| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Published online before print September 15, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Neuroscience Center, and Institute of Biotechnology, University of Helsinki, Helsinki, Finland
1Correspondence: Neuroscience Center, Viikinkaari 4, PL 56, University of Helsinki, Helsinki 00014, Finland. E-mail: ari.rouhiainen{at}helsinki.fi
ABSTRACT
HMGB1 (amphoterin) is a 30-kDa heparin-binding protein that mediates transendothelial migration of monocytes and has proinflammatory cytokine-like activities. In this study, we have investigated proinflammatory activities of both highly purified eukaryotic HMGB1 and bacterially produced recombinant HMGB1 proteins. Mass analyses revealed that recombinant eukaryotic HMGB1 has an intrachain disulphide bond. In mass analysis of tissue-derived HMGB1, two forms were detected: the carboxyl terminal glutamic acid residue lacking form and a full-length form. Cell culture studies indicated that both eukaryotic and bacterial HMGB1 proteins induce TNF-
secretion and nitric oxide release from mononuclear cells. Affinity chromatography analysis revealed that HMGB1 binds tightly to proinflammatory bacterial substances. A soluble proinflammatory substance was separated from the bacterial recombinant HMGB1 by chloroform-methanol treatment. HMGB1 interacted with phosphatidylserine in both solid-phase binding and cell culture assays, suggesting that HMGB1 may regulate phosphatidylserine-dependent immune reactions. In conclusion, HMGB1 polypeptide has a weak proinflammatory activity by itself, and it binds to bacterial substances, including lipids, that may strengthen its effects.
Key Words: inflammation • nitric oxide • phosphatidylserine • RAGE • TNF-
INTRODUCTION
HMGB1 (amphoterin) is a 30-kDa heparin-binding protein widely expressed in different tissues and organisms [1 2 3 ]. Macrophages, monocytes, endothelial cells, neurons, and various tumor cells secrete HMGB1 after induction, and high amounts of HMGB1 have been detected in serum samples of various inflammatory diseases [4 5 6 7 8 9 10 ].
Recent studies have highlighted the role of HMGB1 as a monocyte and endothelium-activating substance, and mediator of inflammation [4 , 11 , 12 , and as reviewed in 13 and 14 ]. HMGB1 induces inflammation during necrosis, whereas in apoptotic cells, it is sequestered to the nucleus [11 ]. During trauma and inflammation, HMGB1 is massively released to extracellular space, where it mediates organ damage and lethality [4 , 15 ]. Further, elevated levels of extracellular HMGB1 or HMGB1 mRNA are detected in cancer and in inflammatory disorders, suggesting that HMGB1 is acting as a widespread inflammatory mediator [16 , 17 ].
HMGB1 binds to several transmembrane receptors, including the receptor for advanced glycation end products (RAGE), Toll-like receptors 2 and 4 (TLR2/4), and syndecan-1 (CD138), and generates proinflammatory signaling to nucleus [18
19
20
21
22
]. Well-characterized signaling routes of HMGB1 are NF-
B and ERK1/2 activation by RAGE-ligation, and IKKa/b and NF-B activation by TLRs [19
, 23
24
25
]. In addition, HMGB1 and RAGE mediate transendothelial migration of monocytes and tumor cells [5
, 26
].
HMGB1 has a characteristic bipolar structure (amphoterin), and it avidly binds to various substances like DNA or heparin [2 ]. Further, it is often post-translationally modified [27 ]. Whether HMGB1 in solid tissue or circulation binds other inflammation mediators is currently unclear. HMGB1 derived from eukaryotic cells is less proinflammatory than the recombinant protein derived from bacterial expression systems [28 , 29 ]. This suggests that the different forms of HMGB1 or the existence of HMGB1 binding cofactors influence proinflammatory activity.
We have produced recombinant HMGB1 (recHMGB1) in a baculovirus system yielding high expression levels (50–100 mg/l) of recombinant protein [10 ]. In addition, we have produced an E. coli-derived recombinant, and purified HMGB1 from tissue. In this study, we have tested the effect of both tissue derived and recombinant HMGB1 proteins in mononuclear cell proinflammatory responses.
MATERIALS AND METHODS
Materials
ATP (ATP), lipopolysaccharide (LPS), phosphatidic acid, phosphatidylethanolamine, polymyxin B and S100b were from Sigma-Aldrich (St. Louis, MO, USA). Phosphatidylserine was from Avanti Polar Lipids (Alabaster, AL, USA). Advanced glycation end bovine serum albumin (AGE-BSA) was produced as described [24
]. Recombinant HMGB1 (recHMGB1) was produced and purified as described, and analyzed in GelCode Blue (Pierce, Rockford, IL)-stained SDS-PAGE [5
, 10
]. cDNA coding for amino terminal amino acids 1-185 of HMGB1 was cloned into pGEX-6P-1-plasmid. Recombinant GST-fusion protein (deltaC-HMGB1) was expressed in BL21(pLysS) bacteria, and purified using glutathione-sepharose column and PerScission Protease method (GE Healthcare Bio-Sciences AB, Uppsala, Sweden). In some experiments deltaC-HMGB1 was further purified with HiTrap Heparin and HiTrap SP chromatographies (GE Healthcare Bio-Sciences AB, New York, NY). The truncated HMGB1 (deltaC-HMGB1) is still capable to trigger RAGE signaling [26
], but it is more soluble than the nascent HMGB1. Tissue HMGB1 was isolated from E18-P2 rat brain using heparin-sepharose and Affi-Gel Blue chromatographies (GE Healthcare Bio-Sciences AB) as described, except that the NaDH washing step was omitted [30
]. DNA content in recombinant protein stocks were measured using CyQuant Kit (Promega, Madison, WI). Both recHMGB1 and deltaC-HMGB1 contained 0.03 µg DNA per 1 mg of protein. Endotoxin content in recHMGB1 fraction was under detection limit [5
].
Cells and cell culture
RAW 264.7 cells were cultured as described [5
]. Mixed rat glial cultures were prepared from neonatal rat brain and cultured as described [31
]. PBMCs were isolated from adult male NMRI mice. Blood was collected; mononuclear cells were enriched using a method described by Graziani-Bowering et al., and cells were washed with 1 mM EDTA-PBS [32
]. In some assays, mononuclear cell fractions from two mice were pooled. Cells in 10% FCS-RPMI were adhered to HMGB1-coated or control cell culture wells.
Primary and secondary structure analyses
HMGB1 used in mass analyses was analyzed and purified using RP-HPLC [10
, 33
]. In some studies recHMGB1 was reduced and alkylated. Alkylation was done using 4-vinylpyridine alkylating agent, which causes 105 Da or 106 Da increase in mass when bound to nonreduced or reduced cysteine residue, respectively [34
]. Trypsin digestion and mass spectrometric analyses were carried out as described [33
, 34
]. To determine disulfide-bonded cysteines, tryptic peptides derived from nonreduced recHMGB1 were analyzed in mass spectrometry.
Database searches
Expressed sequence tag (EST) searches of nucleotide databases were done using tools from the Web sites of National Center for Biotechnology Information (Rockville Pike, Bethesda, MD).
Heparin-binding experiments
Heparin-sepharose chromatographies were done as described previously [30
] using Äkta chromatography station and 1 ml HiTrap heparin column (GE Healthcare Bio-Sciences AB). In some experiments, samples contained 1 mM dithiothreitol or 10 mM ß-mercaptoethanol.
TNF- induction and secretion assays
In HMGB1-induced RAW 264.7 macrophage secretion assays, 0.1–0.2 x 106 cells (in OPTIMEM I medium, Invitrogen, Carlsbad, CA) were cultured in the wells of cell culture plates. Proteins or LPS were added in the medium as defined in each experiment, and cells were cultured for indicated times. In some studies, reduced (3% ß-mercaptoethanol treated) proteins were coated to wells for 1 h and washed before cell culture. TNF- concentration in culture medium was measured using ELISA (Bender Medsystems, Vienna, Austria). TNF- standards used in ELISA were from Bender Medsystems, Roche (Mannheim, Germany) and Endogen (Pierce). Resulting TNF- values were normalized to values from uninduced cells, which was defined as 100%.
Mouse PBMC TNF- mRNA induction and protein secretion
Cells were adhered to HMGB1-coated or control 48-well plate wells (3–7 wells/mouse total PBMCs) in 10% FCS-RPMI and cultured for 6 h. TNF- in culture media was quantified using ELISA. In some assays, mRNA coding for TNF- was detected from PBMC-cultures by RT-PCR. Cells were cultured for 6 h, and RT-PCR analysis was done as described [5
]. Primers for TNF- were acagaaagcatgatccgcgacg and ggctcagccactccagctgctc. Amplified DNA was analyzed in agarose gel electrophoresis, and relative OD values of bands were measured as described [5
]. Porphobilinogen deaminase housekeeping gene was used as a control, and TNF- values were normalized to porphobilinogen deaminase values. The OD value of uninduced cells was defined as 1.
Interleukin-6 (IL-6) and monocyte chemotactic protein-1 (MCP-1) expression analyses
RAW 264.7 cells were cultured for 2 days in OPTI-MEM I with or without coated recHMGB1 (20 µg/ml), S100b (20 µg/ml), AGE-BSA (500 µg/ml) or with soluble LPS (0.1 µg/ml). Equal amounts of RNA were reverse transcribed and analyzed in RT-PCR. The oligopairs for IL-6 and MCP-1 were cagttgccttcttgggactgatgctg and agcatccatcatttctttgtatctctgg, and atgcaggtccctgtcatgcttctgg and ggtgctgaagaccttagggcagatg, respectively. IL-6 and MCP-1 values were normalized to porphobilinogen deaminase values [5
]. The OD value of uninduced cells was defined as 1. Trimmean values, excluding 17% of lowest and highest values, were calculated for IL-6 samples, and mean values were calculated for MCP-1 samples.
Nitric oxide secretion assay
RAW 264.7 or mixed rat glial cultures were treated with various amounts of HMGB1 proteins or LPS and cultured for indicated times. RAW 264.7 cells were cultured in RPMI or DMEM supplemented with 10% FCS, and PBMCs were cultured in RPMI supplemented with 10% FCS. 10 µg/ml of polymyxin B was added to some assays. Nitric oxide was quantified from culture media using Greiss Reagent System (Promega). Inducible nitric oxide synthase (iNOS) expression levels were analyzed with RT-PCR using the primers atggcttgcccctggaagttt and ggcttgtctctgggtcctctggt. Amplified DNA was normalized and quantified as described above.
Coculture of endotoxin-activated RAW 264.7 cells with phospholipid vesicles and recHMGB1
Cells were cultured on microwell plates in 10% FCS-RPMI (1.5x105 cells/well). LPS (10 ng/ml) was added to all of the wells. Phospholipid vesicles containing phosphatidylcholine alone or phosphatidylcholine (70%) and phosphatidylserine (30%) were made as described with two exceptions: the chloroform was evaporated with nitrogen gas, and filter pore size used was 0.2 µm [35
]. Various amounts of phospholipid vesicles with or without 30 µg/ml of recHMGB1 were added, and cells were cultured for 20 h. Nitric oxide in culture media was quantified using Greiss Reagent System. Values from cell cultures without added lipids were determined as 1, and values of lipid containing wells were normalized to this value in both control and recHMGB1 samples.
Extraction of HMGB1-binding bacterial substances
XL-1 E. Coli cells were homogenized in cold TBS containing lysozyme (Sigma) and protease inhibitors [36
]. RecHMGB1 was coupled to EAH-sepharose (GE Healthcare Bio-Sciences AB) at the concentration of 1 mg per 1 ml of sepharose gel. The cleared soluble fraction was applied to recHMGB1 column. The column was washed with TBS containing 0.5 M NaCl, and bound substances were eluted with increasing salt concentrations. Uncoupled sepharose CL-4B (Sigma) was used as a control column. DNA content in the fractions was measured using CyQuant assay kit. For macrophage TNF- secretion induction measurement, diluted fractions were coated to plastic wells. Macrophages were adhered to wells and cultured, and TNF- was measured by ELISA.
RecHMGB1 or glutathione-sepharose column and PerScission Protease method purified deltaC-HMGB1 were used as samples in chloroform-methanol extraction. Extraction was done using the method described by M. Pasciak et al. with some modifications [37
]. Briefly, 5 µg of protein was diluted in 100 µl of PBS in polypropylene tube, and 600 µl of chloroform-methanol (2:1) was added with mixing. Then, 200 µl of methanol and 300 µl of water was added, tubes were mixed by vortexing, and centrifuged at 16,000 g for 5 min. The upper phase was dried to plastic tubes, and 4 x 105 RAW 264.7 cells in 400 µl of OPTIMEM I was added to tubes. Tubes were mixed after 30 min incubation, and after 60 min incubation, cell suspensions were transferred to a 48-well plate and subcultured for 2 h. TNF- was quantified from culture supernatants using ELISA.
Phospholipid binding assay
The assay was carried out essentially as described by Nakano et al. [38
]. Phospholipids were dissolved in methanol, and various amounts of lipids (0, 100, or 300 µg) were added in 100 µl to microwells and dried. Wells were blocked with 1% BSA-PBS, and 2 µg/ml of recHMGB1 in 1% BSA-PBS was added to the wells for 1 h. The wells were washed, and bound recHMGB1 was detected with antipeptide I and antipeptide III ELISAs [10
]. Wells omitting the primary antibody were used as negative controls.
Statistics
P values were calculated using Student's unpaired t test in Microsoft® Excel2000 program (Microsoft Corporation, Redmond, WA). Error bars in all figures represent means ± SD.
RESULTS
Structural analysis of HMGB1
Recombinant HMGB1 proteins were produced in either S9 baculovirus or E. coli expression systems. The baculovirus system produced extremely high levels of full-length recHMGB1, yielding 50–100 mg/l of recombinant protein in culture stocks from which it was purified with heparin-sepharose and ion exchange chromatography [10
]. Tissue-HMGB1 was isolated from young rat brain with a two-step chromatography method using heparin-sepharose and Affi Gel Blue chromatography [30
]. Both recHMGB1 and tissue-HMGB1 migrated as a single band in SDS-PAGE both under nonreducing and reducing conditions (Fig. 1A
and data not shown). The finding that proteins migrated faster under reducing conditions suggests that the oxidation state is the same in both eukaryotic proteins. Mass spectrometric analyses of tissue-HMGB1 suggested that, compared with the recHMGB1, the major form lacks the carboxyl terminal glutamic acid residue (the mass was 129 Da lower than excepted), and the minor form is the full-length protein. Results of tissue HMGB1 analyses are similar to results by Chou et al. [39
]. No ESTs coding for glutamic acid residue-lacking form of rat HMGB1 were found in databases, suggesting that lack of the glutamic acid residue is not due to modifications of the HMGB1 transcript (data not shown).
|
The mass of the RP-HPLC purified recHMGB1 was 2–3 Da lower than the calculated theoretical mass, suggesting one intrachain disulphide bond (Fig. 1E) . Mass-spectrometric analyses of the trypsinized recHMGB1 peptides showed that the disulfide bond exists between the first two cysteines within the A-box in the HMGB1 derived from the first peak of RP-HPLC (data not shown).
We tested whether reduction has any effect on heparin binding. The reduced and nonreduced recHMGB1 bound to heparin-sepharose with a similar affinity, indicating that heparin binding of HMGB1 is redox state independent (Fig. 1F) .
Effect of HMGB1 proteins on TNF- secretion from mononuclear cells
The eukaryotic and bacterial recombinant HMGB1 proteins and the tissue-derived protein were tested for their effect on TNF- secretion using RAW 267.4 cells or mouse PBMCs. The full-length bacterial recombinant was somewhat more active than the deleted form (deltaC-HMGB1), but both recombinants rapidly induced TNF- secretion when added in solution or coated on the substrate (shown for deltaC-HMGB1 in a 3-h assay in Fig. 2A
). In contrast, no significant TNF- induction was observed under the same conditions for the eukaryotic recombinant HMGB1 in 3-h assays (Fig. 2A)
. However, a TNF- inducing activity that was slightly above the baseline was observed for the eukaryotic proteins in long-term assays (shown for the recombinant and tissue-derived protein in an 8-h assay in Fig. 2B
). The reducing agent ß-mercaptoethanol had no effect on the ability of recombinant HMGB1 proteins to induce TNF- secretion (data not shown). An inducing effect on TNF- secretion and mRNA level was also observed for eukaryotic HMGB1 in PBMCs in 6-h assays (Fig. 2C
and 2D)
.
|
|
|
|
secretion. No such activity was found in eukaryotic recHMGB1 or bacterial protein that was further purified with heparin- and ion-exchange chromatography (Fig. 4B
and data not shown). HMGB1 has been previously shown to bind both phosphatidylserine and sulfatide lipids [44 , 45 ]. In this study, we tested HMGB1 binding to three phospholipids expressed in E. coli: phosphatidic acid, phosphatidylethanolamine, and phosphatidylserine [46 ]. HMGB1 bound strongly to phosphatidylserine as excepted. In addition, HMGB1 bound strongly to phosphatidic acid. Binding to phosphatidylethanolamine was much weaker (Fig. 4C) .
Phosphatidylserine is a well-known immune suppressor [47 ]. Therefore, we tested the effect of recHMGB1 on phosphatidylserine-mediated inhibition of nitric oxide release from macrophages [48 ]. Phosphatidylserine vesicles inhibited LPS induced nitric oxide release from RAW 264.7 cells dose dependently (Fig. 4D) . Coincubation with recHMGB1 affected only slightly the inhibitory effect of phosphatidylserine (Fig. 4D) .
DISCUSSION
In the current study, we have taken advantage of the high expression level of HMGB1 in our baculovirus expression system in insect cells, which is expected to reduce the risk of contaminating substances in the recombinant protein. The expression system made it possible to isolate the recombinant in a highly purified form using mild nondenaturing conditions, without using trichloroacetic acid that is commonly used to purify HMG-type proteins. For example, plasminogen activation-enhancing effect by HMGB1 and its DNA binding capability are strongly affected by acid treatment of the protein [10 , 49 ]. Further, we have purified tissue-derived HMGB1 from rat brain and show that it is very similar to recHMGB1.
Structural studies of the baculovirus-derived HMGB1 produced in animal cells show that it contains an intrachain disulfide bond. Occurrence of the disulfide bond has been also demonstrated in HMGB1 isolated from tissue [30 , 50 , 51 ]. The molecular mass of the recombinant HMGB1 corresponds exactly to the calculated molecular mass and does not give evidence of other post-translational modifications, than the presence of one disulfide bond. The tissue-derived HMGB1 used in this study differs from the recombinant eukaryotic protein in that the major form lacks the carboxyl terminal glutamic acid residue. The minor form is the full-length protein.
Post-translational modifications may regulate induction of inflammatory reactions by HMGB1 [27
]. The results of this study indicate that genuine reduced and oxidized HMGB1 polypeptides are weak TNF- and nitric oxide-inducing agents in mononuclear cells. Further studies are warranted to reveal how post-translational modifications affect proinflammatory activity of HMGB1.
Treatment with reducing agents has no effect on HMGB1’s heparin binding activity or proinflammatory activity, suggesting that HMGB1 can preserve its functions in the absence of the disulfide bond. In addition, NMR studies have previously shown that the recombinant A-box of HMGB1, having one cysteine replaced with serine, folds in a manner that allows a close contact of the cysteine with the replacing serine residue [52
]. This suggests that the disulfide formation is not necessary for folding to such conformation where the two cysteines are in close proximity. Further, CD spectroscopy studies revealed that both the reduced and nonreduced recHMGB1 have essentially the same -helical structure, suggesting that reduction has no effect on secondary structure (Tumova and Rauvala, unpublished results). In contrast, CD spectroscopy studies of perchloric acid-treated HMGB1 revealed major changes in spectra after reducing of the disulfide bond [53
].
Our current results and previous results from other groups suggest that eukaryotic and bacterial HMGB1 proteins differ in their ability to induce TNF- [28
, 29
]. Further, our results show that a TNF--inducing activity can be extracted by a lipid solvent (chloroform/methanol) from the bacterially expressed recombinant but not from the highly purified baculovirus-derived protein expressed in animal cells. It seems probable that the extremely high expression level achieved in our eukaryotic system largely overrides the occurrence of copurifying factor(s) that enhance proinflammatory activity.
The occurrence of the proinflammatory activity in the polar phase in Folch partition after chloroform-methanol extraction of the bacterially produced recombinant suggests that the activity is enhanced by a polar lipid. Tentative analysis of lipids in this fraction using mass spectrometry reveals a complex lipid pattern (A. Rouhiainen, H. Rauvala, and P. Somerharju, unpublished observations), and further work is warranted to elucidate the molecular nature of the active components(s). Furthermore, we show that HMGB1 binds to purified lipids in a microwell binding assay and interacts with phosphatidylserine in cell culture assay, agreeing with our previous finding of HMGB1 binding to platelet lipids [44 ]. It appears clear that HMGB1 binds at least phosphatidic acid and phosphatidylserine. Interestingly, phosphatidylserine has been implicated in the regulation of inflammation [54 , 55 ], and HMGB1 might thus affect interactions of phosphatidylserine with cells and regulate its anti-inflammatory activities.
HMGB1 is present in circulation during different inflammatory diseases, but its function there is not fully understood [4 , 6 , 7 ]. Binding of HMGB1 to substances derived from microbes and/or injured tissues might create complexes up-regulating innate immune responses that, in turn, jeopardize tissue integrity through production of toxic inflammatory mediators. Foreign material binding capacity phenomenon for some circulating proteins, such as the LPS binding protein, vitronectin, and fibronectin, is known to occur. These proteins have been shown to strengthen macrophage responses to bacterial substances [56 , 57 ]. Furthermore, other highly charged recombinant proteins, for example, heat shock proteins produced in bacterial expression systems [58 59 60 61 ], have been shown to induce immune cell activations through binding to microbe-derived substances.
Our nitric oxide induction results are similar to those of Kuniyasu et al. who detected nitric oxide induction in macrophages by eukaryotic HMGB1 [23
]. These results suggest that nitric oxide synthase upregulation and nitric oxide release are induced by high concentrations of HMGB1. Nitric oxide synthase gene expression is regulated by NF-B [reviewed in 62]. Since the HMGB1 receptors TLR2/4 and RAGE activate NF-B, it seems reasonable to assume that these receptors are involved in HMGB1/macrophage signaling [19
, 23
, 63
]. In fact, Kuniyasu et al. have shown that HMGB1 activates NF-B in human monocytes [23
]. Sumi and Ignarro have shown that AGE-BSA-induced nitric oxide synthase upregulation is inhibited by anti-RAGE antibodies in RAW 264.7 cells [64
]. However, Adami et al. described that the RAGE ligand S100b-induced nitric oxide release from microglial cells is RAGE signaling independent but RAGE-ectodomain mediated, suggesting that other cell surface receptors exist for S100b [65
]. The recent study by Kim et al. showed that down-regulation of HMGB1 by short hairpin RNA in postischemic brain decreases iNOS mRNA expression, suggesting that HMGB1 is involved in iNOS regulation in vivo [66
].
ACKNOWLEDGEMENTS
A. R. was supported by grants from the Aarne and Aili Turunen
Foundation and the Maud Kuistila Memorial Foundation. H. R. was supported by grants from the Academy of Finland, Finnish Cancer Organizations and the Sigrid Jusélius Foundation. We thank Seija Lehto and Eeva-Liisa Saarikalle for excellent technical assistance.
Received March 14, 2006; revised August 9, 2006; accepted August 9, 2006.
REFERENCES
B activation and nitric oxide production J. Biol. Chem. 278,31853-31860Related Article
This article has been cited by other articles:
|
|
 |
|
  R. K. Aneja, A. Tsung, H. Sjodin, J. V. Gefter, R. L. Delude, T. R. Billiar, and M. P. Fink Preconditioning with high mobility group box 1 (HMGB1) induces lipopolysaccharide (LPS) tolerance J. Leukoc. Biol., November 1, 2008; 84(5): 1326 - 1334. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Rowe, P. L. Jackson, G. Liu, M. Hardison, A. Livraghi, G. M. Solomon, D. B. McQuaid, B. D. Noerager, A. Gaggar, J. P. Clancy, et al. Potential Role of High-Mobility Group Box 1 in Cystic Fibrosis Airway Disease Am. J. Respir. Crit. Care Med., October 15, 2008; 178(8): 822 - 831. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Liu, J. Wang, Y.-J. Park, Y. Tsuruta, E. F. Lorne, X. Zhao, and E. Abraham High Mobility Group Protein-1 Inhibits Phagocytosis of Apoptotic Neutrophils through Binding to Phosphatidylserine J. Immunol., September 15, 2008; 181(6): 4240 - 4246. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Zicari, C. Centonze, M. Realacci, B. Buchetti, A. Pietropolli, and C. Ticconi Estradiol 17-{beta} and Progesterone Modulate Inducible Nitric Oxide Synthase and High Mobility Group Box 1 Expression in Human Endometrium Reproductive Sciences, July 1, 2008; 15(6): 559 - 566. [Abstract] [PDF]
|
|
|
|
|
|
J. H. Youn, Y. J. Oh, E. S. Kim, J. E. Choi, and J.-S. Shin High Mobility Group Box 1 Protein Binding to Lipopolysaccharide Facilitates Transfer of Lipopolysaccharide to CD14 and Enhances Lipopolysaccharide-Mediated TNF-{alpha} Production in Human Monocytes J. Immunol., April 1, 2008; 180(7): 5067 - 5074. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. H. Williams and H. E. Ireland Sensing danger--Hsp72 and HMGB1 as candidate signals J. Leukoc. Biol., March 1, 2008; 83(3): 489 - 492. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Sha, J. Zmijewski, Z. Xu, and E. Abraham HMGB1 Develops Enhanced Proinflammatory Activity by Binding to Cytokines J. Immunol., February 15, 2008; 180(4): 2531 - 2537. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. Levy, K. P. Mollen, J. M. Prince, D. J. Kaczorowski, R. Vallabhaneni, S. Liu, K. J. Tracey, M. T. Lotze, D. J. Hackam, M. P. Fink, et al. Systemic inflammation and remote organ injury following trauma require HMGB1 Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2007; 293(4): R1538 - R1544. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. S. Pisetsky The Role of Nuclear Macromolecules in Innate Immunity Proceedings of the ATS, July 1, 2007; 4(3): 258 - 262. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||
