Pepro Tech
Originally published online as doi:10.1189/jlb.0306200 on September 15, 2006

Published online before print September 15, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.0306200v1
81/1/49    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rouhiainen, A.
Right arrow Articles by Rauvala, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rouhiainen, A.
Right arrow Articles by Rauvala, H.
Related Collections
Right arrowRelated Article
(Journal of Leukocyte Biology. 2007;81:49-58.)
© 2007 by Society for Leukocyte Biology

Analysis of proinflammatory activity of highly purified eukaryotic recombinant HMGB1 (amphoterin)

Ari Rouhiainen1, Sarka Tumova, Leena Valmu, Nisse Kalkkinen and Heikki Rauvala

Neuroscience Center, and Institute of Biotechnology, University of Helsinki, Helsinki, Finland

1Correspondence: Neuroscience Center, Viikinkaari 4, PL 56, University of Helsinki, Helsinki 00014, Finland. E-mail: ari.rouhiainen{at}helsinki.fi

ABSTRACT

HMGB1 (amphoterin) is a 30-kDa heparin-binding protein that mediates transendothelial migration of monocytes and has proinflammatory cytokine-like activities. In this study, we have investigated proinflammatory activities of both highly purified eukaryotic HMGB1 and bacterially produced recombinant HMGB1 proteins. Mass analyses revealed that recombinant eukaryotic HMGB1 has an intrachain disulphide bond. In mass analysis of tissue-derived HMGB1, two forms were detected: the carboxyl terminal glutamic acid residue lacking form and a full-length form. Cell culture studies indicated that both eukaryotic and bacterial HMGB1 proteins induce TNF-{alpha} secretion and nitric oxide release from mononuclear cells. Affinity chromatography analysis revealed that HMGB1 binds tightly to proinflammatory bacterial substances. A soluble proinflammatory substance was separated from the bacterial recombinant HMGB1 by chloroform-methanol treatment. HMGB1 interacted with phosphatidylserine in both solid-phase binding and cell culture assays, suggesting that HMGB1 may regulate phosphatidylserine-dependent immune reactions. In conclusion, HMGB1 polypeptide has a weak proinflammatory activity by itself, and it binds to bacterial substances, including lipids, that may strengthen its effects.

Key Words: inflammation • nitric oxide • phosphatidylserine • RAGE • TNF-{alpha}

INTRODUCTION

HMGB1 (amphoterin) is a 30-kDa heparin-binding protein widely expressed in different tissues and organisms [1 2 3 ]. Macrophages, monocytes, endothelial cells, neurons, and various tumor cells secrete HMGB1 after induction, and high amounts of HMGB1 have been detected in serum samples of various inflammatory diseases [4 5 6 7 8 9 10 ].

Recent studies have highlighted the role of HMGB1 as a monocyte and endothelium-activating substance, and mediator of inflammation [4 , 11 , 12 , and as reviewed in 13 and 14 ]. HMGB1 induces inflammation during necrosis, whereas in apoptotic cells, it is sequestered to the nucleus [11 ]. During trauma and inflammation, HMGB1 is massively released to extracellular space, where it mediates organ damage and lethality [4 , 15 ]. Further, elevated levels of extracellular HMGB1 or HMGB1 mRNA are detected in cancer and in inflammatory disorders, suggesting that HMGB1 is acting as a widespread inflammatory mediator [16 , 17 ].

HMGB1 binds to several transmembrane receptors, including the receptor for advanced glycation end products (RAGE), Toll-like receptors 2 and 4 (TLR2/4), and syndecan-1 (CD138), and generates proinflammatory signaling to nucleus [18 19 20 21 22 ]. Well-characterized signaling routes of HMGB1 are NF-{kappa}B and ERK1/2 activation by RAGE-ligation, and IKKa/b and NF-{kappa}B activation by TLRs [19 , 23 24 25 ]. In addition, HMGB1 and RAGE mediate transendothelial migration of monocytes and tumor cells [5 , 26 ].

HMGB1 has a characteristic bipolar structure (amphoterin), and it avidly binds to various substances like DNA or heparin [2 ]. Further, it is often post-translationally modified [27 ]. Whether HMGB1 in solid tissue or circulation binds other inflammation mediators is currently unclear. HMGB1 derived from eukaryotic cells is less proinflammatory than the recombinant protein derived from bacterial expression systems [28 , 29 ]. This suggests that the different forms of HMGB1 or the existence of HMGB1 binding cofactors influence proinflammatory activity.

We have produced recombinant HMGB1 (recHMGB1) in a baculovirus system yielding high expression levels (50–100 mg/l) of recombinant protein [10 ]. In addition, we have produced an E. coli-derived recombinant, and purified HMGB1 from tissue. In this study, we have tested the effect of both tissue derived and recombinant HMGB1 proteins in mononuclear cell proinflammatory responses.

MATERIALS AND METHODS

Materials
ATP (ATP), lipopolysaccharide (LPS), phosphatidic acid, phosphatidylethanolamine, polymyxin B and S100b were from Sigma-Aldrich (St. Louis, MO, USA). Phosphatidylserine was from Avanti Polar Lipids (Alabaster, AL, USA). Advanced glycation end bovine serum albumin (AGE-BSA) was produced as described [24 ]. Recombinant HMGB1 (recHMGB1) was produced and purified as described, and analyzed in GelCode Blue (Pierce, Rockford, IL)-stained SDS-PAGE [5 , 10 ]. cDNA coding for amino terminal amino acids 1-185 of HMGB1 was cloned into pGEX-6P-1-plasmid. Recombinant GST-fusion protein (deltaC-HMGB1) was expressed in BL21(pLysS) bacteria, and purified using glutathione-sepharose column and PerScission Protease method (GE Healthcare Bio-Sciences AB, Uppsala, Sweden). In some experiments deltaC-HMGB1 was further purified with HiTrap Heparin and HiTrap SP chromatographies (GE Healthcare Bio-Sciences AB, New York, NY). The truncated HMGB1 (deltaC-HMGB1) is still capable to trigger RAGE signaling [26 ], but it is more soluble than the nascent HMGB1. Tissue HMGB1 was isolated from E18-P2 rat brain using heparin-sepharose and Affi-Gel Blue chromatographies (GE Healthcare Bio-Sciences AB) as described, except that the NaDH washing step was omitted [30 ]. DNA content in recombinant protein stocks were measured using CyQuant Kit (Promega, Madison, WI). Both recHMGB1 and deltaC-HMGB1 contained 0.03 µg DNA per 1 mg of protein. Endotoxin content in recHMGB1 fraction was under detection limit [5 ].

Cells and cell culture
RAW 264.7 cells were cultured as described [5 ]. Mixed rat glial cultures were prepared from neonatal rat brain and cultured as described [31 ]. PBMCs were isolated from adult male NMRI mice. Blood was collected; mononuclear cells were enriched using a method described by Graziani-Bowering et al., and cells were washed with 1 mM EDTA-PBS [32 ]. In some assays, mononuclear cell fractions from two mice were pooled. Cells in 10% FCS-RPMI were adhered to HMGB1-coated or control cell culture wells.

Primary and secondary structure analyses
HMGB1 used in mass analyses was analyzed and purified using RP-HPLC [10 , 33 ]. In some studies recHMGB1 was reduced and alkylated. Alkylation was done using 4-vinylpyridine alkylating agent, which causes 105 Da or 106 Da increase in mass when bound to nonreduced or reduced cysteine residue, respectively [34 ]. Trypsin digestion and mass spectrometric analyses were carried out as described [33 , 34 ]. To determine disulfide-bonded cysteines, tryptic peptides derived from nonreduced recHMGB1 were analyzed in mass spectrometry.

Database searches
Expressed sequence tag (EST) searches of nucleotide databases were done using tools from the Web sites of National Center for Biotechnology Information (Rockville Pike, Bethesda, MD).

Heparin-binding experiments
Heparin-sepharose chromatographies were done as described previously [30 ] using Äkta chromatography station and 1 ml HiTrap heparin column (GE Healthcare Bio-Sciences AB). In some experiments, samples contained 1 mM dithiothreitol or 10 mM ß-mercaptoethanol.

TNF-{alpha} induction and secretion assays
In HMGB1-induced RAW 264.7 macrophage secretion assays, 0.1–0.2 x 106 cells (in OPTIMEM I medium, Invitrogen, Carlsbad, CA) were cultured in the wells of cell culture plates. Proteins or LPS were added in the medium as defined in each experiment, and cells were cultured for indicated times. In some studies, reduced (3% ß-mercaptoethanol treated) proteins were coated to wells for 1 h and washed before cell culture. TNF-{alpha} concentration in culture medium was measured using ELISA (Bender Medsystems, Vienna, Austria). TNF-{alpha} standards used in ELISA were from Bender Medsystems, Roche (Mannheim, Germany) and Endogen (Pierce). Resulting TNF-{alpha} values were normalized to values from uninduced cells, which was defined as 100%.

Mouse PBMC TNF-{alpha} mRNA induction and protein secretion
Cells were adhered to HMGB1-coated or control 48-well plate wells (3–7 wells/mouse total PBMCs) in 10% FCS-RPMI and cultured for 6 h. TNF-{alpha} in culture media was quantified using ELISA. In some assays, mRNA coding for TNF-{alpha} was detected from PBMC-cultures by RT-PCR. Cells were cultured for 6 h, and RT-PCR analysis was done as described [5 ]. Primers for TNF-{alpha} were acagaaagcatgatccgcgacg and ggctcagccactccagctgctc. Amplified DNA was analyzed in agarose gel electrophoresis, and relative OD values of bands were measured as described [5 ]. Porphobilinogen deaminase housekeeping gene was used as a control, and TNF-{alpha} values were normalized to porphobilinogen deaminase values. The OD value of uninduced cells was defined as 1.

Interleukin-6 (IL-6) and monocyte chemotactic protein-1 (MCP-1) expression analyses
RAW 264.7 cells were cultured for 2 days in OPTI-MEM I with or without coated recHMGB1 (20 µg/ml), S100b (20 µg/ml), AGE-BSA (500 µg/ml) or with soluble LPS (0.1 µg/ml). Equal amounts of RNA were reverse transcribed and analyzed in RT-PCR. The oligopairs for IL-6 and MCP-1 were cagttgccttcttgggactgatgctg and agcatccatcatttctttgtatctctgg, and atgcaggtccctgtcatgcttctgg and ggtgctgaagaccttagggcagatg, respectively. IL-6 and MCP-1 values were normalized to porphobilinogen deaminase values [5 ]. The OD value of uninduced cells was defined as 1. Trimmean values, excluding 17% of lowest and highest values, were calculated for IL-6 samples, and mean values were calculated for MCP-1 samples.

Nitric oxide secretion assay
RAW 264.7 or mixed rat glial cultures were treated with various amounts of HMGB1 proteins or LPS and cultured for indicated times. RAW 264.7 cells were cultured in RPMI or DMEM supplemented with 10% FCS, and PBMCs were cultured in RPMI supplemented with 10% FCS. 10 µg/ml of polymyxin B was added to some assays. Nitric oxide was quantified from culture media using Greiss Reagent System (Promega). Inducible nitric oxide synthase (iNOS) expression levels were analyzed with RT-PCR using the primers atggcttgcccctggaagttt and ggcttgtctctgggtcctctggt. Amplified DNA was normalized and quantified as described above.

Coculture of endotoxin-activated RAW 264.7 cells with phospholipid vesicles and recHMGB1
Cells were cultured on microwell plates in 10% FCS-RPMI (1.5x105 cells/well). LPS (10 ng/ml) was added to all of the wells. Phospholipid vesicles containing phosphatidylcholine alone or phosphatidylcholine (70%) and phosphatidylserine (30%) were made as described with two exceptions: the chloroform was evaporated with nitrogen gas, and filter pore size used was 0.2 µm [35 ]. Various amounts of phospholipid vesicles with or without 30 µg/ml of recHMGB1 were added, and cells were cultured for 20 h. Nitric oxide in culture media was quantified using Greiss Reagent System. Values from cell cultures without added lipids were determined as 1, and values of lipid containing wells were normalized to this value in both control and recHMGB1 samples.

Extraction of HMGB1-binding bacterial substances
XL-1 E. Coli cells were homogenized in cold TBS containing lysozyme (Sigma) and protease inhibitors [36 ]. RecHMGB1 was coupled to EAH-sepharose (GE Healthcare Bio-Sciences AB) at the concentration of 1 mg per 1 ml of sepharose gel. The cleared soluble fraction was applied to recHMGB1 column. The column was washed with TBS containing 0.5 M NaCl, and bound substances were eluted with increasing salt concentrations. Uncoupled sepharose CL-4B (Sigma) was used as a control column. DNA content in the fractions was measured using CyQuant assay kit. For macrophage TNF-{alpha} secretion induction measurement, diluted fractions were coated to plastic wells. Macrophages were adhered to wells and cultured, and TNF- {alpha} was measured by ELISA.

RecHMGB1 or glutathione-sepharose column and PerScission Protease method purified deltaC-HMGB1 were used as samples in chloroform-methanol extraction. Extraction was done using the method described by M. Pasciak et al. with some modifications [37 ]. Briefly, 5 µg of protein was diluted in 100 µl of PBS in polypropylene tube, and 600 µl of chloroform-methanol (2:1) was added with mixing. Then, 200 µl of methanol and 300 µl of water was added, tubes were mixed by vortexing, and centrifuged at 16,000 g for 5 min. The upper phase was dried to plastic tubes, and 4 x 105 RAW 264.7 cells in 400 µl of OPTIMEM I was added to tubes. Tubes were mixed after 30 min incubation, and after 60 min incubation, cell suspensions were transferred to a 48-well plate and subcultured for 2 h. TNF-{alpha} was quantified from culture supernatants using ELISA.

Phospholipid binding assay
The assay was carried out essentially as described by Nakano et al. [38 ]. Phospholipids were dissolved in methanol, and various amounts of lipids (0, 100, or 300 µg) were added in 100 µl to microwells and dried. Wells were blocked with 1% BSA-PBS, and 2 µg/ml of recHMGB1 in 1% BSA-PBS was added to the wells for 1 h. The wells were washed, and bound recHMGB1 was detected with antipeptide I and antipeptide III ELISAs [10 ]. Wells omitting the primary antibody were used as negative controls.

Statistics
P values were calculated using Student's unpaired t test in Microsoft® Excel2000 program (Microsoft Corporation, Redmond, WA). Error bars in all figures represent means ± SD.

RESULTS

Structural analysis of HMGB1
Recombinant HMGB1 proteins were produced in either S9 baculovirus or E. coli expression systems. The baculovirus system produced extremely high levels of full-length recHMGB1, yielding 50–100 mg/l of recombinant protein in culture stocks from which it was purified with heparin-sepharose and ion exchange chromatography [10 ]. Tissue-HMGB1 was isolated from young rat brain with a two-step chromatography method using heparin-sepharose and Affi Gel Blue chromatography [30 ]. Both recHMGB1 and tissue-HMGB1 migrated as a single band in SDS-PAGE both under nonreducing and reducing conditions (Fig. 1A and data not shown). The finding that proteins migrated faster under reducing conditions suggests that the oxidation state is the same in both eukaryotic proteins. Mass spectrometric analyses of tissue-HMGB1 suggested that, compared with the recHMGB1, the major form lacks the carboxyl terminal glutamic acid residue (the mass was 129 Da lower than excepted), and the minor form is the full-length protein. Results of tissue HMGB1 analyses are similar to results by Chou et al. [39 ]. No ESTs coding for glutamic acid residue-lacking form of rat HMGB1 were found in databases, suggesting that lack of the glutamic acid residue is not due to modifications of the HMGB1 transcript (data not shown).


Figure 1
View larger version (16K):
[in this window]
[in a new window]

 
Figure 1. Structural characteristics of recombinant HMGB1. (A) Analysis of recHMGB1 (3.25 micrograms) or tissue derived HMGB1 (1 microgram) was performed in GelCode Blue stained SDS-PAGE. Proteins migrate as 30 kDa bands. (B–D) RP-HPLC analysis of native HMGB1 proteins, and reduced and alkylated recHMGB1. recHMGB1 elutes at two close peaks in RP-HPLC (B). After reduction and alkylation of cysteine residues recHMGB1 elutes as a single peak (C). Tissue derived HMGB1 eluted as one major peak. In addition, two minor peaks are detected (D). Time (t) and absorbance (AU) axes in figures are not in scale. (E) The first peak of recHMGB1 separated in RP-HPLC (B) was analyzed in mass spectrometry. The data indicated the molecular mass of 24760 Da for recHMGB1. A second recHMGB1 peak from RP-HPLC (B) gave an identical mass (data not shown). (F) Reduction does not influence recHMGB1 binding to heparin. Non-reduced or reduced recHMGB1 was analyzed in heparin-Sepharose chromatography. The bound protein was eluted with 0.15–1.5 M NaCl gradient. All recHMGB1 samples were eluted at the same NaCl concentration (0.7 M NaCl).

Primary structure of recHMGB1 protein was analyzed using RP-HPLC and mass spectrometry. RecHMGB1 was eluted at two close peaks in RP-HPLC, which both had identical masses of 24760 (Fig. 1B and 1E , and data not shown). After reduction and alkylation, recHMGB1 was eluted as a single peak (Fig. 1C) , suggesting that different retention times of the native protein fractions may be due to differences in protein conformation. Tissue-HMGB1 was eluted at three peaks (Fig. 1D) as described earlier [10 ]. The most prominent peak was identified as HMGB1 (data not shown and Ref. 10 ).

The mass of the RP-HPLC purified recHMGB1 was 2–3 Da lower than the calculated theoretical mass, suggesting one intrachain disulphide bond (Fig. 1E) . Mass-spectrometric analyses of the trypsinized recHMGB1 peptides showed that the disulfide bond exists between the first two cysteines within the A-box in the HMGB1 derived from the first peak of RP-HPLC (data not shown).

We tested whether reduction has any effect on heparin binding. The reduced and nonreduced recHMGB1 bound to heparin-sepharose with a similar affinity, indicating that heparin binding of HMGB1 is redox state independent (Fig. 1F) .

Effect of HMGB1 proteins on TNF-{alpha} secretion from mononuclear cells
The eukaryotic and bacterial recombinant HMGB1 proteins and the tissue-derived protein were tested for their effect on TNF-{alpha} secretion using RAW 267.4 cells or mouse PBMCs. The full-length bacterial recombinant was somewhat more active than the deleted form (deltaC-HMGB1), but both recombinants rapidly induced TNF-{alpha} secretion when added in solution or coated on the substrate (shown for deltaC-HMGB1 in a 3-h assay in Fig. 2A ). In contrast, no significant TNF-{alpha} induction was observed under the same conditions for the eukaryotic recombinant HMGB1 in 3-h assays (Fig. 2A) . However, a TNF-{alpha} inducing activity that was slightly above the baseline was observed for the eukaryotic proteins in long-term assays (shown for the recombinant and tissue-derived protein in an 8-h assay in Fig. 2B ). The reducing agent ß-mercaptoethanol had no effect on the ability of recombinant HMGB1 proteins to induce TNF-{alpha} secretion (data not shown). An inducing effect on TNF-{alpha} secretion and mRNA level was also observed for eukaryotic HMGB1 in PBMCs in 6-h assays (Fig. 2C and 2D) .


Figure 2
View larger version (21K):
[in this window]
[in a new window]

 
Figure 2. HMGB1 and TNF-{alpha} expression. Bacterially produced recombinant HMGB1is a more potent TNF-{alpha} secretion inducer than eukaryotic recombinant HMGB1. RAW 264.7 cells (1–2 x 105 cells/well in OPTIMEM I) were added to HMGB1-coated (20 or 100 µg/ml) microwells, and cultured for 3 h (A). TNF-{alpha} concentration in the culture medium was measured using ELISA. Values from control wells were determined as 100%, and sample values were normalized to control values. Solid bars denote 20 µg/ml; open bars denote 100 µg/ml. (n=3, *, P<0.04 when compared with controls, #, P<0.05 when compared with recHMGB1 samples). Eukaryotic recHMGB1 induces TNF-{alpha} release from macrophages. 20 µg/ml of recHMGB1 or tissue-HMGB1 was added to RAW 264.7 cultures (1–2x105 cells/well in OPTIMEM I). LPS (0.1 µg/ml) was added to positive control cultures. Cells were cultured for 8 h (B). TNF-{alpha} concentration in the culture medium was measured using ELISA. Values from wells without activators were determined as 100%, and sample values were normalized to nonactivated control values (n=5; *, P<0.01). Tissue-derived HMGB1 induces TNF-{alpha} secretion from mouse PBMCs. Freshly isolated mouse PBMCs in 10% FCS-RPMI were adhered to tissue-HMGB1-coated (20 µg/ml) plastic wells and cultured (C). After 6 h of culture, TNF-{alpha} concentration in the medium was measured. Results were calculated as in Fig. 2B. (n=4, *, P<0.03). HMGB1 induces TNF-{alpha} mRNA in mouse PBMCs. Cells were isolated and cultured as described in Fig. 3C . RNA was isolated and analyzed in RT-PCR, and relative OD values of the bands were measured (D). OD value of uninduced cells was determined as 1. ODs of bands were normalized to porphobilinogen mRNA bands. *, P < 0.05 when compared with uninduced sample. (n=3).

RecHMGB1 does not induce expression of IL-6 and MCP-1
RAGE ligation has been shown to induce expression of proinflammatory cytokines IL-6 and MCP-1 [40 , 41 ]. We tested using RT-PCR whether coated recHMGB1 is capable of inducing IL-6 and MCP-1 in macrophages. AGE-BSA and S100b were used as RAGE-ligand controls, and LPS was used as a control for macrophage activation. Both AGE-BSA and LPS induced significant upregulation of IL-6 and MCP-1 after 2 days of culture, whereas recHMGB1 and S100b had no effect (Table 1 ). Interestingly, S100b and S100A1 were recently shown to be incapable of inducing cytokine production [42 , 43 ].


View this table:
[in this window]
[in a new window]

 
Table 1. recHMGB1 or S100b Does Not Induce IL-6 or MCP-1 Gene Expression After Culture of 2 Daysa

HMGB1 induces nitric oxide release from macrophages
We tested whether recombinant HMGB1 proteins induce nitric oxide release from both primary cells and transformed macrophages. A slow nitric oxide secretion was seen in RAW 264.7 cell cultures with high concentrations of soluble eukaryotic HMGB1 (Fig. 3A ), and it was not inhibited by polymyxin B (data not shown). Bacterially produced soluble HMGB1 was a more potent nitric oxide inducer (Fig. 3B) . Effect of eukaryotic soluble HMGB1 proteins on iNOS mRNA expression was tested. RAW 264.7 cells were treated with 100 µg/ml of recHMGB1 or 10 or 100 ng/ml of LPS for 19 h, and iNOS mRNA was quantified using RT-PCR analysis. Values obtained were 104 ± 1.3% (P<0.05), 111 ± 4.6%, and 115 ± 5.5% [for 100 µg/ml HMGB1, 10 ng/ml of LPS, and 100 ng/ml of LPS, respectively (n=3)] when uniduced expression was determined as 100%. In mixed rat glial primary cell cultures, soluble recHMGB1 induced nitrite release at lower concentrations than from RAW 264.7 cells (Fig. 3C) .


Figure 3
View larger version (36K):
[in this window]
[in a new window]

 
Figure 3. RecHMGB1 induces nitric oxide release and up-regulates iNOS in macrophage cultures. Time course study of HMGB1-induced nitric oxide release. RAW 264.7 cells were cultured in the presence of various amounts of soluble recHMGB1 or LPS, and nitric oxide was quantified from culture media after 1, 2, or 3 days of culture (A). Control cells are denoted by solid bars; 0.1 µg/ml of recHMGB1 is denoted by open bars; 1 µg/ml of recHMGB1 is denoted by dark gray bars; 10 µg/ml of recHMGB1 is denoted by light gray bars; 100 µg/ml of recHMGB1 is denoted by checkered bars; and 1 µg/ml of LPS is denoted by ruled bars (n=3; *, P<0.05 when compared with control samples). Bacterially produced HMGB1 is a potent nitric oxide inducer. RAW 264.7 cell were cultured in the presence of soluble deltaC-HMGB1 (20 µg/ml) or LPS (0.1 µg/ml) for 24 h (B). Nitric oxide in culture media was quantified. (n=4; *, P<0.005 when compared with control samples). RecHMGB1 induces nitric oxide release from primary cell cultures. Mixed glial cell cultures from neonatal rat brains were incubated with LPS (1 µg/ml) or recHMGB1 (1–30 µg/ml) for 1 day, and nitric oxide was quantified from the culture medium (C). The number of experiments is at least six in all conditions tested. *, P<0.05 when compared with samples without recHMGB1 or LPS.

HMGB1 binds to bacterial proinflammatory substances
Because the bacterially produced recombinant HMGB1 induced strong proinflammatory reactions in mononuclear cells, we tested whether HMGB1 is capable of binding macrophage-activating bacterial substances. HMGB1 affinity chromatography revealed that some bacterial components bind tightly to HMGB1, and when released from HMGB1, they can elicit a proinflammatory response (Fig. 4A ). One such substance, DNA, was detected from fractions eluted from the HMGB1 affinity column (data not shown).


Figure 4
View larger version (28K):
[in this window]
[in a new window]

 
Figure 4. HMGB1-binding substances and cytokine expression. HMGB1 binds to bacterial proinflammatory substances. E. coli homogenates were applied to HMGB1 or sepharose CL-4B columns, the columns were washed with 0.5 M NaCl-TBS (0.5 M wash), and bound substances were eluted with increasing salt concentrations. TNF-{alpha} induction by coated wash and elution fractions was determined in macrophage cell culture assay (A). HMGB1 column fractions = black bars; Sepharose CL-4B column fractions are denoted by open bars. An active substance can be extracted by chloroform-methanol-water partition to polar lipid phase from bacterially produced HMGB1. Five migrograms of recHMGB1 or deltaC-HMGB1 purified using glutathione-sepharose chromatography (in 100 µl of PBS) was treated with chloroform-methanol mixture, and water was added to separate nonpolar and polar phases. The polar phase was dried to plastic tubes. Induction of macrophage TNF-{alpha} secretion was assayed using RAW 264.7 cells, and secreted TNF-{alpha} was quantified using ELISA (B). Samples from control partitions were used as controls, and their TNF-{alpha} release was determined as 100%. (n=3; *, P<0.05 when compared with control). HMGB1 binds to acidic phospholipids. Binding of HMGB1 to phospholipid-coated wells was detected by ELISA (C). Phospholipids were dissolved in methanol, and various amounts of lipids (0, 100, or 300 µg) were dried on microwells. The wells were blocked with BSA and incubated with 2 µg/ml of recHMGB1 for 1h. Bound recHMGB1 was detected with antipeptide I (squares) and antipeptide III (triangles) ELISAs. Results of control ELISA without primary antibody are indicated by solid circles. PA, phosphatitic acid; PE, phosphatidylethanolamine; PS, phosphatidylserine; n=3. *, P<0.05 when compared with control wells. Effect of HMGB1 on phosphatidylserine-mediated inhibition of LPS-induced macrophage nitric oxide release (D). LPS (10 ng/ml)-activated RAW 264.7 cells were cultured in the presence of 30, 60, or 120 µg/ml of PS-containing vesicles, or in the presence of 60 or 120 µg/ml of phosphatidylcholine (PC) vesicles. Nitric oxide in culture medium was measured after 20 h, and the results were normalized to values of cell cultures without added lipids. PS inhibited nitric oxide release dose dependently when compared with PC control (solid bars). Effect of HMGB1 (30 µg/ml) on the PS-mediated inhibition was tested (open bars) (n=3).

Eukaryotic recHMGB1 and the bacterial recombinant proteins purified with glutathione-sepharose column and PerScission Protease method were treated with chloroform-methanol to denature the proteins and to separate possible polypeptide-bound lipophilic substances. Both organic and polar phases were separated with the addition of water. The polar phase from the bacterial recombinant was found to induce macrophage TNF-{alpha} secretion. No such activity was found in eukaryotic recHMGB1 or bacterial protein that was further purified with heparin- and ion-exchange chromatography (Fig. 4B and data not shown).

HMGB1 has been previously shown to bind both phosphatidylserine and sulfatide lipids [44 , 45 ]. In this study, we tested HMGB1 binding to three phospholipids expressed in E. coli: phosphatidic acid, phosphatidylethanolamine, and phosphatidylserine [46 ]. HMGB1 bound strongly to phosphatidylserine as excepted. In addition, HMGB1 bound strongly to phosphatidic acid. Binding to phosphatidylethanolamine was much weaker (Fig. 4C) .

Phosphatidylserine is a well-known immune suppressor [47 ]. Therefore, we tested the effect of recHMGB1 on phosphatidylserine-mediated inhibition of nitric oxide release from macrophages [48 ]. Phosphatidylserine vesicles inhibited LPS induced nitric oxide release from RAW 264.7 cells dose dependently (Fig. 4D) . Coincubation with recHMGB1 affected only slightly the inhibitory effect of phosphatidylserine (Fig. 4D) .

DISCUSSION

In the current study, we have taken advantage of the high expression level of HMGB1 in our baculovirus expression system in insect cells, which is expected to reduce the risk of contaminating substances in the recombinant protein. The expression system made it possible to isolate the recombinant in a highly purified form using mild nondenaturing conditions, without using trichloroacetic acid that is commonly used to purify HMG-type proteins. For example, plasminogen activation-enhancing effect by HMGB1 and its DNA binding capability are strongly affected by acid treatment of the protein [10 , 49 ]. Further, we have purified tissue-derived HMGB1 from rat brain and show that it is very similar to recHMGB1.

Structural studies of the baculovirus-derived HMGB1 produced in animal cells show that it contains an intrachain disulfide bond. Occurrence of the disulfide bond has been also demonstrated in HMGB1 isolated from tissue [30 , 50 , 51 ]. The molecular mass of the recombinant HMGB1 corresponds exactly to the calculated molecular mass and does not give evidence of other post-translational modifications, than the presence of one disulfide bond. The tissue-derived HMGB1 used in this study differs from the recombinant eukaryotic protein in that the major form lacks the carboxyl terminal glutamic acid residue. The minor form is the full-length protein.

Post-translational modifications may regulate induction of inflammatory reactions by HMGB1 [27 ]. The results of this study indicate that genuine reduced and oxidized HMGB1 polypeptides are weak TNF-{alpha} and nitric oxide-inducing agents in mononuclear cells. Further studies are warranted to reveal how post-translational modifications affect proinflammatory activity of HMGB1.

Treatment with reducing agents has no effect on HMGB1’s heparin binding activity or proinflammatory activity, suggesting that HMGB1 can preserve its functions in the absence of the disulfide bond. In addition, NMR studies have previously shown that the recombinant A-box of HMGB1, having one cysteine replaced with serine, folds in a manner that allows a close contact of the cysteine with the replacing serine residue [52 ]. This suggests that the disulfide formation is not necessary for folding to such conformation where the two cysteines are in close proximity. Further, CD spectroscopy studies revealed that both the reduced and nonreduced recHMGB1 have essentially the same {alpha}-helical structure, suggesting that reduction has no effect on secondary structure (Tumova and Rauvala, unpublished results). In contrast, CD spectroscopy studies of perchloric acid-treated HMGB1 revealed major changes in spectra after reducing of the disulfide bond [53 ].

Our current results and previous results from other groups suggest that eukaryotic and bacterial HMGB1 proteins differ in their ability to induce TNF-{alpha} [28 , 29 ]. Further, our results show that a TNF-{alpha}-inducing activity can be extracted by a lipid solvent (chloroform/methanol) from the bacterially expressed recombinant but not from the highly purified baculovirus-derived protein expressed in animal cells. It seems probable that the extremely high expression level achieved in our eukaryotic system largely overrides the occurrence of copurifying factor(s) that enhance proinflammatory activity.

The occurrence of the proinflammatory activity in the polar phase in Folch partition after chloroform-methanol extraction of the bacterially produced recombinant suggests that the activity is enhanced by a polar lipid. Tentative analysis of lipids in this fraction using mass spectrometry reveals a complex lipid pattern (A. Rouhiainen, H. Rauvala, and P. Somerharju, unpublished observations), and further work is warranted to elucidate the molecular nature of the active components(s). Furthermore, we show that HMGB1 binds to purified lipids in a microwell binding assay and interacts with phosphatidylserine in cell culture assay, agreeing with our previous finding of HMGB1 binding to platelet lipids [44 ]. It appears clear that HMGB1 binds at least phosphatidic acid and phosphatidylserine. Interestingly, phosphatidylserine has been implicated in the regulation of inflammation [54 , 55 ], and HMGB1 might thus affect interactions of phosphatidylserine with cells and regulate its anti-inflammatory activities.

HMGB1 is present in circulation during different inflammatory diseases, but its function there is not fully understood [4 , 6 , 7 ]. Binding of HMGB1 to substances derived from microbes and/or injured tissues might create complexes up-regulating innate immune responses that, in turn, jeopardize tissue integrity through production of toxic inflammatory mediators. Foreign material binding capacity phenomenon for some circulating proteins, such as the LPS binding protein, vitronectin, and fibronectin, is known to occur. These proteins have been shown to strengthen macrophage responses to bacterial substances [56 , 57 ]. Furthermore, other highly charged recombinant proteins, for example, heat shock proteins produced in bacterial expression systems [58 59 60 61 ], have been shown to induce immune cell activations through binding to microbe-derived substances.

Our nitric oxide induction results are similar to those of Kuniyasu et al. who detected nitric oxide induction in macrophages by eukaryotic HMGB1 [23 ]. These results suggest that nitric oxide synthase upregulation and nitric oxide release are induced by high concentrations of HMGB1. Nitric oxide synthase gene expression is regulated by NF-{kappa}B [reviewed in 62]. Since the HMGB1 receptors TLR2/4 and RAGE activate NF-{kappa}B, it seems reasonable to assume that these receptors are involved in HMGB1/macrophage signaling [19 , 23 , 63 ]. In fact, Kuniyasu et al. have shown that HMGB1 activates NF-{kappa}B in human monocytes [23 ]. Sumi and Ignarro have shown that AGE-BSA-induced nitric oxide synthase upregulation is inhibited by anti-RAGE antibodies in RAW 264.7 cells [64 ]. However, Adami et al. described that the RAGE ligand S100b-induced nitric oxide release from microglial cells is RAGE signaling independent but RAGE-ectodomain mediated, suggesting that other cell surface receptors exist for S100b [65 ]. The recent study by Kim et al. showed that down-regulation of HMGB1 by short hairpin RNA in postischemic brain decreases iNOS mRNA expression, suggesting that HMGB1 is involved in iNOS regulation in vivo [66 ].

ACKNOWLEDGEMENTS

A. R. was supported by grants from the Aarne and Aili Turunens Foundation and the Maud Kuistila Memorial Foundation. H. R. was supported by grants from the Academy of Finland, Finnish Cancer Organizations and the Sigrid Jusélius Foundation. We thank Seija Lehto and Eeva-Liisa Saarikalle for excellent technical assistance.

Received March 14, 2006; revised August 9, 2006; accepted August 9, 2006.

REFERENCES

    1
  1. Bustin, M. (2002) At the crossroads of necrosis and apoptosis: signaling to multiple cellular targets by HMGB1 Sci. STKE 151,PE39
  2. 2
  3. Merenmies, J., Pihlaskari, R., Laitinen, J., Wartiovaara, J., Rauvala, H. (1991) 30-kDa heparin-binding protein of brain (amphoterin) involved in neurite outgrowth. Amino acid sequence and localization in the filopodia of the advancing plasma membrane J. Biol. Chem. 266,16722-16729[Abstract/Free Full Text]
  4. 3
  5. Bianchi, M. E., Beltrame, M., Paonessa, G. (1989) Specific recognition of cruciform DNA by nuclear protein HMG1 Science 243,1056-1059[Abstract/Free Full Text]
  6. 4
  7. Wang, H., Bloom, O., Zhang, M., Vishnubhakat, J. M., Ombrellino, M., Che, J., Frazier, A., Yang, H., Ivanova, S., Borovikova, L., et al (1999) HMG-1 as a late mediator of endotoxin lethality in mice Science 285,248-251[Abstract/Free Full Text]
  8. 5
  9. Rouhiainen, A., Kuja-Panula, J., Wilkman, E., Pakkanen, J., Stenfors, J., Tuominen, R. K., Lepantalo, M., Carpen, O., Parkkinen, J., Rauvala, H. (2004) Regulation of monocyte migration by amphoterin (HMGB1) Blood 104,1174-1182[Abstract/Free Full Text]
  10. 6
  11. Sunden-Cullberg, J., Norrby-Teglund, A., Rouhiainen, A., Rauvala, H., Herman, G., Tracey, K. J., Lee, M. L., Andersson, J., Tokics, L., Treutiger, C. J. (2005) Persistent elevation of high-mobility group box-1 protein (HMGB1) in patients with severe sepsis and septic shock Crit. Care Med. 33,564-573[CrossRef][Medline]
  12. 7
  13. Yamada, S., Inoue, K., Yakabe, K., Imaizumi, H., Maruyama, I. (2003) High-mobility group protein 1 (HMGB1) quantified by ELISA with a monoclonal antibody that does not cross-react with HMGB2 Clin. Chem. 49,1535-1537[Free Full Text]
  14. 8
  15. Mullins, G. E., Sunden-Cullberg, J., Johansson, A. S., Rouhiainen, A., Erlandsson-Harris, H., Yang, H., Tracey, K. J., Rauvala, H., Palmblad, J., Andersson, J., et al (2004) Activation of human umbilical vein endothelial cells leads to relocation and release of high-mobility group box chromosomal protein 1 Scand. J. Immunol. 60,566-573[CrossRef][Medline]
  16. 9
  17. Rauvala, H., Merenmies, J., Pihlaskari, R., Korkolainen, M., Huhtala, M. L., Panula, P. (1988) The adhesive and neurite-promoting molecule p30: analysis of the amino-terminal sequence and production of antipeptide antibodies that detect p30 at the surface of neuroblastoma cells and of brain neurons J. Cell Biol. 107,2293-2305[Abstract/Free Full Text]
  18. 10
  19. Parkkinen, J., Raulo, E., Merenmies, J., Nolo, R., Kajander, E. O., Baumann, M., Rauvala, H. (1993) Amphoterin, the 30-kDa protein in a family of HMG1-type polypeptides. Enhanced expression in transformed cells, leading edge localization, and interactions with plasminogen activation J. Biol. Chem. 268,19726-19738[Abstract/Free Full Text]
  20. 11
  21. Scaffidi, P., Misteli, T., Bianchi, M. E. (2002) Release of chromatin protein HMGB1 by necrotic cells triggers inflammation Nature 418,191-195[CrossRef][Medline]
  22. 12
  23. Treutiger, C. J., Mullins, G. E., Johansson, A. S., Rouhiainen, A., Rauvala, H. M., Erlandsson-Harris, H., Andersson, U., Yang, H., Tracey, K. J., Andersson, J., et al (2003) High mobility group 1 B-box mediates activation of human endothelium J. Intern. Med. 254,375-385[CrossRef][Medline]
  24. 13
  25. Lotze, M. T., Tracey, K. J. (2005) High-mobility group box 1 protein (HMGB1): nuclear weapon in the immune arsenal Nat. Rev. Immunol. 5,331-342[CrossRef][Medline]
  26. 14
  27. Sunden-Cullberg, J., Norrby-Teglund, A., Treutiger, C. J. (2006) The role of high mobility group box-1 protein in severe sepsis Curr. Opin. Infect. Dis. 19,231-236[Medline]
  28. 15
  29. Tsung, A., Sahai, R., Tanaka, H., Nakao, A., Fink, M. P., Lotze, M. T., Yang, H., Li, J., Tracey, K. J., Geller, D. A., et al (2005) The nuclear factor HMGB1 mediates hepatic injury after murine liver ischemia-reperfusion J. Exp. Med. 201,1135-1143[Abstract/Free Full Text]
  30. 16
  31. Hatada, T., Wada, H., Nobori, T., Okabayashi, K., Maruyama, K., Abe, Y., Uemoto, S., Yamada, S., Maruyama, I. (2005) Plasma concentrations and importance of high mobility group box protein in the prognosis of organ failure in patients with disseminated intravascular coagulation Thromb. Haemost. 94,975-979[Medline]
  32. 17
  33. Pachot, A., Monneret, G., Voirin, N., Leissner, P., Venet, F., Bohe, J., Payen, D., Bienvenu, J., Mougin, B., Lepape, A. (2005) Longitudinal study of cytokine and immune transcription factor mRNA expression in septic shock Clin. Immunol. 114,61-69[CrossRef][Medline]
  34. 18
  35. Hori, O., Brett, J., Slattery, T., Cao, R., Zhang, J., Chen, J. X., Nagashima, M., Lundh, E. R., Vijay, S., Nitecki, D., et al (1995) The receptor for advanced glycation end products (RAGE) is a cellular binding site for amphoterin. Mediation of neurite outgrowth and co-expression of rage and amphoterin in the developing nervous system J. Biol. Chem. 270,25752-25761[Abstract/Free Full Text]
  36. 19
  37. Park, J. S., Svetkauskaite, D., He, Q., Kim, J. Y., Strassheim, D., Ishizaka, A., Abraham, E. (2004) Involvement of toll-like receptors 2 and 4 in cellular activation by high mobility group box 1 protein J. Biol. Chem. 279,7370-7377[Abstract/Free Full Text]
  38. 20
  39. Park, J. S., Gamboni-Robertson, F., He, Q., Svetkauskaite, D., Kim, J. Y., Strassheim, D., Sohn, J. W., Yamada, S., Maruyama, I., Banerjee, A., et al (2006) High mobility group box 1 protein interacts with multiple Toll-like receptors Am. J. Physiol. Cell Physiol. 290,C917-C924[Abstract/Free Full Text]
  40. 21
  41. Izuishi, K., Tsung, A., Jeyabalan, G., Critchlow, N. D., Li, J., Tracey, K. J., Demarco, R. A., Lotze, M. T., Fink, M. P., Geller, D. A., et al (2006) High-mobility group box 1 preconditioning protects against liver ischemia-reperfusion injury J. Immunol. 176,7154-7158[Abstract/Free Full Text]
  42. 22
  43. Salmivirta, M., Rauvala, H., Elenius, K., Jalkanen, M. (1992) Neurite growth-promoting protein (amphoterin, p30) binds syndecan Exp. Cell Res. 200,444-451[CrossRef][Medline]
  44. 23
  45. Kuniyasu, H., Yano, S., Sasaki, T., Sasahira, T., Sone, S., Ohmori, H. (2005) Colon cancer cell-derived high mobility group 1/amphoterin induces growth inhibition and apoptosis in macrophages Am. J. Pathol. 166,751-760[Abstract/Free Full Text]
  46. 24
  47. Huttunen, H. J., Fages, C., Rauvala, H. (1999) Receptor for advanced glycation end products (RAGE)-mediated neurite outgrowth and activation of NF-kappaB require the cytoplasmic domain of the receptor but different downstream signaling pathways J. Biol. Chem. 274,19919-19924[Abstract/Free Full Text]
  48. 25
  49. Ishihara, K., Tsutsumi, K., Kawane, S., Nakajima, M., Kasaoka, T. (2003) The receptor for advanced glycation end-products (RAGE) directly binds to ERK by a D-domain-like docking site FEBS Lett. 550,107-113[CrossRef][Medline]
  50. 26
  51. Huttunen, H. J., Fages, C., Kuja-Panula, J., Ridley, A. J., Rauvala, H. (2002) Receptor for advanced glycation end products-binding COOH-terminal motif of amphoterin inhibits invasive migration and metastasis Cancer Res. 62,4805-4811[Abstract/Free Full Text]
  52. 27
  53. Ulloa, L., Messmer, D. (2006) High-mobility group box 1 (HMGB1) protein: Friend and foe Cytokine Growth Factor Rev. 17,189-201[CrossRef][Medline]
  54. 28
  55. Zimmermann, K., Volkel, D., Pable, S., Lindner, T., Kramberger, F., Bahrami, S., Scheiflinger, F. (2004) Native versus recombinant high-mobility group B1 proteins: functional activity in vitro Inflammation 28,221-229[CrossRef][Medline]
  56. 29
  57. Li, J., Wang, H., Mason, J. M., Levine, J., Yu, M., Ulloa, L., Czura, C. J., Tracey, K. J., Yang, H. (2004) Recombinant HMGB1 with cytokine-stimulating activity J. Immunol. Methods 289,211-223[CrossRef][Medline]
  58. 30
  59. Rauvala, H., Pihlaskari, R. (1987) Isolation and some characteristics of an adhesive factor of brain that enhances neurite outgrowth in central neurons J. Biol. Chem. 262,16625-16635[Abstract/Free Full Text]
  60. 31
  61. Golde, S., Chandran, S., Brown, G. C., Compston, A. (2002) Different pathways for iNOS-mediated toxicity in vitro dependent on neuronal maturation and NMDA receptor expression J. Neurochem. 82,269-282[CrossRef][Medline]
  62. 32
  63. Graziani-Bowering, G. M., Graham, J. M., Filion, L. G. (1997) A quick, easy and inexpensive method for the isolation of human peripheral blood monocytes J. Immunol. Methods 207,157-168[CrossRef][Medline]
  64. 33
  65. Ylonen, A., Rinne, A., Herttuainen, J., Bogwald, J., Jarvinen, M., Kalkkinen, N. (1999) Atlantic salmon (Salmo salar L.) skin contains a novel kininogen and another cysteine proteinase inhibitor Eur. J. Biochem. 266,1066-1072[Medline]
  66. 34
  67. Ylonen, A., Kalkkinen, N., Saarinen, J., Bogwald, J., Helin, J. (2001) Glycosylation analysis of two cysteine proteinase inhibitors from Atlantic salmon skin: di-O-acetylated sialic acids are the major sialic acid species on N-glycans Glycobiology 11,523-531[Abstract/Free Full Text]
  68. 35
  69. Chen, X., Doffek, K., Sugg, S. L., Shilyansky, J. (2004) Phosphatidylserine regulates the maturation of human dendritic cells J. Immunol. 173,2985-2994[Abstract/Free Full Text]
  70. 36
  71. Froman, G., Switalski, L. M., Speziale, P., Hook, M. (1987) Isolation and characterization of a fibronectin receptor from Staphylococcus aureus J. Biol. Chem. 262,6564-6571[Abstract/Free Full Text]
  72. 37
  73. Pasciak, M., Holst, O., Lindner, B., Mordarska, H., Gamian, A. (2003) Novel bacterial polar lipids containing ether-linked alkyl chains, the structures and biological properties of the four major glycolipids from Propionibacterium propionicum PCM 2431 (ATCC 14157T) J. Biol. Chem. 278,3948-3956[Abstract/Free Full Text]
  74. 38
  75. Nakano, T., Ishimoto, Y., Kishino, J., Umeda, M., Inoue, K., Nagata, K., Ohashi, K., Mizuno, K., Arita, H. (1997) Cell adhesion to phosphatidylserine mediated by a product of growth arrest-specific gene 6 J. Biol. Chem. 272,29411-29414[Abstract/Free Full Text]
  76. 39
  77. Chou, D. K., Evans, J. E., Jungalwala, F. B. (2001) Identity of nuclear high-mobility-group protein, HMG-1, and sulfoglucuronyl carbohydrate-binding protein, SBP-1, in brain J. Neurochem. 77,120-131[Medline]
  78. 40
  79. Schmidt, A. M., Hasu, M., Popov, D., Zhang, J. H., Chen, J., Yan, S. D., Brett, J., Cao, R., Kuwabara, K., Costache, G., et al (1994) Receptor for advanced glycation end products (AGEs) has a central role in vessel wall interactions and gene activation in response to circulating AGE proteins Proc. Natl. Acad. Sci. USA 91,8807-8811[Abstract/Free Full Text]
  80. 41
  81. Hou, F. F., Jiang, J. P., Guo, J. Q., Wang, G. B., Zhang, X., Stern, D. M., Schmidt, A. M., Owen, W. F., Jr (2002) Receptor for advanced glycation end products on human synovial fibroblasts: role in the pathogenesis of dialysis-related amyloidosis J. Am. Soc. Nephrol. 13,1296-1306[Abstract/Free Full Text]
  82. 42
  83. Valencia, J. V., Mone, M., Koehne, C., Rediske, J., Hughes, T. E. (2004) Binding of receptor for advanced glycation end products (RAGE) ligands is not sufficient to induce inflammatory signals: lack of activity of endotoxin-free albumin-derived advanced glycation end products Diabetologia 47,844-852[CrossRef][Medline]
  84. 43
  85. Ehlermann, P, Eggers, K, Bierhaus, A, Most, P, Weichenhan, D, Greten, J, Nawroth, PP, Katus, HA, Remppis, A. (2006) Increased proinflammatory endothelial response to S100A8/A9 after preactivation through advanced glycation end products Cardiovasc. Diabetol. 5,6[CrossRef][Medline]
  86. 44
  87. Rouhiainen, A., Imai, S., Rauvala, H., Parkkinen, J. (2000) Occurrence of amphoterin (HMG1) as an endogenous protein of human platelets that is exported to the cell surface upon platelet activation Thromb. Haemost. 84,1087-1094[Medline]
  88. 45
  89. Mohan, P. S., Laitinen, J., Merenmies, J., Rauvala, H., Jungalwala, F. B. (1992) Sulfoglycolipids bind to adhesive protein amphoterin (P30) in the nervous system Biochem. Biophys. Res. Commun. 182,689-696[CrossRef][Medline]
  90. 46
  91. Raetz, C. R., Dowhan, W. (1990) Biosynthesis and function of phospholipids in Escherichia coli J. Biol. Chem. 265,1235-1238[Free Full Text]
  92. 47
  93. Savill, J., Dransfield, I., Gregory, C., Haslett, C. (2002) A blast from the past: clearance of apoptotic cells regulates immune responses Nat. Rev. Immunol. 2,965-975[CrossRef][Medline]
  94. 48
  95. De, S. R., Ajmone-Cat, M. A., Nicolini, A., Minghetti, L. (2002) Expression of phosphatidylserine receptor and down-regulation of pro-inflammatory molecule production by its natural ligand in rat microglial cultures J. Neuropathol. Exp. Neurol. 61,237-244[Medline]
  96. 49
  97. Wagner, J. P., Quill, D. M., Pettijohn, D. E. (1995) Increased DNA-bending activity and higher-affinity DNA binding of high-mobility group protein HMG-1 prepared without acids J. Biol. Chem. 270,7394-7398[Abstract/Free Full Text]
  98. 50
  99. Baker, C., Isenberg, I., Goodwin, G. H., Johns, E. W. (1976) Physical studies of the nonhistone chromosomal proteins HMG-1 and HMG-2 Biochemistry 15,1645-1649[CrossRef][Medline]
  100. 51
  101. Elton, T. S., Reeves, R. (1985) The effects of oxidation on the reverse-phase high-performance liquid chromatography characteristics of the high mobility groups 1 and 2 proteins Anal. Biochem. 149,316-321[CrossRef][Medline]
  102. 52
  103. Hardman, C. H., Broadhurst, R. W., Raine, A. R., Grasser, K. D., Thomas, J. O., Laue, E. D. (1995) Structure of the A-domain of HMG1 and its interaction with DNA as studied by heteronuclear three- and four-dimensional NMR spectroscopy Biochemistry 34,16596-16607[CrossRef][Medline]
  104. 53
  105. Kohlstaedt, L. A., Sung, E. C., Fujishige, A., Cole, R. D. (1987) Non-histone chromosomal protein HMG1 modulates the histone H1-induced condensation of DNA J. Biol. Chem. 262,524-526[Abstract/Free Full Text]
  106. 54
  107. Gaipl, U. S., Beyer, T. D., Baumann, I., Voll, R. E., Stach, C. M., Heyder, P., Kalden, J. R., Manfredi, A., Herrmann, M. (2003) Exposure of anionic phospholipids serves as anti-inflammatory and immunosuppressive signal–implications for antiphospholipid syndrome and systemic lupus erythematosus Immunobiology 207,73-81[CrossRef][Medline]
  108. 55
  109. Brouckaert, G., Kalai, M., Krysko, D. V., Saelens, X., Vercammen, D., Ndlovu, M., Haegeman, G., D'Herde, K., Vandenabeele, P. (2004) Phagocytosis of necrotic cells by macrophages is phosphatidylserine dependent and does not induce inflammatory cytokine production Mol. Biol. Cell 15,1089-1100[Abstract/Free Full Text]
  110. 56
  111. Mathison, J. C., Tobias, P. S., Wolfson, E., Ulevitch, R. J. (1992) Plasma lipopolysaccharide (LPS)-binding protein. A key component in macrophage recognition of gram-negative LPS J. Immunol. 149,200-206[Abstract]
  112. 57
  113. Vassallo, R., Kottom, T. J., Standing, J. E., Limper, A. H. (2001) Vitronectin and fibronectin function as glucan binding proteins augmenting macrophage responses to Pneumocystis carinii Am. J. Respir. Cell Mol. Biol. 25,203-211[Abstract/Free Full Text]
  114. 58
  115. Gao, B., Tsan, M. F. (2003) Recombinant human heat shock protein 60 does not induce the release of tumor necrosis factor alpha from murine macrophages J. Biol. Chem. 278,22523-22529[Abstract/Free Full Text]
  116. 59
  117. Bausinger, H., Lipsker, D., Ziylan, U., Manie, S., Briand, J. P., Cazenave, J. P., Muller, S., Haeuw, J. F., Ravanat, C., de la Salle, H., et al (2002) Endotoxin-free heat-shock protein 70 fails to induce APC activation Eur. J. Immunol. 32,3708-3713[CrossRef][Medline]
  118. 60
  119. Gao, B., Tsan, M. F. (2003) Endotoxin contamination in recombinant human heat shock protein 70 (Hsp70) preparation is responsible for the induction of tumor necrosis factor alpha release by murine macrophages J. Biol. Chem. 278,174-179[Abstract/Free Full Text]
  120. 61
  121. Reed, R. C., Berwin, B., Baker, J. P., Nicchitta, C. V. (2003) GRP94/gp96 elicits ERK activation in murine macrophages. A role for endotoxin contamination in NF-{kappa}B activation and nitric oxide production J. Biol. Chem. 278,31853-31860[Abstract/Free Full Text]
  122. 62
  123. Lowenstein, C. J., Padalko, E. (2004) iNOS (NOS2) at a glance J. Cell Sci. 117,2865-2867[Free Full Text]
  124. 63
  125. Yonekura, H., Yamamoto, Y., Sakurai, S., Watanabe, T., Yamamoto, H. (2005) Roles of the receptor for advanced glycation endproducts in diabetes-induced vascular injury J. Pharmacol. Sci. 97,305-311[CrossRef][Medline]
  126. 64
  127. Sumi, D., Ignarro, L. J. (2004) Regulation of inducible nitric oxide synthase expression in advanced glycation end product-stimulated raw 264.7 cells: the role of heme oxygenase-1 and endogenous nitric oxide Diabetes 53,1841-1850[Abstract/Free Full Text]
  128. 65
  129. Adami, C., Bianchi, R., Pula, G., Donato, R. (2004) S100B-stimulated NO production by BV-2 microglia is independent of RAGE transducing activity but dependent on RAGE extracellular domain Biochim. Biophys. Acta 1742,169-177[Medline]
  130. 66
  131. Kim, J. B., Sig Choi, J., Yu, Y. M., Nam, K., Piao, C. S., Kim, S. W., Lee, M. H., Han, P. L., Park, J. S., Lee, J. K. (2006) HMGB1, a novel cytokine-like mediator linking acute neuronal death and delayed neuroinflammation in the postischemic brain J. Neurosci. 26,6413-6421[Abstract/Free Full Text]

Related Article

Interview with Dr. Heikki Rauvala regarding Pivotal Advance: Analysis of proinflammatory activity of highly purified eukaryotic recombinant HMGB1 (amphoterin)
Marco E. Bianchi
J. Leukoc. Biol. 2007 81: 46-48. [Full Text] [PDF]



This article has been cited by other articles:


Home page
Rheumatology (Oxford)Home page
I. Garcia-Arnandis, M. I. Guillen, M. A. Castejon, F. Gomar, and M. J. Alcaraz
Haem oxygenase-1 down-regulates high mobility group box 1 and matrix metalloproteinases in osteoarthritic synoviocytes
Rheumatology, January 27, 2010; (2010): kep463v1 - kep463.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y.-H. Qin, S.-M. Dai, G.-S. Tang, J. Zhang, D. Ren, Z.-W. Wang, and Q. Shen
HMGB1 Enhances the Proinflammatory Activity of Lipopolysaccharide by Promoting the Phosphorylation of MAPK p38 through Receptor for Advanced Glycation End Products
J. Immunol., November 15, 2009; 183(10): 6244 - 6250.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. E. Bianchi
HMGB1 loves company
J. Leukoc. Biol., September 1, 2009; 86(3): 573 - 576.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
H. S. Hreggvidsdottir, T. Ostberg, H. Wahamaa, H. Schierbeck, A.-C. Aveberger, L. Klevenvall, K. Palmblad, L. Ottosson, U. Andersson, and H. E. Harris
The alarmin HMGB1 acts in synergy with endogenous and exogenous danger signals to promote inflammation
J. Leukoc. Biol., September 1, 2009; 86(3): 655 - 662.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
Y. Nawa, K.-i. Kawahara, S. Tancharoen, X. Meng, H. Sameshima, T. Ito, Y. Masuda, H. Imaizumi, T. Hashiguchi, and I. Maruyama
Nucleophosmin may act as an alarmin: implications for severe sepsis
J. Leukoc. Biol., September 1, 2009; 86(3): 645 - 653.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
R. Takamiya, C.-C. Hung, S. R. Hall, K. Fukunaga, T. Nagaishi, T. Maeno, C. Owen, A. A. Macias, L. E. Fredenburgh, A. Ishizaka, et al.
High-Mobility Group Box 1 Contributes to Lethality of Endotoxemia in Heme Oxygenase-1-Deficient Mice
Am. J. Respir. Cell Mol. Biol., August 1, 2009; 41(2): 129 - 135.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
R. Yang, K. Miki, N. Oksala, A. Nakao, L. Lindgren, M. E. Killeen, A. Mennander, M. P. Fink, and J. Tenhunen
Bile high-mobility group box 1 contributes to gut barrier dysfunction in experimental endotoxemia
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2009; 297(2): R362 - R369.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
K. Tsoyi, T. Y. Lee, Y. S. Lee, H. J. Kim, H. G. Seo, J. H. Lee, and K. C. Chang
Heme-Oxygenase-1 Induction and Carbon Monoxide-Releasing Molecule Inhibit Lipopolysaccharide (LPS)-Induced High-Mobility Group Box 1 Release in Vitro and Improve Survival of Mice in LPS- and Cecal Ligation and Puncture-Induced Sepsis Model in Vivo
Mol. Pharmacol., July 1, 2009; 76(1): 173 - 182.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
R. K. Aneja, A. Tsung, H. Sjodin, J. V. Gefter, R. L. Delude, T. R. Billiar, and M. P. Fink
Preconditioning with high mobility group box 1 (HMGB1) induces lipopolysaccharide (LPS) tolerance
J. Leukoc. Biol., November 1, 2008; 84(5): 1326 - 1334.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. M. Rowe, P. L. Jackson, G. Liu, M. Hardison, A. Livraghi, G. M. Solomon, D. B. McQuaid, B. D. Noerager, A. Gaggar, J. P. Clancy, et al.
Potential Role of High-Mobility Group Box 1 in Cystic Fibrosis Airway Disease
Am. J. Respir. Crit. Care Med., October 15, 2008; 178(8): 822 - 831.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Liu, J. Wang, Y.-J. Park, Y. Tsuruta, E. F. Lorne, X. Zhao, and E. Abraham
High Mobility Group Protein-1 Inhibits Phagocytosis of Apoptotic Neutrophils through Binding to Phosphatidylserine
J. Immunol., September 15, 2008; 181(6): 4240 - 4246.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
A. Zicari, C. Centonze, M. Realacci, B. Buchetti, A. Pietropolli, and C. Ticconi
Estradiol 17-{beta} and Progesterone Modulate Inducible Nitric Oxide Synthase and High Mobility Group Box 1 Expression in Human Endometrium
Reproductive Sciences, July 1, 2008; 15(6): 559 - 566.
[Abstract] [PDF]


Home page
J. Immunol.Home page
J. H. Youn, Y. J. Oh, E. S. Kim, J. E. Choi, and J.-S. Shin
High Mobility Group Box 1 Protein Binding to Lipopolysaccharide Facilitates Transfer of Lipopolysaccharide to CD14 and Enhances Lipopolysaccharide-Mediated TNF-{alpha} Production in Human Monocytes
J. Immunol., April 1, 2008; 180(7): 5067 - 5074.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. H. H. Williams and H. E. Ireland
Sensing danger--Hsp72 and HMGB1 as candidate signals
J. Leukoc. Biol., March 1, 2008; 83(3): 489 - 492.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Sha, J. Zmijewski, Z. Xu, and E. Abraham
HMGB1 Develops Enhanced Proinflammatory Activity by Binding to Cytokines
J. Immunol., February 15, 2008; 180(4): 2531 - 2537.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
R. M. Levy, K. P. Mollen, J. M. Prince, D. J. Kaczorowski, R. Vallabhaneni, S. Liu, K. J. Tracey, M. T. Lotze, D. J. Hackam, M. P. Fink, et al.
Systemic inflammation and remote organ injury following trauma require HMGB1
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2007; 293(4): R1538 - R1544.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
D. S. Pisetsky
The Role of Nuclear Macromolecules in Innate Immunity
Proceedings of the ATS, July 1, 2007; 4(3): 258 - 262.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.0306200v1
81/1/49    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rouhiainen, A.
Right arrow Articles by Rauvala, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rouhiainen, A.
Right arrow Articles by Rauvala, H.
Related Collections
Right arrowRelated Article