Published online before print October 24, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Departments of Medicine, Anatomoy and Cell Biology, and Physiology and Cellular Biophysics, Columbia University, New York, New York, USA
1 Correspondence: Department of Medicine, Columbia University, 630 West 168th Street, New York, NY 10032, USA. E-mail: iat1{at}columbia.edu
|
|
|---|
s), and we have shown that this process induces the synthesis and secretion of inflammatory cytokines, including TNF-
and IL-6. However, lesions contain many other macrophages that are not FC-enriched (non-FCM
s). Therefore, we sought to understand how the interaction of these two populations of macrophages would influence the inflammatory response. We show here that non-FCM
s possess a robust ability to deplete TNF-
and IL-6 secreted by FCM
s. The mechanism involves enhanced pinocytic uptake and lysosomal degradation of the FCM
-secreted cytokines by the non-FCM
s. The FCM
s contribute directly to this process by secreting pinocytosis-stimulatory factors that act on non-FCM
s but not on the FCM
s themselves. One of these pinocytosis-stimulatory factors is M-CSF, which is induced by a process involving cholesterol trafficking to the endoplasmic reticulum and signaling through PI-3K and ERK MAPK pathways. However, one or more other FCM
-secreted factors are also required for stimulating pinocytosis in non-FCM
s. Thus, FCM
s secrete inflammatory cytokines as well as factors that promote the eventual pinocytosis and degradation of these cytokines by neighboring macrophages. This process may normally serve to prevent prolonged or disseminated effects of inflammatory cytokines during inflammation. Moreover, possible perturbation of stimulated pinocytosis during the progression of advanced atherosclerosis may contribute to the heightened inflammatory state of these lesions.
Key Words: TNF M-CSF atherosclerosis
|
|
|---|
and IL-6, as well as apoptosis [5
6
7
8
9
]. Moreover, we have recently shown that the same inflammatory and apoptotic pathways can be activated in an FC-independent manner. This occurs by exposure of macrophages to any combination of type A scavenger receptor (SRA) ligands plus activators of the endoplasmic reticulum (ER) stress pathway known as the unfolded protein response (UPR). Both SRA ligands and UPR activators are known to be present in advanced atherosclerotic lesions (ref. 6
and unpublished data). In terms of apoptosis, there is evidence that phagocytic clearance of apoptotic macrophages is less than fully efficient in advanced lesions, which leads to secondary macrophage necrosis [10
11
12
]. The combination of inflammation and cellular necrosis is thought to contribute to plaque disruption, which in turn, can lead to acute thrombotic vascular occlusion and tissue infarction. These latter processes are the cause of acute myocardial infarction and common forms of sudden cardiac death and stroke [13
, 14
].
Although FC-enriched macrophages (FCM
s) may play an important role in advanced lesional pathology, there are many other macrophages in these lesions that are loaded primarily with CE or have relatively little cholesterol accumulation at all. Thus, to understand the biology of FCM
s, one must study how these cells and their products are influenced by interaction with neighboring macrophages that are not FC-loaded. In this context, the goal of the present study was to determine how non-FCM
s affect the aforementioned inflammatory response of FCM
s. We show that non-FCM
s possess a remarkable ability to deplete TNF-
and IL-6 secreted by FCM
s. The process involves stimulated pinocytosis and lysosomal degradation of the cytokines by non-FCM
s. Moreover, the pinocytosis-stimulating factors are secreted by the FCM
s themselves. We speculate that this process may normally serve to prevent prolonged and disseminated inflammatory cytokine effects during inflammation and that defective stimulated pinocytosis in advanced atherosclerosis may contribute to enhanced inflammation in these lesions.
|
|
|---|
Eliciting and culturing mouse peritoneal macrophages
For most experiments, macrophages were obtained from C57BL6/J mice. For some experiments, p38flox x LysMCre macrophages on the C57BL6/J background were used [6
]. For other experiments, Tnfa/ mice on the B6129S background were used, and for these experiments, the control mice were B6129SF2. All mice were female, 810 weeks of age, and purchased from Jackson Laboratories (Bar Harbor, ME). Peritoneal macrophages were harvested following a 4-week immunization protocol using intradermal and i.p. methyl-BSA [5
] or 3 days after i.p. injection of Con A [18
]. Similar results were obtained for macrophages from both procedures. For the immunization protocol, 2 mg/ml methylated BSA (mBSA) in 0.9% saline was emulsified in an equal volume of CFA (Difco, Detroit, MI). Mice were immunized intradermally with 100 µl emulsion. Fourteen days later, the immunization protocol was repeated, except IFA was used instead of CFA. Seven days later, the mice were injected i.p. with 0.5 ml PBS containing 100 µg mBSA. Four days later, macrophages were harvested by peritoneal lavage. Con A-elicited macrophages were obtained from mice, which were injected i.p. with 0.5 ml PBS containing 40 µg Con A. Three days later, the macrophages were harvested by peritoneal lavage. All macrophages were cultured in DMEM, supplemented with 10% heat-inactivated FBS, 100 units/ml penicillin/streptomycin, and 20% L cell-conditioned medium. The cells were cultured for 2448 h, at which time they reached confluence.
Generation of FCM
s and FCM
-conditioned medium
FCM
s were generated by incubation of the cells with acetyl-LDL (50 µg/ml) and the ACAT inhibitor 58035 (10 µg/ml) for 16 h. To collect FCM
-conditioned medium, the FC-loading medium was removed, and the cells were rinsed twice with DMEM and then incubated in this medium for an additional 18 h. At the end of incubation, the FCM
-conditioned medium was collected and ridded of any detached cells by centrifugation at 14,000 rpm for 5 min. For control-conditioned media, macrophages were first incubated for 16 h with acetyl-LDL alone (CE-loading) or with media alone (unloaded), with subsequent rinsing and 18 h incubation in nonloading medium as above.
For the coculture experiments, FCM
s were collected, resuspended in fresh medium and added to a confluent monolayer of non-FCM
s, which had been cultured previously on 12-well plates. The ratio of FCM
s:non-FCM
s was 1:5 in this system. For the transwell experiments, non-FCM
s were cultured on the lower well, into which an upper well containing FCM
s on a permeable membrane was inserted. In this system, there was no cell-cell contact. For both systems, coincubations were typically 18 h, after which cytokine levels in the media were assayed.
Cell association and degradation of 125I-TNF-
Iodination of TNF-
was done by mixing 10 µg rmTNF-
(R&D Systems) and 100 µCi Na125I (PerkinElmer, Wellesley, MA) in 250 µl PBS with 1 unit Iodo-Beads iodination reagent (Pierce, Rockford, IL) for 15 min. Unbound Na125I was removed by D-SaltTM desalting column (Pierce), following the manufacturers protocol. The specific activity of 125I-TNF-
was 35 cpm/pg. To assay TNF-
degradation, 200 pg/ml 125I-TNF-
was added to the macrophage media. At the end of the incubation period, the media were subjected to TCA precipitation. Radioactivity in the supernatant and pellet fractions was measured with a
-counter as an indicator of degraded and intact TNF-
, respectively. The cells were washed twice with PBS and then lysed in 3 M NaOH. Radioactivity in the cell lysates was assayed as an indicator of cell-associated TNF-
.
[14C]Sucrose uptake
Fluid-phase pinocytosis was measured by incubation of macrophages with 10 µM [14C]sucrose (PerkinElmer) over a 1- to 2-h time period. At the end of incubations, the cells were washed twice with PBS and scraped into 1 ml PBS. Cellular 14C radioactivity was measured with a liquid scintillation counter.
M-CSF measurement
M-CSF protein level in the media was measured by ELISA using mouse M-CSF quantikine kit (R&D Systems) following the manufacturers protocol. M-CSF mRNA level was assayed by RT-quantitative PCR (QPCR). The forward and reverse primers were GGCCAGGGGAAAGTGAAAGTT and CTTGCTCGCTAGTGGCTGAA, respectively, and the probe was FAM-CTCGGTGCTCTCGGTGTCGCTGC. 36B4 was used as the internal control. The forward and reverse primers for 36B4 were AGATGCAGCAGATCCGCAT and GTTCTTGCCCATCAGCACC, respectively, and the probe was CAL-CGCTCCGAGGGAAGGCCG. The reactions were run on a MX4000 multiplex QPCR system (Stratagene, La Jolla, CA). The thermal profile settings were 50°C for 2 min, 95°C for 10 min, then 45 cycles at 95°C for 15 s, and 60°C for 1 min.
M-CSF immunodepletion and reconstitution
To immunodeplete M-CSF from FCM
-conditioned media, 1 ml medium was incubated for 2 h with 5 µg M-CSF antibody or control rabbit IgG at 4°C with gentle rocking. Protein A beads (100 µl) were then added into the media, and the suspension was incubated for an additional 2 h. The beads were then removed by centrifugation at 1000 rpm for 3 min. A 50-µl aliquot from the supernatant fraction was removed to assay the level of M-CSF, and the rest was added to macrophage cultures. For M-CSF reconstitution, rmM-CSF was added to the aforementioned immunodepleted media or non-FCM
-conditioned media before incubation with macrophages.
Cytokine assays
TNF-
and IL-6 in the media were determined by ELISA analysis conducted by the Cytokine Core Laboratory (Baltimore, MD). Protein concentration was measured by bicinchoninic acid assay (Pierce) using BSA standards.
Statistics
Data are presented as mean ± SEM. Experiments were performed in triplicate unless specified otherwise.
|
|
|---|
secreted from FCM
s is decreased markedly in the presence of non- FCM
s
and IL-6 synthesis and secretion [5
]. As FCM
s likely coexist with non-FCM
s in advanced atherosclerotic lesions, we wondered what would happen to these cytokines during coculture of FCM
s and non-FCM
s. Therefore, we incubated FCM
s alone or with non-FCM
s for 18 h and then measured TNF-
and IL-6 levels in the media of the coculture system. As shown in Figure 1A
and described previously [19
], FCM
s alone secrete large amounts of TNF-
and IL-6. However, when the FCM
s were cultured with non-FCM
s, the cytokine levels were decreased by more than 80%. As expected, the non-FCM
s themselves secreted little TNF-
or IL-6.
![]() View larger version (9K): [in a new window] |
Figure 1. Proinflammatory cytokines secreted by FCM s are diminished in the presence of non-FCM s. (A) FCM s were incubated for 18 h in the absence (first bars) or presence of non-FCM s (second bars). As a control, non-FCM s were incubated alone (third bars) for 18 h. At the end of the incubation period, the media were collected, and TNF- and IL-6 were measured by ELISA. In a typical FC-loading experiment, the macrophages accumulate two- to threefold more FC than in unloaded macrophages (e.g., 100 µg vs. 40 µg FC per mg cell protein), whereas CE levels are low in unloaded macrophages and FCM s (<10 µg/mg cell protein). (B) FCM s were plated on permeable insert wells of a transwell system and then incubated for 18 h on top of a companion well containing medium alone (first bars) or medium-bathing non-FCM s (second bars). As a control, non-FCM s were incubated alone (third bars) for 18 h. At the end of the incubation period, the media were collected, and TNF- and IL-6 were measured as above. (C) FCM -conditioned medium was incubated alone () or with non-FCM s ( ) for the indicated times. As a control, non-FCM s were incubated in nonconditioned (control) medium ( ). At the end of the incubation period, the media were collected, and TNF- and IL-6 were assayed as above.
|
suppression might be phagocytic clearance of the FCM
s by the non-FCM
s [19
]. However, our previous work showed that on average, only
20% of non-FCM
s internalize apoptotic FCM
s over an 18-h period [19
], and each ingesting phagocyte internalizes only one apoptotic cell. Moreover, the ratio of FCM
s to non-FCM
s was 5:1 in our system. Therefore, the vast majority of FCM
s (>9095%) is not internalized in this system, and so phagocytic clearance of FCM
s could account for only a small portion of the decrease in TNF-
. This prediction was confirmed by preventing direct contact between FCM
s and non-FCM
s using a transwell system. In this experiment, FCM
s were plated on a permeable membrane in an insert well, which was inserted into the medium of an underlying well containing non-FCM
s. As shown in Figure 1B
, TNF-
and IL-6 in the medium were diminished markedly when non-FCM
s were in the lower well, similar to the result with the coculture system. This result suggested that the non-FCM
s could directly clear the cytokines secreted by the FCM
s. This idea was tested further by an experiment in which cytokine-containing conditioned medium from FCM
s was added directly to wells containing non-FCM
s versus wells without cells. As shown in Figure 1C
, the TNF-
and IL-6 in the medium were almost completely depleted after 8 h of incubation with non-FCM
s but not by incubation in wells without cells.
FCM
-conditioned medium stimulates pinocytosis and lysosomal degradation of TNF-
by non-FCM
s
Based on the above findings, we hypothesized that FCM
-derived TNF-
was depleted via degradation of the cytokine by non-FCM
s. To test this idea, 125I-labeled rTNF-
was added to empty wells or wells containing non-FCM
s, using a dose similar to what is secreted from FCM
s, and degradation was measured by the appearance of nonprotein (i.e., TCA-soluble) 125I in the medium. However, we found that the non-FCM
s did not degrade the 125I-TNF-
under these conditions (data not shown; see below). In view of the conditioned medium data in Figure 1C
, we next considered the possibility that one or more other factors secreted by the FCM
s might be necessary to stimulate TNF-
degradation by non-FCM
s. Therefore, we incubated trace amounts of 125I-TNF-
with non-FCM
s in the presence of conditioned medium from non-FCM
s, from CE-loaded macrophages (CEM
s), or from FCM
s. As shown by the data in Figure 2A
, 125I-TNF-
was not degraded in the presence of conditioned medium from non-FCM
s or from CEM
s. However, there was marked degradation of 125I-TNF-
by the non-FCM
s in the presence of conditioned medium from FCM
s.
![]() View larger version (11K): [in a new window] |
Figure 2. FCM -conditioned medium stimulates lysosomal degradation of TNF- by non-FCM s. (A) 125I-TNF- (200 pg/ml) was added to 1 ml conditioned medium from unloaded macrophages (non-FCM s), from CEM , or from FCM s. The media were incubated alone or with non-FCM s for 4 h. The media were then collected and subjected to TCA precipitation. 125I-radioactivity in the TCA-soluble and pellet fractions and in the cell extracts was measured. (B) Non-FCM s were preincubated for 30 min with medium alone or with medium containing 10 µg/ml colchicine, 10 µM cytochalasin D, or 150 µM chloroquine. These macrophages were then incubated for 4 h with FCM -conditioned media containing 200 pg/ml 125I-TNF- . The media were collected and subjected to TCA precipitation, and 125I-radioactivity in the three fractions was assayed as above. Ninety-five percent of original 125I-radioactivity was recovered in the three fractions. The distribution of 125I-radioactivity among the three fractions was plotted as a fraction of the total recovery. (C) Non-FCM s were preincubated for 30 min in medium alone or medium containing the indicated concentrations of wortmannin ( ) or LY294002 (). These macrophages were then incubated for 4 h with FCM -conditioned media containing 200 pg/ml 125I-TNF- . The media were collected and subjected to TCA precipitation, and 125I-radioactivity in the TCA-soluble fraction (degraded 125I-TNF- ) was assayed as above. The data are plotted as percentage of 125I-TNF- degradation by the inhibitor-treated macrophages relative to control macrophages.
|
s secrete one or more factors that act on non-FCM
s to degrade TNF-
. Such a factor or factors might stimulate the non-FCM
s to secrete a TNF-
-degrading protease or to internalize and lysosomally degrade the cytokine, e.g., by pinocytosis. To address the latter idea, we measured 125I-TNF-
degradation and cell association in the absence or presence of various inhibitors of pinocytosis and lysosomal degradation (Fig. 2B)
. The black segment of the first bar in the Figure 2B
shows, as before, that there is substantial degradation of 125I-TNF-
by non-FCM
s in the presence of FCM
-conditioned medium. The white segment of the bar shows that a relatively small portion of the 125I in the medium was still associated with protein, presumably representing undegraded or partially degraded 125I-TNF-
. The gray segment of the bar shows that a similarly small portion of the 125I was cell-associated, which likely reflects internalized 125I-TNF-
not yet fully degraded. The second and third bars in Figure 2B
show the effects of cytochalasin D, an inhibitor of actin polymerization, and colchicine, an inhibitor of tubulin polymerization, each of which is known to block macrophage pinocytosis [21
, 22
]. As shown by the black segments, the inhibitors blocked 125I-TNF-
degradation by 3550%, with a proportional increase in the protein-bound 125I in the medium (white segments). These data suggest that the inhibitors suppress TNF-
degradation by blocking its cellular uptake. Chloroquine, an inhibitor of lysosomal enzyme activity [22
, 23
], also decreased TCA-soluble 125I counts in the media by
50%, but with this compound, there was a reciprocal increase in the cell-associated 125I fraction (black and gray segments of the fourth bar). These data are consistent with unperturbed cellular uptake of 125I-TNF-
but suppressed lysosomal degradation in the presence of chloroquine. Finally, PI-3K signaling has been implicated in macrophage pinocytosis [24
, 25
]. We investigated the possible involvement of PI-3K in FCM
-conditioned, media-stimulated 125I-TNF-
degradation using two inhibitors of the enzyme, wortmannin and LY294002. As shown in Figure 2C
, wortmannin and LY294002 partially suppressed FCM
-conditioned, media-stimulated 125I-TNF-
degradation in a dose-dependent manner, with maximal inhibition of 4050%.
Together, these results suggest that TNF-
degradation by non-FCM
s is mediated through pinocytosis and subsequent lysosomal degradation. Moreover, this process appears to require one or more factors secreted by FCM
s but not by unloaded macrophages or CEM
s. To address this latter issue, we measured the uptake of the pinocytosis marker [14C]sucrose. As shown in Figure 3A
, macrophage uptake of [14C]sucrose was enhanced approximately twofold in the presence of FCM
-conditioned medium compared with conditioned medium from non-FCM
s or CEM
s. Moreover, as shown in Figure 3B
, the enhanced uptake of [14C]sucrose in the presence of FCM
-conditioned medium was suppressed substantially by wortmannin and LY294002, suggesting a role for PI-3K in this process. Thus, FCM
s secrete inflammatory cytokines as well as one or more other factors that enhance the eventual pinocytosis and lysosomal degradation of these cytokines by neighboring macrophages.
![]() View larger version (11K): [in a new window] |
Figure 3. FCM -conditioned medium stimulates liquid-phase pinocytosis by non-FCM s. (A) [14C]Sucrose (10 µM) was added to conditioned media from unloaded macrophages (non-FCM s; ), from CEM s ( ), or from FCM s (). The media were then incubated with non-FCM s for the indicated times. At the end of the incubation period, the media were removed, the cells were washed three times with PBS and then scraped into 1 ml PBS, and cell-associated [14C]cpm were measured. (B) Non-FCM s were preincubated for 30 min in medium alone or medium containing the indicated concentrations of wortmannin ( ) or LY294002 (). These cells were then incubated with FCM -conditioned media (solid lines) or non-FCM -conditioned media (broken lines), which had been supplemented with 10 µM [14C]sucrose. After 60 min of incubation, the media were removed, and cell-associated [14C]cpm were measured. The data are plotted as percentage of cell-associated [14C]sucrose uptake by the inhibitor-treated macrophages relative to control macrophages.
|
-conditioned media, which stimulate pinocytosis, we focused on a macrophage-secreted molecule M-CSF, which was reported previously to enhance pinocytosis [21
, 24
, 26
, 27
]. We therefore assayed the concentration of M-CSF in the conditioned media of the cells used in this study. As shown in Figure 4A
, the conditioned medium of FCM
s contained
400 pg/ml M-CSF, which was much greater than that found in the conditioned medium of unloaded macrophages or CEM
s. To determine the importance of M-CSF in the enhancement of pinocytosis by FCM
-conditioned medium, the medium was preincubated with anti-M-CSF antibody or control IgG, immobilized on protein A beads before adding to phagocytes. As shown in Figure 4B
, the M-CSF antibody, but not the control antibody, decreased [14C]sucrose pinocytosis to a level close to that in unstimulated macrophages. Moreover, the decrease in pinocytosis, effected by the anti-M-CSF antibody, was prevented substantially by adding back to the immunodepleted medium an amount of rM-CSF that was similar to that secreted by FCM
s (Fig. 4C)
. Significantly, however, the addition of M-CSF to non-FCM
-conditioned medium had no significant stimulatory effect whatsoever (compare
and
in Fig. 4C
). From these data, we conclude that M-CSF is necessary but not sufficient for the enhancement of pinocytosis by FCM
-conditioned medium and that FCM
s likely secrete one or more additional factors that function with M-CSF to stimulate pinocytosis.
![]() View larger version (29K): [in a new window] |
Figure 4. FC enrichment of macrophages induces the synthesis and secretion of M-CSF, which is necessary but not sufficient for stimulating pinocytosis and TNF- degradation. (A) M-CSF levels in conditioned media from unloaded macrophages (non-FCM s; open bar), from CEM s (shaded bar), or from FCM s (solid bar) were measured by ELISA assay. (B) FCM -conditioned medium was incubated for 2 h at 4°C with anti-M-CSF antibody ( ) or control rabbit IgG ( ) immobilized on protein A beads. The beads were then removed by centrifugation. The supernatant fractions, as well FCM medium, which was left untreated (), and non-FCM medium ( ) were supplemented with 10 µM [14C]sucrose. The four types of labeled media were then incubated with non-FCM s for the indicated time periods. The media were removed, and cell-associated [14C]cpm were measured. (C) Non-FCM s were incubated for the indicated times with the following media supplemented with 10 µM [14C]sucrose: FCM -conditioned medium (FCM medium; ); FCM medium, which was immunodepleted of M-CSF and then reconstituted with 0, 400, or 800 pg/ml M-CSF ( , , , respectively); or non-FCM medium, which was supplemented with 0 or 800 pg/ml M-CSF ( and , respectively). At the end of each incubation period, the media were removed, and the cell-associated [14C]cpm was measured. (D) Macrophages were incubated for the indicated times with medium alone ( ), acetyl-LDL (CE-loading; ), or acetyl-LDL + 58035 (FC-loading; ). mRNA was then extracted from these cells, and M-CSF mRNA was assayed by RT-QPCR. The values were normalized to the level of 36B4 mRNA, which served as an internal control. (E) Macrophages were incubated for 9 h with acetyl-LDL + 58035 (FC) alone or with 70 nM U18666A, 10 µM LY294002, 10 µM PD98059, 10 µM SP600125, or 10 µM PS1145 for 9 h. For one of the incubations, FCM s from P38flox x LysMCre mice were used (p38floxedCre M ). M-CSF mRNA was assayed and quantified as in D.
|
s, CEM
s, and unloaded macrophages was assayed for M-CSF mRNA by RT-QPCR. As shown in Figure 4D
, M-CSF mRNA was increased markedly by 9 h FC loading but not by the other treatments. We showed previously that FC enrichment of macrophages triggers a number of signaling pathways, including the UPR, MAPKs, PI-3K-AKT, and I
B kinase (IKK)-NF-
B, and a number of these effects require cholesterol trafficking to the ER [5
, 28
, 29
]. To test the role of cholesterol trafficking to the ER and activation of the aforementioned signaling pathways in FC-induced M-CSF, M-CSF mRNA was assayed in FCM
s treated with inhibitors of cholesterol trafficking, MAPKs, PI-3K-AKT, and IKK-NF-
B. As shown in Figure 4E
, the increase in M-CSF mRNA was markedly blocked by the cholesterol trafficking inhibitor U18666A and the PI-3K LY294002 and partially blocked by the ERK inhibitor PD98059. However, inhibition of p38 (p38floxed-Cre macrophages), JNK (SP600125), or IKK-NF-
B (PS1145) had no significant effect. In summary, FC enrichment of macrophages induces a marked increase in M-CSF mRNA, and inhibitor studies suggest an involvement of cholesterol trafficking to the ER as well as PI-3K and ERK MAPK.
FCM
-conditioned, media-stimulated pinocytosis and TNF-
degradation are diminished in FCM
s themselves
The findings in this study raised an intriguing issue related to the original finding that macrophages secrete large amounts of TNF-
after
10 h of FC loading [5
]. If the mechanism described above could function in an autocrine/paracrine manner, then the FCM
s would secrete and degrade the cytokine, thus limiting the net accumulation of TNF-
in the medium of these cells. To explore this issue, 125I-TNF-
in FCM
-conditioned medium was added to unloaded macrophages (non-FCM
s) or to TNF-
-deficient macrophages, which were preloaded for various times with FC or CE. TNF-
-deficient macrophages were used to avoid FC-induced cytokine secretion by the macrophages themselves. As shown in Figure 5A
(
), CE loading of macrophages for up to 18 h did not diminish their ability to degrade 125I-TNF-
in comparison with unloaded macrophages. This is an important finding, as CEM
s represent a large population of macrophages that coexist with FCM
s in advanced atheromata [2
, 30
]. However, after 1018 h of FC loading, macrophages showed diminished degradation of 125I-TNF-
compared with unloaded macrophages or CEM
s (Fig. 5A
, ). Similar results were found using a pinocytosis assay as the endpoint: after 18 h of FC loading, there was virtually no stimulation of pinocytosis above the basal level by FCM
-conditioned medium (Fig. 5B)
. Thus, at the time of FC loading, when TNF-
secretion becomes most robust (10 h and up) [5
], FCM
s begin to lose the ability to pinocytose and degrade the cytokine. This finding likely explains why the medium of FCM
s themselves accumulates high levels of TNF-
.
![]() View larger version (10K): [in a new window] |
Figure 5. Stimulated pinocytosis and TNF- degradation are diminished in FCM s. Tnfa/ macrophages were loaded with CE ( ) or FC () for the indicated times. Control macrophages were left unloaded. (A) These cells were incubated for 4 h with FCM -conditioned medium supplemented with 200 pg/ml 125I-TNF- . The media were collected and subjected to TCA precipitation, and 125I-radioactivity in the TCA-soluble fraction (degraded 125I-TNF- ) was assayed. The data are plotted as percentage of 125I-TNF- degradation by the CEM s or FCM s relative to the control macrophages. (B) The cells were incubated for 60 min with FCM -conditioned medium supplemented with 10 µM [14C]sucrose. The media were then removed, and cell-associated [14C]cpm was measured. The dotted line represents [14C]sucrose in unloaded macrophages incubated in non-FCM -conditioned medium.
|
|
|
|---|
s, as there is evidence that such cells exist in advanced atheromata, and, in cell-culture studies, FCM
s secrete inflammatory cytokines [5
]. Moreover, in recent studies based on signal transduction mechanisms in FCM
s, we have developed another lesion-relevant model of inflammation and apoptosis that does not require FC loading or ACAT inhibition. In this model, TNF-
and IL-6 are induced by a combination of ligands for the SRA in combination with activators of ER stress, both of which are known to exist in advanced atheromata (cf., ref. [6
] and unpublished data). Whether advanced lesional macrophages are activated by FC enrichment or by the scavenger receptor/ER stress pathway, it is almost certain that they coexist with a significant population of CEM
s, poorly loaded with cholesterol that are or not exposed to SRA ligands and ER stress activators. Thus, the interaction of inflammatory macrophages and their secreted cytokines with these neighboring macrophages is important to understand. In this context, we have shown herein that TNF-
and IL-6 secreted by FCM
s are markedly depleted in the presence of non-FCM
s. Initially, we imagined that phagocytic clearance of FCM
s would be the most important mechanism. However, the phagocytic efficiency is too low to explain a major effect in this regard. Moreover, when FCM
s are exposed briefly to phagocytes, there is a modest, proinflammatory response in the phagocytes [19
]. Rather, our data show that the mechanism involves stimulated pinocytosis and lysosomal degradation of the cytokine by non-FCM
s. To our knowledge, this rather simple but efficient mechanism of cytokine suppression has not been reported previously. It is intriguing that the stimulation of pinocytosis requires FC-induced M-CSF plus one or more other factors induced by FC loading, and the FCM
s themselves become relatively resistant to this stimulation.
These findings raise a number of mechanistic and physiologic questions. The mechanism of M-CSF-induced pinocytosis has been explored previously and is thought to involve one or more cell-surface M-CSF-interacting proteins, cytoskeleton-mediated plasma membrane ruffling, and an overall increase in endocytic solute flow [21
, 24
, 26
, 27
]. Our inhibitor data in Figure 2B
and 2C
, are consistent with the mechanisms implied by these findings, particularly, those involved in cytoskeletal remodeling. Our data also suggest the existence of one or more non-M-CSF pinocytosis-stimulatory factor(s) induced by FC loading, and the identity and mechanism of these putative factors remain to be elucidated. In addition, the mechanism by which FCM
s become relatively resistant to the stimulation is yet unknown. One possibility is that at the later stages of FC loading, the plasma membrane loses its ability to undergo the type of cytoskeletal reorganization required for pinocytosis. Alternatively, at the early phase of FC-loading, FC enrichment may actively signal a pathway or molecule that somehow suppresses the effect of M-CSF or the other putative factor(s) on pinocytosis.
The physiologic implications of our findings remain to be explored. In the setting of an inflammatory response, where the desired effect is focal and short-term cytokine action, such a system may prevent prolonged and/or disseminated effects of the cytokines. However, we found that TNF-
secreted by LPS-stimulated macrophages was not diminished when these cells were cocultured with resting macrophages (data not shown). These data are consistent with the ability of LPS to suppress pinocytosis [23
] and raise the possibility that macrophage-secreted TNF-
in the setting of gram-negative bacterial sepsis may not be subject to the type of regulation described herein. Whether other inducers of macrophage inflammatory cytokines and M-CSF fit into this scenario remains to be explored. Another important issue is the overall functional importance of the mechanism elucidated here compared with the rapid removal of inflammatory cytokines by the flow of interstitial fluid. We propose that the pinocytosis mechanism would be most important in inflammatory abscesses, where the fibrotic wall of the abscess would be expected to limit the flow of interstitial fluid.
In terms of atherosclerosis, previous studies suggest that non-FCM
s may limit plaque necrosis in relatively early atherosclerotic lesions by ingesting apoptotic macrophages before they become secondarily necrotic [11
]. The findings herein suggest another, beneficial effect of these macrophages, namely, clearing inflammatory cytokines. In the context of the discussion above about interstitial flow versus pinocytosis as mechanisms to clear inflammatory cytokines, advanced atherosclerotic lesions have features of abscesses, i.e., extensive fibrosis surrounding the inflammatory necrotic core. Thus, the pinocytosis mechanism may be particularly important in the setting of advanced atherosclerosis.
However, at some point in advanced lesion progression, even this mechanism of inflammatory cytokine clearance may become defective. In particular, recent work has suggested that phagocytic clearance of apoptotic macrophages in advanced atherosclerosis becomes defective, which contributes to postapoptotic macrophage necrosis and development of the necrotic core of advanced plaques [10
, 11
]. As phagocytosis and pinocytosis share a number of common features and mechanisms, it is possible that advanced lesional macrophages also lose their ability to clear inflammatory cytokines by pinocytosis. Indeed, our data in Figure 5
would suggest that as more macrophages become FC-enriched in advanced lesions, their ability to respond to propinocytic factors might diminish. If so, the resulting increased inflammatory milieu would be expected to contribute to plaque disruption and vascular occlusion [31
]. Finally, Kruth and colleagues [32
] have shown that pinocytosis, including that stimulated by M-CSF, can result in the uptake of large amounts of atherogenic lipoproteins by macrophages [32
]. Thus, it is possible that the secretion of M-CSF by FCM
s or other activated macrophages in advanced lesions may enhance this process in those neighboring macrophages that are still able to respond to pinocytic enhancement. The testing of these and other ideas in vivo is critical but must await the elucidation on a molecular level of how M-CSF stimulates pinocytosis. The use of mice deficient in M-CSF or currently known M-CSF receptors will not suffice, as these mice simply have an overall deficiency of macrophages [33
34
35
]. Therefore, future progress in this area will require selective silencing of pinocytosis but not monocyte proliferation and differentiation.
Received August 16, 2006; accepted October 2, 2006.
|
|
|---|
and interleukin-6: model of NF-
B- and MAP kinase-dependent inflammation in advanced atherosclerosis J. Biol. Chem. 280,21763-21772This article has been cited by other articles:
![]() |
A. Paul, B. H.-J. Chang, L. Li, V. K. Yechoor, and L. Chan Deficiency of Adipose Differentiation-Related Protein Impairs Foam Cell Formation and Protects Against Atherosclerosis Circ. Res., June 20, 2008; 102(12): 1492 - 1501. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||