages are thought to play an ambiguous role acting as an antiviral defense system or as target cells. Macrophages may serve as sites for virus replication at late stages of AIDS when CD4+ T cells are depleted markedly or following withdrawal of viral inhibitor treatment [1 , 2 ]. Moreover, their interplay, as APCs or a source of chemotactic cytokines, with CD4+ T cells may favor intercell virus transmission [3 ]. Indeed, there is increasing interest in several aspects of macrophage infection, including the mechanism of HIV infection and their role in the pathogenesis of disease.

In response to changes in cytokine environment, macrophages can reversibly shift their functional phenotype through a multitude of patterns. This capacity of macrophages to respond specifically at microenvironment changes has important implication for therapeutic targeting of macrophages in chronic disease, which results in the dominance of particular functional phenotypes of macrophages [4 5 6 ]. It is well known that the early phase of HIV infection, which involves activation of T cells, is regulated by Th1 cytokines exemplified by IL-2 and IFN-{gamma}, which may favor virus replication in CD4+ T cells [7 ]. Elevated levels of plasma IFN-{gamma} were also detected in patients with HIV-1 in the absence of concurrent, opportunistic infections, and a high number of IFN-{gamma}-producing cells were detected in the peripheral blood compartment and in the germinal centers of lymph nodes during HIV disease [8 ].

We focused herein on two key questions we consider critical: How do changes in macrophages derived from IFN-{gamma}-activated monocytes influence their ability to be infected and to support viral replication? and How do changes in cytokines/chemokines released by macrophages derived from IFN-{gamma}-activated monocytes create an environment that would support the spread of HIV by implicating HIV-1-sensitive T cells? To this end, we first evaluated whether the activation of monocytes by IFN-{gamma} influenced the susceptibility of macrophages to HIV entry and the establishment of a productive infection. We evaluated the viral attachment that determines their ability to capture the virus and the intensity of viral replication by using the real-time PCR to quantify the viral DNA and the p24 ELISA as an indicator of virus production and spread capacity. According to a previous study, the HIV entry into macrophages and CD4+ T cells is mediated by interaction of the virus envelope with CD4 and CXCR4 [9 ] or CCR5 [10 , 11 ]. Virions can also interact with macrophages in several other ways including the heparan sulfate proteoglycans (HSPG) [12 13 14 ] or the mannose-binding protein (MBP) macrophages such as the macrophage mannose receptor (MR) and the dendritic cell-specific ICAM-3-grabbing nonintegrin (DC-SIGN) belonging to the mannose C-type lectin receptors [15 16 17 ]. These molecules concentrate virus particles on the target cell surface or transfer the virus to CD4+ T cells. Recently, macrophages derived from monocytes activated with Type 1 (IFN-{gamma}) or Type 2 (IL-4 and IL-13) cytokines were described to express the DC-SIGN molecule at their surface [15 ]. Accordingly, we also studied the implications of these MBP and HSPG on the HIV-1 adsorption and transmission. Then, we determined the consequences of the activation of monocytes by IFN-{gamma} on the expression of classical macrophage markers such as cytokines and chemokines, the recruitment of sensitive T lymphocytes, and the replication of HIV-1 by these recruited T cells.

This study, performed in a unique model of human monocyte-derived macrophages (MDM) using two viral strains, R5 and X4 tropic, shows that differentiation of monocytes in the presence of IFN-{gamma} does not interfere with the HIV-1 adsorption at the surface of the resulting macrophage population, but it exerts inhibitory effects on HIV-1 production and its subsequent transfer to activated T cells. Nevertheless, these macrophages derived from IFN-{gamma}-activated monocytes recruit CD4+ CXCR4+ CCR5+ T cells efficiently and released soluble factors that enhance the viral production by these recruited T cells. These soluble factors remain to be identified.

MATERIALS AND METHODS

MDM
PBMC were isolated from buffy coats of healthy adult donors by Ficoll density gradient centrifugation on medium for separation for lymphocytes (MSL). The percentage of monocytes was determined by flow cytometry using forward-scatter and side-scatter properties (FSC/SSC). PBMC were resuspended in RPMI-1640 medium supplemented with glutamine, penicillin (100 IU/ml), and streptomycin (100 µg/ml). Cells were seeded into 24-well plates (Costar, Cambridge, MA) at the concentration 1 x 106 adherent cells/ml and incubated at 37°C for 45 min. Nonadherent cells were removed by four washes. Adherent monocytes were incubated in RPMI medium with 10% FCS, glutamine, and antibiotics in the presence of 10 ng/ml recombinant human (rh)M-CSF, alone or in combination with rhIFN-{gamma} (10 ng/ml) to differentiate to macrophages for 6 days. The medium, including all supplements, was replaced the 3rd day of differentiation. Flow cytometry analysis demonstrated that the macrophages were more than 90% pure.

Purification of autologous T lymphocytes
T cells were subsequently prepared from the monocyte-depleted cell fraction. PBL were cultured for 48 h in fresh medium supplemented with PHA (2.5 µg/ml) and rhIL-2 (1 µg/ml). PBL were then washed and cultured in growth medium containing rhIL-2 (1 µg/ml) for 24 h.

Virus
Primary X4-HIV-1NDK (gifts from Prof. Françoise Barré-Sinoussi, Institut Pasteur, Paris, France) was grown in PBL of healthy donors stimulated with PHA and rhIL-2. R5-HIV-1Ba-L was amplified in MDM of healthy donors. Tropism of viruses was determined using U87 cells transfected with DNA encoding for human CD4 and CCR5 or CXCR4 [National Institutes of Health (NIH) AIDS Research and Reference Reagent Program, provided by Dr. Emmanuel Menue, Institut Pasteur]. The number of viral particles was assessed by the real-time RT-PCR. Briefly, RNA was isolated from HIV-infected cells on a silica column system according to the manufacturer’s recommendations (DNA or RNA mini kit, Qiagen AG, Basel, Switzerland). HIV-1 RNA quantification was carried out by RT-PCR using primers (forward: 5'-GGCGCCACTGCTAGAGATTTT-3'; reverse: 5'-GCCTCAATAAAGCTTGCCTTGA-3') and exonucelase probe (5'-FAM-AAGTAGTGTGTGCCCGTCTGTTRTKTGACT-TAMRA-3'), designed to amplify a fragment in the long terminal repeat (LTR) gene. RT and amplification were achieved in a one-step RT-PCR using the LightCycler RNA Master Hybridization Probes kit (Roche Diagnostics Corp., Nutley, NJ; a standard graph of the heat capacity at constant pressure values was obtained from serial dilutions, 106–10 copies per assay, of the HIV-1 subtype A strain). Similar concentrations (expressed in copies/ml) of HIV-1Ba-L and HIV-1NDK solution stocks were used.

Cytokines, antibodies, and reagents
rhM-CSF, rhIFN-{gamma}, and rhIL-2 were obtained from Peprotech (Rocky Hill, NJ). Anti-CD4 mAb (PE-CD4, RPA-T4), anti-CCR5 (PE-CCR5, 2D7), anti-CXCR4 (PE-CXCR4, 12G5), anti-CD11b (FITC-CD11b, BEAR-1), anti-CD11c (PE-CD11c, BU15), anti-CD40 (FITC-CD40, EA-5), anti-HLA-DR (FITC-HLA-DR, TU-36), anti-CD14 (PE-CD14, M5E2), anti-CD16 (FITC-CD16, 3G8), anti-CD80 (FITC-CD80, BB1), anti-CD86 (PE-CD86, FUN-1), anti-CD44 (FITC-CD4, G44-26), anti-CD11a (FITC-CD11a, G43-25B), anti-CD68 (PE-CD68, Y1-82A), anti-CD163 (PE-CD163, 215927), anti-MR (FITC-MR, 19.2), and anti-DC-SIGN (PE-DC-SIGN, DCN46) mAb were obtained from BD PharMingen (San Diego, CA). IFN-{gamma} was used at 10 ng/ml as described previously [18 ]. RPMI 1640 (with L-glutamine) and penicillin/streptomycin were provided from BioWhittaker Europe (Verviers, France). MSL was from Eurobio (Les Ulis, France). Mannan, heparinase, chondroitinase ABC, PHA, formaldehyde, and BSA were from Sigma Chemical Co. (St. Louis, MO).

Immunofluorescence analyses (FACS)
The cells were detached by adding versen (1/1000, Life Technologies, Cergy Pontoise, France) to culture plates for 10 min at 37°C, washed twice with PBS containing sodium azide (0.01%) and BSA (0.2%), and then incubated with PE- or FITC-conjugated (mAb) or with isotype-matched mAb for 30 min at 4°C. Following incubation with these different mAb, cells were washed with PBS containing azide (0.01%) and BSA (0.2%) and fixed using 1% formaldehyde PBS buffer. Acquisition of a least 2000 events was performed using a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA). Analysis was subsequently performed using CellQuest software (BD Biosciences).

HIV-1 adsorption on MDM
Macrophages were seeded into 96-well culture plates (105 cells/well). In some experiments, the cell surface removal of HSPG was performed by using heparitinase III (500 mIU/ml) and chondroitinase ABC (100 mIU/ml) as described previously [19 ]. HIV-1 (1 ng p24) and anti-DC-SIGN mAb (20 µg) or mannan (1 mg/ml) were added on cells and incubated for 1 h at 37°C in a 5% CO2 atmosphere. Each assay was performed in triplicate. After four washes to remove the nonattached virus, cells were lysed by incubation at 37°C for 45 min with 1% Triton X-100. The amount of cell-associated HIV-1 was evaluated using p24 capture ELISA.

Infection of macrophages
Macrophages were washed two times after 6 days of differentiation and seeded into 96-well culture plates (105 cells/well). HIV-1 (1 ng p24/ml) was added on cells and incubated for 3 h at 37°C in a 5% CO2 atmosphere. Each sample was performed in triplicate. After four washes to remove exceeding virus, cells were cultured for 4–5 days. The amounts of virus replication were monitored by p24 antigen ELISA. In this last case, supernatants were harvested, and viruses produced were lysed by incubation for 45 min at 37°C with 1% Triton X-100.

DNA extraction and quantification of HIV-1 DNA by real-time PCR
Genomic DNA was isolated from HIV-infected macrophages by using extraction protocol on a silica column system according to the manufacturer’s recommendations (DNA mini kit, Qiagen AG). HIV-1 DNA was quantified by real-time PCR, using 5' nuclease assay in the LTR gene, the sense primer NEC152 (GCCTCAATAAAGCTTGCCTTGA), the reverse primer NEC131 (GGCGCCACTGCTAGAGATTTT) in the presence of a dually (FAM and TAMRA) labeled NEC LTR probe (AAGTAGTGTGTGCCCGTCTGTTRTKTGACT; Eurogentec SA, Seraing, Belgium), and the LC-PCR master mix (Roche Applied Science, Indianapolis, IN). HIV-1 DNA was carried out on the LightCycler instrument (Roche Applied Science). Cycling conditions were as follows: initial denaturation/FastStart Taq DNA polymerase activation at 95°C/10 min, 45 cycles of denaturation at 95°C/10 s, and annealing and extension at 60°C/30 s with a ramp of 5°C/s. The first PCR cycle allowing fluorescence detection permitted to quantify HIV-1 DNA by reference to a standard curve (tenfold dilutions of 8E5 cell DNA). All reactions were performed in triplicate and tested in the same assay. The level of albumin DNA copies in the cell pellet was used as endogenous reference to normalize the variations in cell number as described previously [20 ]. The normalized value of cell-associated HIV-1 DNA load corresponding to the ratio [(HIV-1 copy number/albumin copy number)x2x106] was finally expressed as the number of HIV-1 DNA copies per 106 cells.

Macrophage-mediated infection of autologous T cells
Macrophages were incubated into 96-well culture plates (105 cells/well) and infected with HIV-1 (1 ng p24) in the presence of the anti-DC-SIGN mAb 1B10 (IgG2a; 20 µg) or mannan (1 mg/ml) for 3 h at 37°C in a 5% CO2 atmosphere. Cells were washed four times, and autologous-stimulated T cells were added onto infected macrophages at a macrophages:T cell ratio of 1:5. Each sample was performed in triplicate. Culture supernatants were harvested every 3 days, and fresh medium was added. Supernatants were inactivated with 1% Triton X-100. The viral production was evaluated the 6th day of the coculture by measurement of p24 in supernatants using capture ELISA.

Chemotaxis assay
The migration of fresh, nonactivated PBL was assessed by a 12-well microchamber technique. Supernatant of each macrophages population was placed in the lower wells of the chamber. Fresh PBL (2x106 cells/well) were loaded in the upper wells. The lower and upper wells were separated by a polycarbonate filter (3 µm pore size, Thincert, Greiner Bio-One Inc., Longwood, FL). The chamber was incubated at 37°C for 18 h in humidified air with 5% CO2. At the end of the incubation, the cells migrating across the filter were counted in triplicate. The chemotaxis index was calculated as number of cells migrating to chemokines secreted by each macrophage’s population/number of cells migrating to medium.

Infection of T cells recruited by MDM
Following chemotaxis assay, migrated T cells were washed two times and seeded into 96-well culture plates (105 cells/well) in the presence or absence of macrophage population supernatants. HIV-1 (1 ng p24/ml) was added on cells and incubated for 3 h at 37°C in a 5% CO2 atmosphere. Each sample was performed in duplicate. After four washes to remove exceeding virus, cells were cultured for 3 days, harvested, and lysed for subsequent HIV-DNA quantification or cultured in medium-supplemented PHA (2.5 µg/ml) and rhIL-2 (1 µg/ml) for 24 h to induce a single cycle of viral replication. Supernatants were collected, and p24 concentrations were monitored by HIV-p24 antigen ELISA.

Detection of cytokine and chemokine released by human antibody array
To evaluate cytokines and chemokine release, the supernatants of macrophage populations were harvested at the 6th day of their differentiation. Supernatants were analyzed with the "Human Chemokine Antibody Array Series I" or the "Human Cytokine Antibody Array Series I" (RayBiotech, Norcross, GA), allowing us to detect 76 and 23 different molecules, respectively. The assay was performed per the instructions. Signal integration was performed with NIH Version 1.3, membrane-negative control values were subtracted, and signal intensities were normalized against the membrane-positive controls.

IL-6 and IL-8 released
IL-6 sandwich ELISA kit (purchased from Tebu-Bio, France) and IL-8 Quantikine ELISA kits (from R&D Systems, Minneapolis, MN) were used. The assay was performed per the instructions. Sample dilutions were assessed after varying trials and ranged from 1:10 to 1:2. The detection limits of these ELISA are 3 pg/mL and 3.5 pg/mL for IL-6 and IL-8, respectively.

Statistical analysis
An unpaired and nonparametric Mann-Whitney U-test was performed for all tests to determine the statistical significance of the data. P < 0.05 was considered the level of statistical significance.

RESULTS

Morphologic and phenotypic characterization of the macrophage populations derived in vitro from monocytes
A comparative, detailed phenotypic analysis was performed on cells obtained by culturing monocytes in the presence of rhM-CSF [untreated macrophages (M0)] or rhM-CSF + rhIFN-{gamma} [macrophages derived from IFN-{gamma}-activated monocytes (M1)] for 6 days. M0 were adherent cells, whereas M1 formed semiadherent, multiple colonies. M1 cells exhibited a round shape conversely to the M0 population, which acquired a more pronounced fibroblastic morphology (Fig. 1 A). Flow cytometry analysis also showed that M1 cells had a weaker size and granularity than M0 cells (Fig. 1A) .


Figure 1
View larger version (48K):
[in this window]
[in a new window]

  		Figure 1. Phenotypic characteristics of MDM, which were generated from monocytes in the presence of rhM-CSF with (M1) or without (M0) rhIFN-{gamma} for 6 days. (A) M0 and M1 cells were photographed through an Olympus CK2 (CRI, Inc., Boston, MA) at x10 original magnification. (B) Cells were stained with the relevant mAb or isotype control and analyzed by flow cytometry for receptor cell surface expression. Histograms represent the mean ± SD (number of donors=3) of percentages of positive cells or of mean fluorescence intensity (MFI) of M0 or M1. The isotype control was subtracted from the MFI for signal quantitation. *, P ≤ 0.05, between M0 and M1. The proportion of contaminating CD3+ T cells was between 3% and 5%.

 
Subsequently, we analyzed the expression of macrophage-related cell surface molecules (CD14, CD16, CD68, CD163) and also the expression of molecules involved in several functions: T cell stimulation (CD40, CD80, CD86), antigen presentation (HLA-DR), adhesion process (CD44, CD11a), and phagocytosis (CD11b, CD11c; Fig. 1B ). As expected, on M0, all the markers of macrophage lineage (CD14, CD16, CD68, CD163) are expressed (Fig. 1B) . M1 expressed CD14, CD68, and CD16 at the same level as M0, but M1 cells expressed a lower level of CD163. Both populations expressed a marker of T cell stimulation, antigen presentation, adhesion process, and phagocytosis at the same level, except CD86, which was expressed significantly higher on M1 compared with M0.

Implication of mannose-binding receptors and HSPG on HIV adsorption
As it was well established that mannose-binding receptors such as C-type lectins are mainly implicated in viral dissemination [21 ], the membrane expression of the MR and the DC-SIGN molecule by each population of macrophages was evaluated (Fig. 2 A). Fifty-three percent and 7% of the M0 population expressed MR (MFI, 18) and DC-SIGN (MFI, 10), respectively. Consistent with prior studies about IFN-{gamma} exposure of macrophages [15 , 22 ], the proportion of MR+ M1 cells decreased significantly (4%, MFI, 7), whereas the proportion of DC-SIGN+ M1 cells was increased (36%, MFI, 15), as compared with M0 cells (P<0.05).


Figure 2
View larger version (31K):
[in this window]
[in a new window]

  		Figure 2. Implications of C-type lectins and HSPG in HIV adsorption on MDM, which were generated from monocytes in the presence of rhM-CSF with (M1) or without (M0) rhIFN-{gamma} for 6 days. (A) Cells were stained with the relevant mAb or isotype control and analyzed by flow cytometry for surface expression of MR and DC-SIGN. Histograms represent the mean ± SD (number of donors=3) of percentages of positive cells (top two panels) or of MFI (bottom two panels) of M1 or M0. The isotype control was subtracted from the MFI for signal quantitation. *, P ≤ 0.05, between M0 and M1. (B) MDM were coincubated with increasing concentrations of soluble mannan and with HIV-1Ba-L. The results are expressed as the percentage of virus bound to each MDM population. The mean of two independent experiments is presented (number of donors=2). Error bars represent SD. (C) MDM were pretreated or not by heparinase III (HaseIII) and chondroitinase ABC (Case), as described in Materials and Methods, and further coincubated or not with mannan and HIV-1Ba-L or HIV-1NDK. The limit of detection is 5 pg/ml. (D) MDM were preincubated or not with anti-DC-SIGN mAb and HIV-1Ba-L or HIV-1NDK. The quantity of attached virus was evaluated by measurement of p24 by ELISA. Each test was performed in triplicate. Mean values of triplicates are reported. Error bars represent SD. One experiment representative of three is presented (number of donors=3). The proportion of contaminating CD3+ T cells was between 3% and 5%.

 
As the surface expression levels of the mannose-binding receptors have been shown to strongly impact on the efficiency of HIV binding, we tested if the only increase of DC-SIGN expression in M1 was associated with a higher capacity of these cells to bind HIV in comparison with M0. Similar levels of attached viruses were measured for M0 and M1 populations, whatever the viral strain. To block all the mannose-binding receptors by soluble mannan, we used the highest and nontoxic concentration of mannan, which significantly reduces the attachment of the virus. The mannan concentration used in the subsequent experiments was ~1 mg/ml (Fig. 2B) . The blockade of all mannose-binding receptors with soluble mannan resulted in a significant reduction of attachment of R5 (50–60%, P<0.05) and not X4 virus, suggesting a predominant role of C-type lectins in attachment of R5-HIV (Fig. 2C) . It is interesting that treatment by heparinase III in association with chondroitinase ABC and soluble mannan accounted for a greater degree of inhibition of the R5-HIV attachment (60–70%, P<0.05) in both macrophage populations and of the X4-HIV virus attachment (36–45%, P<0.05) in M0 and M1 populations, suggesting that HSPG, such as syndecans, are also implicated in addition to C-type lectins on viral attachment on macrophages, as previously reported [13 , 19 , 23 ]. However, the involvement of HSPG seemed to be weaker for R5-HIV attachment, as compared with X4 viruses. In addition, the DC-SIGN blockade did not induce a reduction of HIV attachment on both MDM populations, suggesting that viral attachment on the macrophage is DC-SIGN-independent (Fig. 2D) .

Levels of HIV-1 DNA in MDM
To determine whether this similar efficiency to capture HIV of M1 and M0 was associated with a subsequent productive infection, the expression of CD4, CXCR4, and CCR5 was examined (Fig. 3 A). Flow cytometry analysis confirmed that the M0 population expressed CD4 (66%, MFI, 18), CCR5 (45%, MFI, 16), and CXCR4 (44%, MFI, 11). M1 significantly exhibited a lower percentage of CD4+ cells (9%, MFI, 13) and a higher percentage of CCR5 (76%, MFI, 17)- and CXCR4 (75%, MFI, 17)-positive cells, compared with M0. The analysis of the intracellular expression of CD4 on M1 cells reveals that the lower expression of CD4 at the surface of M1 cells was not associated with its down-modulation (data not shown).


Figure 3
View larger version (36K):
[in this window]
[in a new window]

  		Figure 3. Differential integration and replication of HIV by MDM, which were generated from monocytes in the presence of rhM-CSF with (M1) or without (M0) rhIFN-{gamma} for 6 days. (A) Cells were stained with the relevant mAb or isotype control and analyzed by flow cytometry for receptor cell surface expression. Histograms represent the mean ± SD (number of donors=3) of percentages of positive cells (left panel) or of MFI (right panel) of M1 or M0. *, P ≤ 0.05, between M0 and M1. (B and C) M0 and M1 cells were infected with HIV-1Ba-L or HIV-1NDK. (B) Cells were harvested for subsequent integrated HIV-DNA quantification, as described in Materials and Methods. (C) Kinetics of viral replication. Supernatants were also harvested, and the concentrations of p24 antigen were measured by ELISA. Mean values of triplicates are reported. Error bars represent SD. One experiment representative of three is presented. The proportion of contaminating CD3+ T cells was between 3% and 5%. (D) IL-8 and IL-6 released by each population of macrophages was measured by ELISA. Mean of three independent experiments is presented. (E) Supernatants of M0 and M1 were collected, and cytokine production was assessed by Chemokine Antibody Array I, as described in Materials and Methods. One experiment representative of three is presented.

 
As surface expression of CD4 may be involved in an attachment step that is critical in viral entry to cells, we tested whether the decrease of CD4 expression induced by IFN-{gamma} treatment was associated with a lower virus entry and subsequently, to a lower level of HIV DNA. We used real-time PCR to detect and quantify HIV-specific DNA per 106 cells [24 ]. Infected M0 and M1 exhibited a similar level of HIVNDK DNA content and of HIVBa-L DNA content (Fig. 3B) .

Differential replication of R5- and X4-HIV strains in MDM
We have evaluated further the ability of these macrophage populations to support productive infection by measuring the concentration of released viruses by each macrophage population. After 5 days of culture, M0 replicated R5-HIVBa-L threefold higher than X4-HIVNDK (324±10 pg/ml vs. 119±15 pg/ml, respectively; Fig. 3C ). Compared with M0, M1 replicated tenfold less HIVNDK (23±12 pg/ml) and threefold less HIVBa-L (92±21 pg/ml) after 5 days of culture. It is interesting that the weak replication of HIV in M1 cannot be explained by lower levels of MDM-derived, HIV-transactivating cytokines. Indeed, IL-8 and IL-6 were secreted at high levels by M1 (2623±12 pg/ml and 59±3 pg/ml, respectively, as measured by ELISA), conversely to M0 cells (1445±122 pg/ml and 38±9 pg/ml, respectively; Fig. 3D ). In addition, only faint levels of tolerizing cytokines such as TGF-ß1 or IL-10 were detected in supernatants from both MDM populations (Fig. 3E) . It is notable that IFN-{gamma} production by M1 was also detected in their supernatants (Fig. 3E) .

Low HIV transmission by M1 toward activated T cells
The efficiency of the M0 and M1 populations to transfer HIV toward activated T cells was assessed. M1 transmitted HIVNDK and HIVBa-L nearly tenfold and twofold less than M0, respectively (1146±170 and 119±8 pg/ml HIVNDK-p24 for M0/T and M1/T cocultures, respectively; 175±27 and 95±10 pg/ml HIVBa-L-p24 for M0/T and M1/T cocultures, respectively; Fig. 4 A). Macrophages were preincubated with soluble mannan, and after several washes, T cells were added to be cultured for 5 days. Preincubation of M0 with soluble mannan induced a significant reduction of 70% of HIVNDK transmission (p24 concentrations decreased from 1146±170 to 242±97 pg/ml) and 35% of HIVBa-L transmission (p24 concentrations decreased from 175±27 to 117±5 pg/ml), confirming a role of C-type lectins in HIV transfer and especially in X4-HIV. As M0 did not or loosely expressed DC-SIGN, addition of blocking anti-DC-SIGN mAb had no effect on HIV transmission toward T cells, as expected. It is surprising that blockade of C type lectins by mannan or of DC-SIGN by blocking mAb on M1 cells had no detectable effect on the measured concentration of HIV-p24.


Figure 4
View larger version (37K):
[in this window]
[in a new window]

  		Figure 4. HIV transfer from MDM toward stimulated T cells. (A) MDM were generated from monocytes in the presence of rhM-CSF with (M1) or without (M0) rhIFN-{gamma} for 6 days. MDM were coincubated with or without mannan or anti-DC-SIGN mAb and with HIV-1NDK or HIV-1Ba-L. Autologous-stimulated T cells were added onto infected macrophages at a macrophage:T cell ratio of 1:5. The concentrations of p24 antigen were measured by ELISA. Mean values of triplicates are reported. Error bars represent SD. One experiment representative of three is presented. *, P≤ 0.05; **, P ≤ 0.01. (B) Differential chemokine production by MDM. Supernatants of M0 and M1 were collected, and chemokine production was assessed by Chemokine Antibody Array I, as described in Materials and Methods. One experiment representative of three is presented (cells from three donors were tested). SDF-1{alpha}, Stromal cell-derived factor 1{alpha}.

 
Variations of HIV transmission from infected macrophages to activated T cells may involve the differential secretions of CCR5- and CXC4-interacting chemokines by these macrophages. At this end, we used protein chemokine array to characterize a large spectrum of secreted chemokines by both HIV-infected MDM populations (Fig. 4B) . Infected M0 cells secreted high amounts of MIP-1ß and weak amounts of RANTES. Conversely, HIV-infected M1 cells secreted high amounts of MIP-1ß and RANTES. It is interesting that only HIV-infected M1 cells secreted small amounts of MIP-1{alpha} and SDF-1{alpha} in response to infection (Fig. 4B) . Taken together, HIV-infected M1 cells produced CCR5- and CXCR4-interacting chemokines.

Characterization of chemokine patterns secreted by uninfected MDM
Only a weak proportion of macrophages was reported to be infected by HIV in vivo [25 ]. Thus, characterizing the effects of uninfected MDM populations on the dissemination of HIV toward fresh, unstimulated T cells would also be physiologically relevant. This first required the migration of target T cells toward MDM. At this end, we characterized the pattern of secreted chemokines produced by uninfected MDM populations (Table 1 ). The supernatant was collected at the 6th day of differentiation. Both uninfected macrophage populations secreted with same, efficient monocyte/macrophage-attracting chemokines such as MCP-1, NK cell-recruiting GRO, and IL-8 and Th1/Th2-attracting chemokines such as CXCR3-interacting I-TAC and CCR4-interacting MDC. None of these macrophage populations secreted detectable amounts of CXCR4 ligand SDF-1{alpha}. As compared with M0 cells, the M1 population released lower levels of CCR5-interacting chemokines such as MIP1-{alpha}, MIP-1ß, and RANTES, higher levels of CXCR3-interacting IP-10 and MIG, and lower levels of CCR4-interacting chemokine TARC and CCR3-interacting eotaxin-1, -2, and -3.


View this table:
[in this window]
[in a new window]

  		Table 1. Differential Chemokine Production by Uninfected MDM

 
Recruitment of CCR5+ CXCR4+ CD4+ T cells by uninfected MDM
To determine whether the differential pattern of released chemokines by each uninfected macrophage population was associated with different HIV target T cell chemoattractant efficiency, chemotaxis assay was thus performed and showed that M1 and M0 similarly recruited unstimulated, fresh, bulk PBL (Fig. 5 A).


Figure 5
View larger version (34K):
[in this window]
[in a new window]

  		Figure 5. Chemotactism of unstimulated PBL toward MDM supernatants. (A) PBL that have migrated among supernatants of M0 (MO-CM) and M1 (M1-CM) were counted in triplicate. M0-CM-RC and M1-CM-RC were PBL, which have migrated toward supernatants from M0 and M1, respectively. One experiment representative of six is presented. (B and C) Migrated cells were analyzed for their expression of CD3, CD4, CD19, CD56, CXCR3, CCR5, and CXCR4 by flow cytometry at the single-cell level. Cells were first gated on lymphocytes, according to light-scattering properties to determine the percentage of CD3+ T cells, CD19+ B cells, and CD56+ NK cells among M0-CM-RC (B) and M1-CM-RC (C). Subsequently, a second gate was performed on CD3+ T cells to characterize the expression of CD4 and CXCR3 among CD3+ T cells. Finally, a third gate was performed on CD3+CD4+ T cells to characterize the expression of CCR5 and CXCR4 among CD4+ T cells. The numbers indicate the percentage of positive cells in each quadrant defined according to the isotypic control. One experiment representative of three is presented (number of donors=3). CM, conditioned medium; RC, recruited cells.

 
Subsequently, flow cytometry analysis of MDM-recruited PBL populations was performed. The majority of migrated cells was CD56+ NK cells, whether recruited by M0 or M1 supernatants (62.3±3.2% and 58.2±2.7% for M0 and M1, respectively). CD56dim and CD56bright NK cell populations were found. CD3+CD8+ T cells (15.6±0.2% and 16.1±0.8% for M0 and M1, respectively) and CD19+ B cells (5.6±0.2% and 5.5±0.8% for M0 and M1, respectively) have also similarly migrated toward M0 or M1 supernatants, which recruited a similar proportion of CD4+ T cells among recruited CD3+ T cells (62.5±2.1% and 68.0±10.5% for M1 and M0, respectively). In addition, those recruited CD4+T cells exhibited similar levels of CD4 expression, whatever the MDM-recruiting population (Fig. 5B and 5C) . It is interesting that all recruited CD8+ T cells also expressed CXCR3 following recruitment by M0 or M1 cells. In addition, 27.4±1.1% and 33.7%±2.1 of CD4+ CD3+ T cells expressed CXCR3 following recruitment by M0 and M1, respectively. Within recruited CD4+ CD3+ T cells, more than 98% of CD4+ T cells expressed CXCR4, and 58% expressed CCR5 for both MDM-derived supernatants. It is interesting that all of the recruited CCR5+ cells coexpressed CXCR4. However, the MFI of CXCR4 and CCR5 coreceptors was significantly (P<0.05) higher on M1-recruited CD4+ T cells (203.5±4.6 and 219.0±8.5, respectively) as compared with M0-recruited CD4+ T cells (157.7±0.4 and 171.5±9.2, respectively). Taken together, these data suggest that both MDM populations recruited CD4+ T cells efficiently, which however, may be more sensitive to HIV infection following recruitment by M1.

Replication of R5- and X4-HIV strains in T cells recruited by MDM
To confirm this hypothesis, we studied the susceptibility of these recruited T cells, which were recruited by uninfected M0 supernatant (M0-CM-RC) or M1 supernatant (M1-CM-RC), to subsequent HIV infection by evaluating the efficiency of these recruited T cells to replicate X4-HIV strain and R5-HIV strain (Fig. 6 ). Infected T cells were stimulated by PHA/IL-2 for 24 h to have a single cycle of viral replication in the presence of RPMI/FCS, uninfected M0 supernatant (M0-CM), or uninfected M1 supernatant (M1-CM) to characterize the impact of MDM supernatant (CM) on HIV replication.


Figure 6
View larger version (24K):
[in this window]
[in a new window]

  		Figure 6. Differential replication of HIV by M0-CM-RC and M1-CM-RC. PBL, which have migrated toward supernatants from M0 (M0-CM-RC) or M1 (M1-CM-RC), were obtained as described in Figure 5 . M0-CM-RC and M1-CM-RC were incubated with HIV-1NDK or HIV-1Ba-L. T cells were then cultured in the presence of PHA and rhIL-2 in RPMI/FCS medium, M0-CM, or M1-CM. In supernatants, p24 concentrations were monitored by ELISA. Mean values of triplicates are reported. Error bars represent SD. One experiment representative of three is presented. *, P≤ 0.05. CM, conditioned medium; RC, recruited cell.

 
In RPMI/FCS, M1-CM-RC replicated 2.2-fold lower HIVNDK compared with M0-CM-RC (99±29 pg/ml vs. 220±10 pg/ml p24 concentrations, respectively). In the presence of their respective supernatants, M1-CM-RC and M0-CM-RC reacted differentially. Indeed, no significant difference of HIVNDK production by recruited T cells was observed in the presence or absence of M0-CM. Conversely, M1-CM induced a significantly higher production of HIVNDK by recruited T cells, as compared with RPMI/FCS medium.

In RPMI/FCS, M1-CM-RC replicated 2.2-fold lower HIVBa-L compared with M0-CM-RC (25.0±5 vs. and 56.0±1 pg/ml p24 concentrations, respectively). However, M0-CM induced a significantly weaker production of HIVBa-L by recruited T cells, as compared with RPMI/FCS medium. Conversely, M1-CM induced a significantly higher production of HIVBa-L by recruited T cells, as compared with RPMI/FCS medium.

Indeed, there was no significant production of IL-1ß (detected by ELISA, data not shown). Neither TNF-{alpha} nor IL-1{alpha} has been detected by antibody array in supernatants from both MDM populations (Table 2 ). IL-8 was secreted at similar levels by M1 and M0 (2827±7.6 pg/ml and 2335.9±332 pg/ml, respectively, as measured by ELISA). Conversely to M0, M1 produced IL-6 at high level (483.4±0.5 pg/ml and 53.4±17.9 pg/ml, respectively, as measured by ELISA). In addition, only faint levels of tolerizing cytokines such as TGF-ß1 or IL-10 were detected in supernatants from both MDM populations. It is notable that IFN-{gamma} production by M1 cells was also detected in M1 supernatants (Table 2) .


View this table:
[in this window]
[in a new window]

  		Table 2. Cytokine Production by MDMs

 
Taken together, these data indicate that compared with M0-CM-RC, M1-CM-RC are intrinsically low producers of HIV, whatever the viral strain. Furthermore, M0-CM may contain soluble factors inhibiting the R5-HIV replication without acting on the X4-HIV replication. At the opposite, M1-CM may contain soluble factors enhancing HIV replication by T cells, whatever the HIV strain.

DISCUSSION

Macrophages participate in the initial transmission of HIV-1, in the virus spreading [26 ], and in the persistence of the virus [27 ]. Macrophages, such as other immune cells, are responsive to a wide variety of positive and negative stimuli, and their susceptibility to HIV infection can be influenced profoundly by the type of stimulus. In this context, the cytokine microenvironment is of primary importance, as it is able to polarize macrophages toward Type 1 or Type 2 cells, like T cells [18 , 28 29 30 ]. Within HIV infection, the concentrations of IFN-{gamma} and M-CSF were reported to be increased in various biological fluids [31 ]. We asked herein if such an IFN-{gamma}-enriched microenvironment could influence in vitro the ability of MDM to amplify X4- and R5-HIV-1 isolates and to transfer them to T cells.

HIV attachment/internalization on MDM is mediated by a great numbers of molecules including CD4 [32 , 33 ], syndecans [13 , 34 ], and C-type lectins [14 15 16 ] and also by nonspecific mechanisms such as macropinocytosis [35 , 36 ]. We confirmed here that syndecans were involved in HIV attachment and especially of X4 strains, exhibiting a higher, positive charge on their gp120 [13 , 34 ]. C-type lectins such as the DC-SIGN and the MR also support a great part on HIV adsorption via the mannose residues on gp120 [14 ]. The role of DC-SIGN in attachment has been ruled out in our system, where no effect of anti-DC-SIGN-blocking antibodies was observed. Indeed, the blocking activity of anti-DC-SIGN mAb was checked by their efficiency to inhibit the HIV transfer by DC to T cells (data not shown). In our experimental conditions, mannan limited the attachment of HIV similarly, whatever the MDM population used. However, the percentage of MR+ cells is more than tenfold lower in M1 compared with M0. Taken together, these data suggest that MR is poorly implicated on the HIV attachment. As suggested by Turville et al. [17 ], another C-type lectin other than MR and DC-SIGN is also implicated in viral attachment and can be up-regulated by IFN-{gamma}. Furthermore, this C-type lectin does not need the cooperation of syndecans, considering the fact that the effects of mannan and the removal of HSPG were additive in our system. Our study suggests that this lectin may also interact preferentially with R5 strains. Nevertheless, it still remains to be identified.

Following attachment and fusion, HIV RNA is reverse-transcribed and integrated in host genomic DNA [37 ]. Our study indicates that both MDM populations had the same level of viral DNA, suggesting that fusion and RT steps are fully functional in both populations. The levels of R5- and X4-HIV DNA seemed to be similar, whatever the MDM population, and to be correlated to the HIV attachment on these MDM. Considering the pattern of HIV attachment on M0 and M1, the discrepancies in CD4, CXCR4, and CCR5 expression between M0 and M1, and the patterns of secretion of CCR5- and CXCR4-interacting chemokines, HIV entry in MDM may reflect the HIV attachment mediated by the MBP and/or HSPG and the efficiency of the interaction between the attached virus and the CD4 and CXCR4 or CCR5 molecules.

In our system, both populations of MDM produced dramatically more R5 viruses than X4 viruses, whereas levels of R5- and X4-HIV DNA seemed to be similar, whatever the MDM population, suggesting that X4 strains can enter macrophages efficiently but subsequently, remain blocked at a postentry level [38 ]. Furthermore, MDM differentiated in the presence of IFN-{gamma} produced significantly low levels of HIV, whatever the HIV tropism. We can suggest that some macrophage cellular factors are able to limit the production of X4 viruses or to promote the production of R5 viruses. Thus, we have shown that this phenomenon in not caused by a lower production of some LTR-stimulating monokines (i.e., IL-8, IL-6, TNF-{alpha}, and IL-1). We can hypothesize also that the high proportion of DNA found in the M1 population was unintegrated [39 ]. Nevertheless, our observations are in agreement with other studies demonstrating that IFN-{gamma} limits HIV production by MDM in reducing the interactions between HIV-Tat and its responsive elements [40 ]. Indeed, IFN-{gamma} increases the production of the Class II transactivator transcription factor, which was demonstrated to sequester cyclin T and is required by HIV-Tat to transactivate HIV transcription [41 ]. Some controversies remain in the literature, but it should be remembered that most of the studies that showed a positive effect of IFN-{gamma} on HIV replication were not performed using primary human macrophages [42 ].

Similarly to DC, macrophages are able to transmit HIV toward T cells but with a weak efficiency [43 ]. Although M0 produced HIVBaL more efficiently than HIVNDK, recovered levels of HIV-p24 in M0/T cocultures were higher in the presence of X4 strains than in the presence of R5 strains. This phenomenon may be in part a result of a stronger amplification of X4-HIV replication by numerous CXCR4+CD4+ T cells (more than 85% of activated CD4+ T cells, data not shown), as compared with weak amplification of R5-HIV replication induced by several CCR5+CD4+ T cells (10–15% of activated CD4+ T cells, data not shown). In addition, the transfer of HIVBaL by M0 cells toward activated T cells is limited by the secretion of MIP-1ß and RANTES by infected MDM, probably in response to intracellular HIV-Nef [44 ]. Our results also confirmed the role of the MBP, in in trans HIV transmission from M0 to activated T cells [26 ]. As expected, no role of DC-SIGN was observed in M0, considering its weak expression. M1 induced a weak transfer of X4-HIV and a moderate amplification of such X4-HIV by T cells. The huge difference between M0 and M1 transfer of X4-HIV to activated T cells was linked to the faint production of X4-HIV and to the production of SDF-1{alpha} by M1 in response to infection. In addition, quantities of R5-HIV-p24 measured in M1-T cell coculture were close to those found in M1 supernatants following infection, suggesting an absence or a weak efficiency of such transfer. Indeed, infected M1 cells secreted large quantities of CCR5-interacting chemokines. Thus, many CCR5+ T cells may be recruited by infected M1 but cannot be heavily infected as a result of down-modulation of CCR5 expression on T cell surface following recruitment. In these contexts of low T cell infections, it would not be possible to characterize the involvement of DC-SIGN in HIV transfer, as it would always appear independent of such molecules, as described in our study in the presence of mannan or anti-DC-SIGN-blocking mAb.

The proportion of HIV-uninfected macrophages within tissues is relatively high (ranging from 50% to 99%) and depends of the site of infection [25 ]. So, we focused on the role of uninfected macrophages in the spread of HIV. Both uninfected MDM were shown to recruit CXCR4+CCR5+CD4+ T cells efficiently, but those recruited by M1 cells were intrinsically low producers of X4- and R5-HIV as compared with T cells recruited by uninfected M0. Furthermore, the M0 supernatant was shown to inhibit the replication of the R5-HIV by recruited T cells without acting on X4-HIV replication. This could be associated with the specific release of CCR5 ligands and the absence of SDF-1{alpha} release, as demonstrated by the proteomic membrane array performed on the MDM supernatant. In contrast, the HIV production was enhanced by uninfected M1 supernatant, probably by the release of IFN-{gamma}, which was shown to induce in vitro the viral replication in infected PBMC stimulated by IL-2 [45 ] and/or of IL-6, recently shown to enhance the T cell proliferation, ensuring the subsequent viral production [46 ]. Other factors other than IFN-{gamma} and IL-6 seem to be implicated in this enhancement of viral production by T cells. Their identification is currently investigated in our laboratory.

In conclusion, our study showed that macrophages derived from IFN-{gamma}-activated monocytes weakly produce and transfer HIV to activated CD4+ T cells. This suggests that the activation of monocytes is rather beneficial as far as virus reservoir capacity is concerned. This is in agreement with the antimicrobial activity of macrophages (Fig. 7 A). However, we showed that these macrophages released chemokines that recruit HIV-sensitive cells efficiently, including CCR5+ cells and monocytes/macrophages, and soluble factors that enhance the production of HIV by recruited T cells (Fig. 7B) . Our model is in agreement with studies reporting that the increased IFN-{gamma} may be a contributing factor to increased viral load [47 48 49 ]. Thus, this consequently proinflammatory state participates in the global, immune activation mediated by the virus and may be deleterious to patients infected with HIV [50 ]. The consequence of this general activation on T cell depletion has been well-documented [51 ] and accounts mainly for AIDS pathogenesis. Nevertheless, the actual impact of these macrophage proinflammatory properties during infection on T cell turnover remains to be characterized more thoroughly. These later data focus further attention on the macrophage as a vector for HIV spread and for storage in tissue reservoirs, continually fed with newly attracted, HIV-sensitive cells.


Figure 7
View larger version (33K):
[in this window]
[in a new window]

  		Figure 7. (A) Model illustrating the effects of early interactions between HIV-1 surface components and macrophages derived from IFN-{gamma}-activated monocytes leading to CXCR4- and CCR5-interacting chemokine (CC chemokines) production and their role in the weak HIV transmission. These initial interactions may implicate the CD4, CXCR4, or CCR5 molecules and the MBP and HSPG. The MBP, which mediated the HIV-1 adsorption, remained to be identified. Other non-CC chemokines induced by HIV infection as well as by viral components may play additional roles in the control of viral replication and spreading. (B) Model illustrating the effects of uninfected macrophages derived from IFN-{gamma}-activated monocytes leading to cytokines that recruit HIV target T cells efficiently and soluble factors that enhance the viral production by these recruited T cells.

 

ACKNOWLEDGEMENTS

This work was supported in part by the Agence Nationale de Recherches sur le SIDA and the Institut National de la Santé et de la Recherche Médicale (INSERM), France. H. S. was supported by the EMPRO program of the VI° PCRD. We gratefully acknowledge Dr. Charlotte Charpentier for helpful discussions and reading the manuscript. The authors thank Professor Françoise Barre-Sinoussi, Institut Pasteur de Paris, for providing HIV-1 strains. The authors declare that they have no competing financial interests.

Received April 18, 2006; revised July 19, 2006; accepted August 7, 2006.

REFERENCES

  1. Ho, D. D., Neumann, A. U., Perelson, A. S., Chen, W., Leonard, J. M., Markowitz, M. (1995) Rapid turnover of plasma virions and CD4 lymphocytes in HIV-1 infection Nature 373,123-126[CrossRef][Medline]
  2. Orenstein, J. M., Fox, C., Wahl, S. M. (1997) Macrophages as a source of HIV during opportunistic infections Science 276,1857-1861[Abstract/Free Full Text]
  3. Gorantla, S., Che, M., Gendelman, H. E. (2005) Isolation, propagation, and HIV-1 infection of monocyte-derived macrophages and recovery of virus from brain and cerebrospinal fluid Methods Mol. Biol. 304,35-48[Medline]
  4. Stout, R. D., Suttles, J. (2004) Functional plasticity of macrophages: reversible adaptation to changing microenvironments J. Leukoc. Biol. 76,509-513[Abstract/Free Full Text]
  5. Rosenberg, Z. F., Fauci, A. S. (1990) Immunopathogenic mechanisms of HIV infection: cytokine induction of HIV expression Immunol. Today 11,176-180[CrossRef][Medline]
  6. Fantuzzi, L., Belardelli, F., Gessani, S. (2003) Monocyte/macrophage-derived CC chemokines and their modulation by HIV-1 and cytokines: a complex network of interactions influencing viral replication and AIDS pathogenesis J. Leukoc. Biol. 74,719-725[Abstract/Free Full Text]
  7. Graziosi, C., Gantt, K. R., Vaccarezza, M., Demarest, J. F., Daucher, M., Saag, M. S., Shaw, G. M., Quinn, T. C., Cohen, O. J., Welbon, C. C., Pantaleo, G., Fauci, A. S. (1996) Kinetics of cytokine expression during primary human immunodeficiency virus type 1 infection Proc. Natl. Acad. Sci. USA 93,4386-4391[Abstract/Free Full Text]
  8. Poli, G., Biswas, P., Fauci, A. S. (1994) Interferons in the pathogenesis and treatment of human immunodeficiency virus infection Antiviral Res. 24,221-233[CrossRef][Medline]
  9. Bleul, C. C., Farzan, M., Choe, H., Parolin, C., Clark-Lewis, I., Sodroski, J., Springer, T. A. (1996) The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry Nature 382,829-833[CrossRef][Medline]
  10. Raport, C. J., Gosling, J., Schweickart, V. L., Gray, P. W., Charo, I. F. (1996) Molecular cloning and functional characterization of a novel human CC chemokine receptor (CCR5) for RANTES, MIP-1ß, and MIP-1{alpha} J. Biol. Chem. 271,17161-17166[Abstract/Free Full Text]
  11. Samson, M., Labbe, O., Mollereau, C., Vassart, G., Parmentier, M. (1996) Molecular cloning and functional expression of a new human CC-chemokine receptor gene Biochemistry 35,3362-3367[CrossRef][Medline]
  12. Vives, R. R., Imberty, A., Sattentau, Q. J., Lortat-Jacob, H. (2005) Heparan sulfate targets the HIV-1 envelope glycoprotein gp120 coreceptor binding site J. Biol. Chem. 280,21353-21357[Abstract/Free Full Text]
  13. Bobardt, M. D., Saphire, A. C., Hung, H. C., Yu, X., Van der Schueren, B., Zhang, Z., David, G., Gallay, P. A. (2003) Syndecan captures, protects, and transmits HIV to T lymphocytes Immunity 18,27-39[CrossRef][Medline]
  14. Turville, S. G., Vermeire, K., Balzarini, J., Schols, D. (2005) Sugar-binding proteins potently inhibit dendritic cell human immunodeficiency virus type 1 (HIV-1) infection and dendritic-cell-directed HIV-1 transfer J. Virol. 79,13519-13527[Abstract/Free Full Text]
  15. Chehimi, J., Luo, Q., Azzoni, L., Shawver, L., Ngoubilly, N., June, R., Jerandi, G., Farabaugh, M., Montaner, L. J. (2003) HIV-1 transmission and cytokine-induced expression of DC-SIGN in human monocyte-derived macrophages J. Leukoc. Biol. 74,757-763[Abstract/Free Full Text]
  16. Geijtenbeek, T. B., Kwon, D. S., Torensma, R., van Vliet, S. J., van Duijnhoven, G. C., Middel, J., Cornelissen, I. L., Nottet, H. S., KewalRamani, V. N., Littman, D. R., Figdor, C. G., van Kooyk, Y. (2000) DC-SIGN, a dendritic cell-specific HIV-1-binding protein that enhances trans-infection of T cells Cell 100,587-597[CrossRef][Medline]
  17. Turville, S., Wilkinson, J., Cameron, P., Dable, J., Cunningham, A. L. (2003) The role of dendritic cell C-type lectin receptors in HIV pathogenesis J. Leukoc. Biol. 74,710-718[Abstract/Free Full Text]
  18. Kodelja, V., Muller, C., Politz, O., Hakij, N., Orfanos, C. E., Goerdt, S. (1998) Alternative macrophage activation-associated CC-chemokine-1, a novel structural homologue of macrophage inflammatory protein-1 {alpha} with a Th2-associated expression pattern J. Immunol. 160,1411-1418[Abstract/Free Full Text]
  19. Saphire, A. C., Bobardt, M. D., Zhang, Z., David, G., Gallay, P. A. (2001) Syndecans serve as attachment receptors for human immunodeficiency virus type 1 on macrophages J. Virol. 75,9187-9200[Abstract/Free Full Text]
  20. Laurendeau, I., Bahuau, M., Vodovar, N., Larramendy, C., Olivi, M., Bieche, I., Vidaud, M., Vidaud, D. (1999) TaqMan PCR-based gene dosage assay for predictive testing in individuals from a cancer family with INK4 locus haploinsufficiency Clin. Chem. 45,982-986[Abstract/Free Full Text]
  21. Hu, Q., Frank, I., Williams, V., Santos, J. J., Watts, P., Griffin, G. E., Moore, J. P., Pope, M., Shattock, R. J. (2004) Blockade of attachment and fusion receptors inhibits HIV-1 infection of human cervical tissue J. Exp. Med. 199,1065-1075[Abstract/Free Full Text]
  22. Raveh, D., Kruskal, B. A., Farland, J., Ezekowitz, R. A. (1998) Th1 and Th2 cytokines cooperate to stimulate mannose-receptor-mediated phagocytosis J. Leukoc. Biol. 64,108-113[Abstract]
  23. De Parseval, A., Bobardt, M. D., Chatterji, A., Chatterji, U., Elder, J. H., David, G., Zolla-Pazner, S., Farzan, M., Lee, T. H., Gallay, P. A. (2005) A highly conserved arginine in gp120 governs HIV-1 binding to both syndecans and CCR5 via sulfated motifs J. Biol. Chem. 280,39493-39504[Abstract/Free Full Text]
  24. Legoff, J., Bouhlal, H., Gresenguet, G., Weiss, H., Khonde, N., Hocini, H., Desire, N., Si-Mohamed, A., de Dieu Longo, J., Chemin, C., Frost, E., Pepin, J., Malkin, J. E., Mayaud, P., Belec, L. (2006) Real-time PCR quantification of genital shedding of herpes simplex virus (HSV) and human immunodeficiency virus (HIV) in women coinfected with HSV and HIV J. Clin. Microbiol. 44,423-432[Abstract/Free Full Text]
  25. McIlroy, D., Autran, B., Cheynier, R., Clauvel, J. P., Oksenhendler, E., Debre, P., Hosmalin, A. (1996) Low infection frequency of macrophages in the spleens of HIV+ patients Res. Virol. 147,115-121[CrossRef][Medline]
  26. Nguyen, D. G., Hildreth, J. E. (2003) Involvement of macrophage mannose receptor in the binding and transmission of HIV by macrophages Eur. J. Immunol. 33,483-493[CrossRef][Medline]
  27. Chun, T. W., Carruth, L., Finzi, D., Shen, X., DiGiuseppe, J. A., Taylor, H., Hermankova, M., Chadwick, K., Margolick, J., Quinn, T. C., Kuo, Y. H., Brookmeyer, R., Zeiger, M. A., Barditch-Crovo, P., Siliciano, R. F. (1997) Quantification of latent tissue reservoirs and total body viral load in HIV-1 infection Nature 387,183-188[CrossRef][Medline]
  28. Goerdt, S., Politz, O., Schledzewski, K., Birk, R., Gratchev, A., Guillot, P., Hakiy, N., Klemke, C. D., Dippel, E., Kodelja, V., Orfanos, C. E. (1999) Alternative versus classical activation of macrophages Pathobiology 67,222-226[CrossRef][Medline]
  29. Munder, M., Eichmann, K., Moran, J. M., Centeno, F., Soler, G., Modolell, M. (1999) Th1/Th2-regulated expression of arginase isoforms in murine macrophages and dendritic cells J. Immunol. 163,3771-3777[Abstract/Free Full Text]
  30. Munder, M., Eichmann, K., Modolell, M. (1998) Alternative metabolic states in murine macrophages reflected by the nitric oxide synthase/arginase balance: competitive regulation by CD4+ T cells correlates with Th1/Th2 phenotype J. Immunol. 160,5347-5354[Abstract/Free Full Text]
  31. Alatrakchi, N., Duvivier, C., Costagliola, D., Samri, A., Marcelin, A. G., Kamkamidze, G., Astriti, M., Agher, R., Calvez, V., Autran, B., Katlama, C. (2005) Persistent low viral load on antiretroviral therapy is associated with T cell-mediated control of HIV replication AIDS 19,25-33[Medline]
  32. McDougal, J. S., Maddon, P. J., Orloff, G., Clapham, P. R., Dalgleish, A. G., Jamal, S., Weiss, R. A., Axel, R. A. (1991) Role of CD4 in the penetration of cells by HIV Adv. Exp. Med. Biol. 300,145-154[Medline]
  33. Kozak, S. L., Kuhmann, S. E., Platt, E. J., Kabat, D. (1999) Roles of CD4 and coreceptors in binding, endocytosis, and proteolysis of gp120 envelope glycoproteins derived from human immunodeficiency virus type 1 J. Biol. Chem. 274,23499-23507[Abstract/Free Full Text]
  34. Mondor, I., Ugolini, S., Sattentau, Q. J. (1998) Human immunodeficiency virus type 1 attachment to HeLa CD4 cells is CD4 independent and gp120 dependent and requires cell surface heparans J. Virol. 72,3623-3634[Abstract/Free Full Text]
  35. Liu, N. Q., Lossinsky, A. S., Popik, W., Li, X., Gujuluva, C., Kriederman, B., Roberts, J., Pushkarsky, T., Bukrinsky, M., Witte, M., Weinand, M., Fiala, M. (2002) Human immunodeficiency virus type 1 enters brain microvascular endothelia by macropinocytosis dependent on lipid rafts and the mitogen-activated protein kinase signaling pathway J. Virol. 76,6689-6700[Abstract/Free Full Text]
  36. Marechal, V., Prevost, M. C., Petit, C., Perret, E., Heard, J. M., Schwartz, O. (2001) Human immunodeficiency virus type 1 entry into macrophages mediated by macropinocytosis J. Virol. 75,11166-11177[Abstract/Free Full Text]
  37. Peterlin, B. M., Trono, D. (2003) Hide, shield and strike back: how HIV-infected cells avoid immune eradication Nat. Rev. Immunol. 3,97-107[CrossRef][Medline]
  38. Schmidtmayerova, H., Alfano, M., Nuovo, G., Bukrinsky, M. (1998) Human immunodeficiency virus type 1 T-lymphotropic strains enter macrophages via a CD4- and CXCR4-mediated pathway: replication is restricted at a postentry level J. Virol. 72,4633-4642[Abstract/Free Full Text]
  39. Swiggard, W. J., O’Doherty, U., McGain, D., Jeyakumar, D., Malim, M. H. (2004) Long HIV type 1 reverse transcripts can accumulate stably within resting CD4+ T cells while short ones are degraded AIDS Res. Hum. Retroviruses 20,285-295[CrossRef][Medline]
  40. Emilie, D., Maillot, M. C., Nicolas, J. F., Fior, R., Galanaud, P. (1992) Antagonistic effect of interferon-{gamma} on tat-induced transactivation of HIV long terminal repeat J. Biol. Chem. 267,20565-20570[Abstract/Free Full Text]
  41. Sarol, L. C., Imai, K., Asamitsu, K., Tetsuka, T., Barzaga, N. G., Okamoto, T. (2002) Inhibitory effects of IFN-{gamma} on HIV-1 replication in latently infected cells Biochem. Biophys. Res. Commun. 291,890-896[CrossRef][Medline]
  42. Biswas, P., Poli, G., Kinter, A. L., Justement, J. S., Stanley, S. K., Maury, W. J., Bressler, P., Orenstein, J. M., Fauci, A. S. (1992) Interferon {gamma} induces the expression of human immunodeficiency virus in persistently infected promonocytic cells (U1) and redirects the production of virions to intracytoplasmic vacuoles in phorbol myristate acetate-differentiated U1 cells J. Exp. Med. 176,739-750[Abstract/Free Full Text]
  43. Sharova, N., Swingler, C., Sharkey, M., Stevenson, M. (2005) Macrophages archive HIV-1 virions for dissemination in trans EMBO J. 24,2481-2489[CrossRef][Medline]
  44. Swingler, S., Brichacek, B., Jacque, J. M., Ulich, C., Zhou, J., Stevenson, M. (2003) HIV-1 Nef intersects the macrophage CD40L signaling pathway to promote resting-cell infection Nature 424,213-219[CrossRef][Medline]
  45. Kinter, A. L., Poli, G., Fox, L., Hardy, E., Fauci, A. S. (1995) HIV replication in IL-2-stimulated peripheral blood mononuclear cells is driven in an autocrine/paracrine manner by endogenous cytokines J. Immunol. 154,2448-2459[Abstract]
  46. Pasare, C., Medzhitov, R. (2003) Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells Science 299,1033-1036[Abstract/Free Full Text]
  47. Eylar, E. H., Lefranc, C., Baez, I., Colon-Martinez, S. L., Yamamura, Y., Rodriguez, N., Yano, N., Breithaupt, T. B. (2001) Enhanced interferon-{gamma} by CD8+ CD28– lymphocytes from HIV+ patients J. Clin. Immunol. 21,135-144[CrossRef][Medline]
  48. Breen, E. C., Salazar-Gonzalez, J. F., Shen, L. P., Kolberg, J. A., Urdea, M. S., Martinez-Maza, O., Fahey, J. L. (1997) Circulating CD8 T cells show increased interferon-{gamma} mRNA expression in HIV infection Cell. Immunol. 178,91-98[CrossRef][Medline]
  49. Buch, S., Pinson, D., King, C. L., Raghavan, R., Hou, Y., Li, Z., Adany, I., Hicks, A., Villinger, F., Kumar, A., Narayan, O. (2001) Inhibitory and enhancing effects of IFN-{gamma} and IL-4 on SHIV(KU) replication in rhesus macaque macrophages: correlation between Th2 cytokines and productive infection in tissue macrophages during late-stage infection Cytokine 13,295-304[CrossRef][Medline]
  50. Heagy, W., Groopman, J., Schindler, J., Finberg, R. (1990) Use of IFN-{gamma} in patients with AIDS J. Acquir. Immune Defic. Syndr. 3,584-590
  51. Grossman, Z., Meier-Schellersheim, M., Sousa, A. E., Victorino, R. M., Paul, W. E. (2002) CD4+ T-cell depletion in HIV infection: are we closer to understanding the cause? Nat. Med. 8,319-323[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0406278v1
81/3/642    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saïdi, H.
Right arrow Articles by Bélec, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saïdi, H.
Right arrow Articles by Bélec, L.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS