Journal of Leukocyte Biology BioLegend: Treg, Th17, Stem Cell
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.0606402 on October 17, 2006

Published online before print October 17, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0606402v1
81/1/306    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, K.
Right arrow Articles by Braley-Mullen, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, K.
Right arrow Articles by Braley-Mullen, H.
(Journal of Leukocyte Biology. 2007;81:306-314.)
© 2007 by Society for Leukocyte Biology

Decreasing TNF-{alpha} results in less fibrosis and earlier resolution of granulomatous experimental autoimmune thyroiditis

Kemin Chen*,1,2, Yongzhong Wei*,1, Gordon C. Sharp*,{dagger} and Helen Braley-Mullen*,{ddagger},§

* Departments of Internal Medicine,
{dagger} Pathology, and
{ddagger} Molecular Microbiology and Immunology, University of Missouri School of Medicine, Columbia, Missouri, USA; and
§ VA Research Service, Columbia, Missouri, USA

2Correspondence: Division of Immunology and Rheumatology, Dept. of Medicine, University of Missouri, M306 Medical Sciences, One Hospital Dr., Columbia, MO 65212, USA. E-mail: chenk{at}health.missouri.edu


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Granulomatous experimental autoimmune thyroiditis (G-EAT) is induced in DBA/1 mice by adoptive transfer of mouse thyroglobulin (MTg)-primed spleen cells. TNF-{alpha} is an important proinflammatory cytokine and apoptotic molecule involved in many autoimmune diseases. To study its role in G-EAT, anti-TNF-{alpha} mAb was given to recipient mice. Disease severity was comparable between mice with or without anti-TNF-{alpha} treatment at days 19–21, the time of maximal severity of G-EAT, suggesting TNF-{alpha} is not essential for development of thyroid inflammation. However, thyroid lesions resolved at day 48 in anti-TNF-{alpha}-treated mice, while thyroids of rat Ig-treated controls had fibrosis. These results suggested that reducing TNF-{alpha} contributed to resolution of inflammation and inhibited fibrosis. Gene and protein expression of inflammatory molecules was examined by RT-PCR and immunostaining, and apoptosis was detected using TUNEL staining and an apoptosis kit. Thyroids of anti-TNF-{alpha}-treated controls had reduced proinflammatory and profibrotic molecules, e.g., IFN-{gamma}, IL-1ß, IL-17, inducible NOS and MCP-1, at day 19 compared with thyroids of rat Ig-treated mice. There were more apoptotic thyrocytes in rat Ig-treated controls than in anti-TNF-{alpha}-treated mice. The site of expression of the anti-apoptotic molecule FLIP also differed between rat Ig-treated and anti-TNF-{alpha}-treated mice. FLIP was predominantly expressed by inflammatory cells of rat Ig-treated mice and by thyrocytes of anti-TNF-{alpha}-treated mice. These results suggest that anti-TNF-{alpha} may regulate expression of proinflammatory cytokines and apoptosis in thyroids, resulting in less inflammation, earlier resolution, and reduced fibrosis.

Key Words: rodent • autoimmunity • cytokines


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Granulomatous experimental autoimmune thyroiditis (G-EAT) is an organ-specific autoimmune disease that can be induced in genetically susceptible mice by injection of MTg and adjuvant [1 2 3 4 5 ] or by adoptive transfer of spleen cells from MTg-primed donors activated in vitro with MTg and IL-12 [6 7 8 ]. G-EAT is characterized by proliferation of thyroid epithelial cells, granuloma formation, and destruction of the thyroid by T lymphocytes, large numbers of histiocytes, multinucleated giant cells, and variable numbers of neutrophils [6 7 8 ]. CD4+ T cells are the primary effector cells [6 , 7 ], while CD8+ T cells promote resolution of G-EAT [9 ]. Although the mechanisms by which CD4+ T cells cause thyroid destruction are not well understood, cytokines produced by activated CD4+ T cells are known to play an important role in the pathogenesis of EAT [6 7 8 ]. TNF-{alpha} and other proinflammatory cytokines are up-regulated in thyroids of mice with G-EAT [10 ]. Moreover, early resolution of G-EAT was observed in IFN-{gamma}–/– recipients, and reduction of several cytokines, including TNF-{alpha} may contribute to G-EAT resolution in IFN-{gamma}–/– mice [10 ].

TNF-{alpha} is a proinflammatory cytokine that plays a critical role in diverse cellular events. The binding of TNF-{alpha} to TNF-{alpha} receptors triggers a series of intracellular events that ultimately result in production of inflammatory cytokines via NF-kB activation or apoptosis [11 , 12 ]. Thus, TNF-{alpha} is a major mediator of apoptosis as well as inflammation and immunity. TNF-{alpha} is expressed in virtually all inflammatory autoimmune diseases and has been implicated in the pathogenesis of a wide spectrum of human autoimmune diseases, including rheumatoid arthritis, diabetes, multiple sclerosis, and inflammatory bowel disease [11 12 13 14 15 ]. However, the pathophysiological effects of TNF-{alpha} in autoimmune diseases are still incompletely understood, and research with other animal models may further clarify its functions [14 ]. TNF-{alpha} is also a profibrotic cytokine, but its role in fibrosis and its mechanism of action are not well defined [16 17 18 19 ].

This study was undertaken to define the role of TNF-{alpha} in autoimmune thyroiditis and to determine whether anti-TNF-{alpha} antibodies might be useful for decreasing autoimmune inflammation and fibrosis. TNF-{alpha} neutralization significantly promoted resolution of inflammation and reduced development of fibrosis in G-EAT. By detecting expression of proinflammatory cytokines, fibrotic and apoptotic molecules, the mechanisms by which TNF-{alpha} contributes to G-EAT pathology, were determined.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Mice
DBA/1 mice were bred in our animal facilities in accordance with the University of Missouri institutional guidelines for animal care. Both male and female mice (8–12 wk old) were used for these experiments.

Induction of G-EAT
G-EAT was induced as described previously [4 ]. Briefly, mice were injected intravenously (i.v.) twice at 10-day intervals with 150 µg MTg prepared as previous described [6 ] and 15 µg LPS (Escherichia coli 011:B4; Sigma Chemical, St. Louis, MO). Seven days later, donor spleen cells were restimulated in vitro with 25 µg/ml MTg and 5 ng/ml IL-12 [1 , 4 ]. Cells were harvested after 72 h, washed twice, and 3.5 x 107 cells were transferred i.v. to 500-Rad irradiated syngeneic recipients. Recipient thyroids were removed at days 19–21 (peak of disease) or 38–56 days (resolution) after cell transfer [6 7 8 ].

Anti-TNF-{alpha} treatment
Rat anti-mouse TNF-{alpha} (ATCC HB-10649) mAb was purified from culture supernatant using protein G-sepharose. Recipient mice were given 0.3 mg rat anti-mouse TNF-{alpha} mAb or normal rat IgG (Jackson Immunoresearch Laboratories, West Grove, PA) 1–2 days after cell transfer and every 3–4 days until termination of the experiment. The dosage of anti-TNF-{alpha} mAb was chosen based on use of anti-TNF-{alpha} mAb in other models [20 , 21 ].

Evaluation of thyroiditis
Thyroids were collected, fixed in formalin, sectioned, and stained with hematoxylin and eosin (H and E), as described previously [4 ]. Thyroids were scored quantitatively for EAT severity (the extent of thyroid follicle destruction) using a scale of 1+ to 5+, as described previously [6 7 8 ]. 1+ thyroiditis is defined as an infiltrate of at least 125 cells in one or several foci; 2+ is 10–20 foci of cellular infiltration involving up to 25% of the gland; 3+ indicates that 25–50% of the gland is infiltrated; 4+ indicates that >50% of the gland is destroyed by infiltrating inflammatory cells; and 5+ indicates virtually complete destruction of the thyroid with few or no remaining follicles. Thyroid lesions were also evaluated qualitatively. Thyroid lesions designated as granulomatous had enlargement and proliferation of thyroid follicular cells, with numerous histiocytes, multinucleated giant cells, and increased numbers of neutrophils in addition to the mononuclear cell infiltration. The more severely inflamed granulomatous thyroids (4–5+ severity scores) also had microabscess formation, necrosis, and focal fibrosis, and inflammation extended beyond the thyroid to involve adjacent muscle and connective tissue [7 ]. For evaluation of collagen deposition, some thyroid sections were stained using Masson’s Trichrome.

Serum thyroxine assay
Serum thyroxine (T4) levels were determined using a T4 enzyme immunoassay kit (Biotecx Labs, Houston, TX), according to the manufacturer’s instructions. Results are expressed as micrograms of T4 per deciliters of serum. Using this kit, we considered values >3 µg T4/dl of serum to be normal [22 ].

Immunohistochemistry and confocal analysis
Myofibroblasts, important cells involved in development of fibrosis, were recognized by staining using a mouse anti-{alpha}-smooth muscle actin ({alpha} SMA) (clone 1A4, Sigma) on paraffin sections of thyroids. Staining of TNF-{alpha}, active TGFß, inducible NOS (iNOS), MCP-1, FLIP, and caspase-3 was performed using the immunoperoxidase method, as described previously [10 , 22 , 23 ]. For IL-17 staining, rabbit anti-IL-17 [H-132; Santa Cruz Biotechnology, Santa Cruz, CA) was used. Following incubation with a secondary biotinylated goat anti-rabbit antibody (1:500) (Jackson ImmunoResearch Laboratories), immunoreactivity was demonstrated using the avidin-biotin complex immunoperoxidase system (Vector ABC peroxidase kit; Vector Laboratories, Burlingame, CA) with 3,3-diaminobenzidine tetrahydrochloride (DAB), Vector VIP (Vector Laboratories) or Vector NovaRED (Vector Laboratories) as the chromogen. Slides were counterstained with hematoxylin. Negative controls used nonimmune rat, rabbit, or goat Ig at a protein concentration equivalent to the respective primary antibodies. These controls were always negative.

Dual staining and confocal microscopy were used to detect apoptotic thyrocytes. Thyrocytes were identified by cytokeratin staining, and apoptosis was detected using an in situ cell death kit [23 ]. To more specifically detect apoptosis of thyrocytes, dual immunofluorescence and confocal laser scanning microscopy were done. Before staining, tissue sections were pretreated by microwave irradiation for antigen retrieval [23 ], and thyroid follicular cells were detected by pan-cytokeratin staining using FITC-labeled PCK-26 (Sigma). Apoptosis was detected using an in situ cell death kit (Roche, Indianapolis, IN). Slides were observed with a BioRad Radiance 2000 confocal system coupled to an Olympus IX70 inverted microscope.

RT-PCR amplification and real-time quantitative PCR
RT-PCR was performed as described previously [10 ] using specific primers [22 , 24 ]. To determine the relative initial amounts of target cDNA, each cDNA sample was serially diluted 1:5 and 1:25, and amplified with specific primers. Hypoxanthine phosphoribosyltransferase (HPRT) was used as a housekeeping gene to verify that the same amount of RNA was amplified. To compare relative levels of mRNA transcripts between different groups, samples were reverse transcribed and amplified at the same time using aliquots of reagent from the same master mix. The PCR products were analyzed using a digital imaging system (Life Sciences, St. Louis, MO). Samples within the linear relationship between input cDNA and final PCR products (usually 1/25 cDNA dilution) were collected, and empirically determined concentrations of first-strand cDNA were used in RT-PCR to ensure linear amplification of sequences. The densitometric units for each cytokine band were normalized to those for the corresponding HPRT band. Most cytokine gene primers used in this study have been described previously [22 , 24 ]. Primer sequences for IL-17 were: sense: GGTCAACCTCAAAGTCTTTAACTC, anti-sense: TTAAAA ATGCAAGTAAGTTTGCTG.

Real-time PCR was performed using an ABI Prism 7000 Sequence Detection System using SYBR Green PCR Master Mix (ABgene, Surrey, UK) following manufacturer’s protocols. Primers used were IFN{gamma} sense: TCAAGTGGCATAGATGTG GAAGAA, IFN{gamma} anti-sense: TGGCTCTGCAGGATTTTC ATG. MCP-1 forward: GTTGGCTCAGCCAGATGCA, MCP-1 reverse: AGCCTACTCATTGG GATCATCTT G. IL-17F sense: CCCATGGGATTACAACATCACTC, IL-17F anti-sense: CACTGGG CCTCAGCGATC. IL-10 forward: CAGCCTTG GAGAAAAGAGAG, IL-10 reverse: GGAAGTGGGTGGTGTTATTG. Each sample was amplified in triplicate. Values represent relative expression levels normalized to HPRT.

Statistical analysis
All experiments were repeated at least three times. Statistical significance was evaluated using the Mann-Whitney U test. Values with a P value <0.05 were considered significant and are designated by * in the figure legends.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Inhibition of TNF-{alpha} has no effect on development of G-EAT but decreases fibrosis and promotes resolution of inflammation
All recipients given anti-TNF-{alpha} developed G-EAT that reached maximal severity 19 days after cell transfer (Fig. 1 ). Rat Ig-treated control recipients always had very severe (4–5+) G-EAT 19 days after cell transfer, and anti-TNF-{alpha} had no significant effect on G-EAT severity at day 19 (P = 0.06). However, anti-TNF-{alpha} significantly reduced G-EAT severity 38–56 days after cell transfer (P<0.05) (Fig. 1) . Thyroids of most rat Ig-treated mice maintained disease severity scores of 5+ 38–56 days after cell transfer, while thyroid lesions of 8 of 15 anti-TNF-{alpha}-treated mice were resolving, with a severity score of 1–3+. Thus, anti-TNF-{alpha} promoted resolution of inflammation in G-EAT.


Figure 1
View larger version (10K):
[in this window]
[in a new window]

  		Figure 1. Effect of anti-TNF-{alpha} on induction and outcome of G-EAT. G-EAT severity scores were evaluated 19 and 38–56 days after cell transfer on a scale from 0 to 5+. Each symbol represents G-EAT severity scores of individual mice. A significant difference in the severity scores of anti-TNF-{alpha} compared with rat Ig-treated mice at day 38–56 is indicated by an asterisk (P<0.05). Results are pooled from three separate experiments.

 
G-EAT lesions were characterized by infiltration of inflammatory cells and destruction of thyroid follicles (Fig. 2A 2B 2C 2D 2E 2F 2G 2H ). There were few or no thyroid follicles at day 19 in thyroids of mice given rat IgG (Fig. 2A) , or anti- TNF-{alpha} with 5+ severity scores (Fig. 2E) , but there were some residual thyroid follicles in thyroids with 4+ severity scores (Fig. 2B and 2F , short arrows). Inflammation persisted in rat-Ig-treated mice, with 5+ severity scores, and thyroids were atrophic (Fig. 2C , arrows) with few or no thyroid follicles. Thyroids of rat-Ig-treated mice with 4 and 5+ severity scores had a few remaining follicles and persistent inflammation at day 40 (Fig. 2D) . At day 40, thyroids of anti-TNF-{alpha}-treated mice with 4-5+ severity scores were less atrophic, and lesions had started to resolve in most mice (Fig. 2G) , while thyroids of anti-TNF-{alpha}-treated mice with 2 and 3+ severity scores were resolving with many thyroid follicles and less inflammation (Fig. 2H) .


Figure 2
View larger version (142K):
[in this window]
[in a new window]

  		Figure 2. Histopathology of G-EAT and fibrosis in thyroids of rat Ig-treated and anti-TNF-{alpha}-treated mice. (A–H) H&E staining of thyroids from rat Ig-treated and anti-TNF-{alpha}-treated mice at day 19 or day 40. G-EAT reached maximal severity in both control (A, B) and anti-TNF-{alpha}-treated (E, F) mice with a score of 5+ (A, E) or 4+ (B, F) severity at day 19. Inflammation was sustained at day 40 with a score of 5+ (C) or 4–5+ severity (D) in rat Ig-treated mice (C, D), and thyroids with 5+ severity scores were atrophic (C). In anti-TNF-{alpha}-treated mice, thyroids with 4 and 5+ severity scores were not atrophic (G), and inflammation was resolving at day 40 in thyroids with 2 and 3+ severity scores (H). (I–P) Trichrome staining for collagen in rat Ig-treated and anti-TNF-{alpha}-treated mice. Collagen was evident in thyroids of rat Ig-treated mice with 5+ (I) or 4+ (J) severity at day 19 (I, J: blue) and was more prominent in thyroids of rat Ig-treated mice with 5+ (K) or 4+ (L) severity at day 40. Collagen was also present in thyroids of anti-TNF-{alpha}-treated mice with 5+ severity scores (M) but was minimal in thyroids with 4+ severity scores (N) at day 19. Fibrosis was minimal in thyroids of anti-TNF-{alpha}-treated mice with 5+ severity scores (O) and was barely discernible in 3+ G-EAT thyroids (P) at day 40. (Q–T) Myofibroblasts were identified by {alpha}-SMA staining in thyroids of both rat Ig-treated and anti-TNF-{alpha}-treated mice at day 19 with 5+ severity scores. There were more myofibroblasts in thyroids of rat Ig-treated mice (Q and R) than in thyroids of anti-TNF-{alpha}-treated mice at day 19 (S and T). Original magnification: A–H: x100; I-T: x400. Photos are representative of 3 experiments for rat Ig-treated and anti-TNF-{alpha}-treated mice.

 
The hallmark of fibrosis is the deposition of collagen and myofibroblasts, which can be detected by Trichrome (Fig. 2I 2J 2K 2L 2M 2N 2O 2P) and {alpha}-smooth muscle actin staining (Fig. 2Q 2R 2S 2T) , respectively. Fibrosis developed at day 19 in thyroids of rat Ig-treated mice with 5+ (Fig. 2I) or 4+ (Fig. 2J) severity scores, as shown by the blue collagen staining. Collagen deposition increased considerably at day 40 in thyroids of rat Ig-treated mice with 5+ (Fig. 2K) or 4+ (Fig. 2L) severity scores. There was less collagen deposition in thyroids of anti-TNF-{alpha}-treated mice at day 19 (Fig. 2M 2N) or day 40 (Fig. 2O 2P) , and little or no collagen was present in thyroids of anti-TNF-{alpha}-treated mice with 3+ severity scores at day 40 (Fig. 2P) . Myofibroblasts represent activated fibroblasts and are prominent inducers of collagen [25 , 26 ]. Infiltration of myofibroblasts was more prominent at day 19 (Fig. 2Q) and day 40 (Fig. 2R) in thyroids of rat Ig-treated mice than in thyroids of anti-TNF-{alpha}-treated mice at day 19 (Fig. 2S) or day 40 (Fig. 2T) . Serum T4 level, which considered normal to be a value >3 µg/dl, is an indicator of thyroid function, and will be decreased during development of fibrosis. All mice with very severe thyroid destruction and fibrosis had 5+ severity scores and had low serum T4 (Fig. 3 ). Serum T4 levels were similar for rat Ig-treated and anti-TNF-{alpha}-treated mice at day 19 (P =0.169) (Fig. 3) . However, at days 38–56, T4 levels for thyroids with 4 and 5+ severity scores were significantly lower in rat Ig-treated mice than in anti-TNF-{alpha}-treated mice (P<0.05) (Fig. 3) . Serum T4 levels in mice with 1–3+ G-EAT severity scores were all normal (Fig. 3) , and serum T4 was normal when lesions resolved in anti-TNF-{alpha}-treated mice.


Figure 3
View larger version (12K):
[in this window]
[in a new window]

  		Figure 3. Serum T4 levels in rat Ig-treated and anti-TNF-{alpha}-treated mice. Serum T4 levels were determined at day 19 or day 38–56 using a T4 enzyme immunoassay kit as described in Methods. Results are expressed as micrograms of T4 per deciliter of serum. *Serum T4 levels that were higher at day 38–56 in anti-TNF-{alpha}-treated compared with rat Ig-treated mice (P<0.05).

 
The reduced thyroid destruction and fibrosis in thyroids of anti-TNF-{alpha}-treated mice is solely due to inhibition of TNF-{alpha} and is not a nonspecific effect of rat IgG, since repeated and prolonged injection of rat IgG or no antibody both resulted in comparable severity of G-EAT at day 19 with atrophy and fibrosis at days 35–60 [7 , 10 , 22 , 23 ].

In conclusion, anti-TNF-{alpha} did not affect incidence, onset, or severity of G-EAT, suggesting that endogenous TNF-{alpha} is not essential for development of G-EAT induced by sensitized cells. However, resolution of G-EAT lesions was promoted, and fibrosis was reduced after TNF-{alpha} neutralization.

Effect of anti-TNF-{alpha} on expression of pro- and anti- inflammatory molecules
To determine whether anti-TNF modulated expression of cytokines in thyroids, expression of TNF-{alpha}, IFN-{gamma}, IL-1ß, iNOS, IL-17, IL4, IL-13, IL-5, and IL-10 were analyzed by RT-PCR. None of the cytokines were detected in normal thyroids, but mRNA was up-regulated in thyroids of rat Ig-treated and anti-TNF-{alpha}-treated mice at day 19 and declined at day 48 (Fig. 4A ). Compared with rat-Ig treated controls, thyroids of anti-TNF-{alpha}-treated mice had significantly lower expression of proinflammatory cytokines such as TNF-{alpha}, IFN-{gamma}, IL-1ß, iNOS, and IL-17 at day 19 (Fig. 4A) . Th2 cytokines IL-4, IL13, IL-5, and IL-10 were also up-regulated in thyroids of both rat Ig-treated and anti-TNF-{alpha}-treated mice at day 19 (Fig. 4B) , and anti-TNF-{alpha} had no effect on expression of IL-4, IL-13, IL-5 or IL-10 at day 19 (Fig. 4B) . These results suggest that IL-4 and IL-13 are not involved in the development of fibrosis in G-EAT, although IL-4 and IL-13 are implicated in development of fibrosis in other models [27 28 29 ]. Expression of all cytokines was very low at day 48 and only TNF-{alpha} was significantly decreased in anti-TNF-{alpha}-treated mice compared with rat Ig-treated mice (Fig. 4) .


Figure 4
View larger version (13K):
[in this window]
[in a new window]

  		Figure 4. Comparison of cytokine expression in rat Ig-treated and anti-TNF-{alpha}-treated mice. mRNA expression levels of TNF-{alpha}, IFN-{gamma}, IL-1ß, iNOS, and IL-17 (A), IL-4, IL13, IL-5 and IL-10 (B) in thyroids of rat Ig-treated and anti-TNF-{alpha}-treated mice 19 or 48 days after cell transfer. Bars represent mean results for thyroids of five individual mice ± SD. Results are expressed as the mean ratio of cytokine densitometric U/HPRT ± SD (x100) and are representative of two independent experiments. (C) Real-time PCR analysis of IFN-{gamma}, MCP-1, IL-17, and IL-10 mRNA expression in thyroids of rat Ig-treated and anti-TNF-{alpha}-treated mice at day 19. The results are the mean ± SD from two independent experiments. Data are presented as relative expression levels normalized against the housekeeping gene HPRT. A significant difference between rat Ig-treated and anti-TNF-{alpha}-treated groups is indicated by *, P < 0.05. N in A and B represents normal thyroids. In A, B, and C, G-EAT severity was 4 and 5+ at day 19 in thyroids of both rat Ig-treated and anti-TNF-{alpha}-treated mice. Thyroids of rat Ig-treated mice had 4 and 5+ severity scores and fibrosis at day 48, while G-EAT was resolving with a score of 0–4+ in thyroids of anti-TNF-{alpha}-treated mice.

 
Real-time quantitative PCR indicated a significant reduction in the expression of mRNA for IFN-{gamma}, MCP-1 and IL-17 in thyroids of anti-TNF-{alpha}-treated mice compared with rat-Ig treated mice (Fig. 4C) . However, anti-TNF-{alpha} had no effect on mRNA for IL-10 (Fig. 4C) .

To determine whether protein expression of proinflammatory and profibrotic cytokines was also reduced in anti-TNF-{alpha}-treated mice, immunostaining was used to examine expression of TNF-{alpha}, IL-17, iNOS, MCP-1, and active TGFß1 in G-EAT thyroids. The results confirmed that the protein expression of TNF-{alpha} (Fig. 5A 5B ), IL-17 (Fig. 5C 5D) , iNOS (Fig. 5E 5F) , and MCP-1 (Fig. 5G 5H) at day 19–21 correlated with expression of their transcripts, being reduced in thyroids of anti-TNF-{alpha}-treated mice (Fig. 5B 5D 5F 5H) compared with rat-Ig treated mice (Fig. 5A 5C 5E 5G) although G-EAT severity (4-5+) at day 19 was comparable in both groups. Active TGFß, which contributes to development of fibrosis, was highly expressed in thyroids of rat Ig-treated mice with 4 and 5+ severity scores at day 19 (Fig. 5I) , whereas active TGFß1 appeared to be reduced in thyroids of anti-TNF-{alpha}-treated mice with 4 and 5+ G-EAT (Fig. 5J) . Confocal analysis showed that IL-17 was expressed by infiltrating CD4+ T cells, and expression of IL-17 by CD4+ T cells was reduced in anti-TNF-{alpha}-treated mice compared with rat-Ig treated mice (data not shown).


Figure 5
View larger version (103K):
[in this window]
[in a new window]

  		Figure 5. Protein expression of TNF-{alpha}, IL-17, iNOS, MCP-1 and TGFß in thyroids of rat Ig-treated and anti-TNF-{alpha}-treated mice. (A–H) Representative areas of photomicrographs demonstrating TNF-{alpha} (A, B: red), IL-17 (C, D: red), iNOS (E, F: brown), MCP-1 (G, H: red), and active TGFß (I, J: brown) at day 19 in thyroids of rat Ig-treated mice (A, C, E, G, I) and anti-TNF-{alpha}-treated mice (B, D, F, H, J). G-EAT severity was 4 and 5+ at day 19 in thyroids of both rat Ig-treated and anti-TNF-{alpha}-treated mice. Thyroids of mice given rat Ig-G had 4 and 5+ severity scores and fibrosis at day 40, but G-EAT lesions were resolving with little fibrosis at day 40 in thyroids of anti-TNF-{alpha}-treated mice. Magnification: A–H: x400.

 
Together, these results indicated that anti-TNF-{alpha} modulated expression of proinflammatory and profibrotic cytokines but had no effect on expression of Th2 cytokines. Reduced protein expression of the profibrotic cytokines MCP-1 and active TGFß in thyroids of anti-TNF-{alpha}-treated mice may contribute to inhibition of fibrosis.

Effect of anti-TNF-{alpha} on apoptosis and expression of anti-apoptotic molecules
TNF-{alpha} is also a major mediator of apoptosis [11 , 12 , 30 ]. To determine whether anti-TNF-{alpha} might regulate expression of apoptosis-related molecules in G-EAT thyroids, different methods were used to examine the effect of anti-TNF-{alpha} on proapoptotic and anti-apoptotic molecules and apoptosis in thyroids. TUNEL staining showed apoptotic cells in thyroids of both rat Ig-treated (Fig. 6A ) and anti-TNF-{alpha}-treated mice (Fig. 6B) . Apoptotic cells were predominant in thyroid follicular cells in thyroids of rat Ig-treated mice (Fig. 6A , arrows) but predominant in inflammatory cells in thyroids of anti-TNF-{alpha}-treated mice (Fig. 6B , arrows). TNF-{alpha} signaling triggers apoptosis through cleavage of caspase-3, and results in production of active caspase-3, which represents cells undergoing apoptosis [31 ]. Using a monoclonal antibody that recognizes the active form of caspase-3, we found that expression of active caspase-3 was predominant in thyroid follicular cells in rat Ig-treated mice (Fig. 6C , arrows), but was predominant in inflammatory cells in anti-TNF-{alpha}-treated mice (Fig. 6D , arrow). Confocal analysis confirmed that there were many apoptotic thyrocytes in rat Ig-treated mice (Fig. 6E) , while there were fewer apoptotic thyrocytes in anti-TNF-{alpha}-treated mice (Fig. 6F) . These results suggest TNF-{alpha} may contribute to apoptotic destruction of thyrocytes.


Figure 6
View larger version (94K):
[in this window]
[in a new window]

  		Figure 6. Expression of apoptotic and antiapoptotic molecules in thyroids of mice given rat IgG and anti-TNF-{alpha} 19 days after cell transfer. (A, B) TUNEL staining (brown) in thyroids of rat Ig-treated (A) and anti-TNF-{alpha} treated mice (B). (C, D) Expression of active caspase-3 (reddish brown) in thyroids of rat Ig-treated (C) and anti-TNF-{alpha}-treated mice (D). (E, F) Confocal analysis demonstrates apoptosis of cytokeratin+ thyrocytes in thyroids of mice given rat Ig-G (E) and anti-TNF-{alpha} (F). Thyrocytes were identified by cytokeratin (green, cytoplasmic staining in E and F), and apoptosis (red, nuclear staining in E, F) was detected using an in situ cell death kit. (G, H) Expression of FLIP (red) in thyroids of rat Ig-treated (G) and anti-TNF-{alpha}-treated mice (H). All thyroids had 4–5+ severity scores. Original magnification: A, B: x1000; C, D, G and H: x400; E and F, x600.

 
FLIP is an important antiapoptotic molecule in TNF-{alpha} and Fas signaling pathways [12 , 31 ] and has been implicated in resolution of G-EAT [10 ]. Expression of FLIP was predominant on infiltrating inflammatory cells in thyroids of rat Ig-treated mice (Fig. 6G) and predominant on thyroid follicular cells in thyroids of anti-TNF-{alpha}-treated mice (Fig. 6H) . The expression pattern of FLIP in thyroids of anti-TNF-{alpha}-treated mice was similar to that in thyroids of IFN-{gamma}–/– mice, in which G-EAT lesions spontaneously resolved [10 ], suggesting FLIP may be an important molecule protecting against apoptotic destruction of thyroids in G-EAT.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The G-EAT model established in our laboratory is an excellent model for studying mechanisms that determine whether an autoimmune response will resolve or progress to fibrosis. G-EAT lesions reach maximal severity 19–21 days after cell transfer, and inflammation continues with development of fibrosis in DBA/1 mice (Figs. 1 and 2) . This study was undertaken in order to understand the role of TNF-{alpha} in development of thyroid inflammation and fibrosis. Our results indicate that TNF-{alpha} is not essential for the development of G-EAT, but sustained expression of TNF-{alpha} is important for maintenance of inflammation and for promoting fibrosis. Furthermore, neutralization of TNF-{alpha} contributes to resolution of inflammation and inhibits fibrosis.

TNF-{alpha} is not essential for development of G-EAT induced by sensitized cells since anti-TNF-{alpha} did not reduce disease severity at day 19. Anti-TNF-{alpha} also did not reduce disease severity in collagen-induced arthritis or experimental autoimmune encephalomyelitis [11 , 32 , 33 ], and TNF-{alpha}-deficient mice develop arthritis [14 , 34 ]. Our results, together with these data, are consistent with the notion that TNF-{alpha} is generally not critical for the induction of organ-specific autoimmune disease [14 , 35 ]. By using knockout of different cytokines on the DBA/1 background, e.g., IFN-{gamma}–/–, IL-12–/–, and IL-4–/– mice, we found that these individual cytokines were also not required for induction of severe G-EAT [6 , 10 , 36 ]. Our results also suggest that it is not an individual cytokine but the combined effects of several proinflammatory cytokines that contribute to the pathogenesis of G-EAT. TNF-{alpha} may act together with other proinflammatory cytokines to induce thyroid destruction.

However, TNF-{alpha} contributes to the maintenance of inflammation in G-EAT as thyroid lesions were resolved earlier in mice given anti-TNF-{alpha}. One mechanism by which anti-TNF-{alpha} promotes G-EAT resolution may due to its ability to modulate production of other cytokines. TNF-{alpha} plays a key role in the inflammatory process by inducing transcription of several proinflammatory cytokines [11 ]. Many proinflammatory cytokines such as TNF-{alpha}, IL-1ß, IFN-{gamma}, iNOS, and IL-17 are expressed in thyroids of mice with G-EAT. Inhibition of TNF-{alpha} reduced expression of proinflammatory cytokines at day 19 in the thyroid and had no significant effect on expression of Th2 cytokines, such as IL-4, IL-13, and IL-10. Thyroids with 4 and 5+ G-EAT severity scores at day 35–60 are very small and atrophic and those in which inflammation has largely resolved have very few inflammatory cells remaining. Therefore, expression of cytokines is very low in both of these groups of thyroids regardless of G-EAT severity. The fact that TNF-{alpha}, IL-1ß, IFN-{gamma}, iNOS, and IL-17 were more highly expressed at day 19 in thyroids of rat Ig-treated mice compared with anti-TNF-{alpha}-treated mice, suggests that TNF-{alpha} has a proinflammatory role in thyroiditis [5 , 37 ]. TNF-{alpha} may up-regulate production of IL-1ß, IFN-{gamma}, IL-17, and iNOS, which coordinate with TNF-{alpha} to maintain autoimmune inflammation in G-EAT. IL-17 contributes to the pathogenesis of many autoimmune and inflammatory diseases by acting as a proinflammatory mediator [38 39 40 41 42 ]. The decreased expression of IL-17 in thyroids of anti-TNF-{alpha}-treated mice suggested that TNF-{alpha} may act directly or indirectly to modulate expression of IL-17. Proinflammatory cytokines, including TNF-{alpha} and iNOS, were also reduced in thyroids of IFN-{gamma}–/– mice, in which G-EAT lesions spontaneously resolved [10 ], suggesting that these cytokines may mutually stimulate each other’s production, further amplify inflammation, and contribute to sustained inflammation in G-EAT. Our study suggests that a complex interplay among cytokines produced by activated CD4+ T cells is likely to control the outcome of an autoimmune disease.

TNF-{alpha}, IFN-{gamma}, and IL-1ß can all affect apoptosis [11 , 12 , 31 , 37 , 43 44 45 ]. Therefore, through modulation of proinflammatory cytokines, TNF-{alpha} may modulate the apoptosis of different cell types. Apoptosis of inflammatory cells was increased, whereas apoptotic thyrocytes were decreased in anti-TNF-{alpha}-treated mice (Fig. 6B 6D 6F) . Indeed, anti-TNF-{alpha} treatment induced apoptosis of inflammatory cells in patients with arthritis and in animal models of Crohn's disease [30 , 46 ]. FasL expression by thyrocytes and CD8+ T cells play an important role in mediating the killing of Fas+ inflammatory cells, contributing to G-EAT resolution [47 , 48 ]. TNF-{alpha} and other proinflammatory cytokines IFN-{gamma}, IL-1ß, and iNOS could induce apoptosis in tissues cells, such as pancreatic islet cells and thyrocytes [10 , 37 , 44 , 45 , 49 ]. The current study supports a role for TNF-{alpha}, IFN-{gamma}, IL-1ß, and iNOS in autoimmune thyroiditis both for perpetuation of the autoimmune disease and the induction of tissue damage via apoptosis of thyrocytes [10 , 37 , 44 ]. Expression of FLIP was shown to protect cells against TNF-{alpha}- and/or Fas- induced apoptosis [31 , 48 , 50 ]. High expression of FLIP by thyrocytes of anti-TNF-{alpha}-treated mice correlated with reduced apoptosis of thyrocytes (Fig. 6H) and may protect thyrocytes in anti-TNF-{alpha}-treated mice from apoptosis.

The results of this study also support a role for TNF-{alpha} in development of fibrosis [16 17 18 , 51 52 53 54 55 56 ]. The fact that profibrotic cytokines were reduced in thyroids of anti-TNF-{alpha}-treated mice suggests that TNF-{alpha} contributes to the development of fibrosis. Thyroids from rat IgG-treated control mice highly expressed TNF-{alpha}, myofibroblasts, and collagen. Our finding is consistent with other observations, indicating that increased levels of TNF-{alpha} correlate with increased collagen deposition and development of fibrosis in other animal models and also in humans [16 17 18 , 51 52 53 54 55 56 ]. Thyroids of rat Ig-treated mice had extensive inflammation, and serum T4 levels began to decrease at day 19 and further decreased by days 38–56 as a result of thyroid fibrosis. In contrast, G-EAT lesions began to resolve by days 38–56 in anti-TNF-{alpha}-treated mice, fibrosis was reduced, and serum T4 levels were normal in anti-TNF-{alpha}-treated mice when lesions resolved. In the present study, reduced fibrosis in thyroids of mice given anti-TNF-{alpha} correlated with reduced expression of active TGFß and MCP-1 and decreased infiltration of myfbs in thyroids. Anti-TNF-{alpha} also markedly suppressed bleomycin-induced lung fibrosis [18 , 54 ] and decreased expression of TGFß and MCP-1 in the lung [18 ]. Anti-TNF-{alpha} may inhibit thyroid fibrosis through down-regulation of profibrotic cytokines such as TGFß and MCP-1 [22 , 57 ]. Consistent with the results presented here, TNF-{alpha} has been shown to be profibrotic in several other different animal models and in human fibrotic disorders [16 17 18 , 51 52 53 54 55 56 ], but TNF-{alpha} was also shown to inhibit fibrosis in some studies [19 , 58 ]. The effect of TNF-{alpha} can differ depending on many factors, e.g., whether TNF-{alpha} is constitutively expressed or temporally blocked and what kind of cells expressed TNF-{alpha} [11 , 14 , 15 , 56 , 58 ]. Fibrosis is a common response to injury and can be the outcome of perturbation in the function of any tissue. Fibrosis occurs as a result of autoimmune inflammation in systemic sclerosis and idiopathic pulmonary fibrosis. However, fibrotic diseases respond poorly to currently available therapy. Our results suggest that inhibition of TNF-{alpha} could provide an alternative therapeutic intervention for fibrosis due to autoimmune inflammation.

In conclusion, unregulated TNF-{alpha} production characterizes many autoimmune diseases. Our results showed that although development of G-EAT was not suppressed by blocking TNF-{alpha}, blocking TNF-{alpha} led to beneficial outcomes in G-EAT with earlier resolution of inflammation and inhibition of fibrosis. Expression of IFN-{gamma}, IL-1ß, IL-17, and iNOS was also decreased, suggesting that blocking TNF-{alpha} decreased production of proinflammatory cytokines, but had no effect on Th2 cytokines. TNF-{alpha} could also contribute to destruction of thyroids through its effect on apoptosis or through regulation of expression of proapoptotic and/or anti-apoptotic molecules. Our study supports a proinflammatory and/or disease-promoting role for TNF-{alpha} in G-EAT and indicates an important role for TNF-{alpha} in the pathogenesis of G-EAT and development of fibrosis that develops after sustained autoimmune inflammation.


   ACKNOWLEDGEMENTS
 
This work was supported by NIH Grant DK35527 and by the Arthritis National Research Foundation. We thank Patti Mierzwa for excellent technical assistance. We also thank Dr. Charles Brown for real-time PCR primers for MCP-1.


   FOOTNOTES
 
1 These authors contributed equally to this work. Back

Received June 16, 2006; revised September 1, 2006; accepted September 15, 2006.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Rose, N. R., Kong, Y. C., Okayasu, I., Giraldo, A. A., Beisel, K., Sundick, R. S. (1981) T-cell regulation in autoimmune thyroiditis Immunol. Rev. 55,299-314[CrossRef][Medline]
  2. Charreire, J. (1989) Immune mechanisms in autoimmune thyroiditis Adv. Immunol. 46,263-334[Medline]
  3. Kong, Y., Audibert, C. F., Giraldo, A. A., Rose, N. R., Chedid, L. (1985) Effects of natural or synthetic microbial adjuvants on induction of autoimmune thyroiditis Infect. Immun. 49,40-45[Abstract/Free Full Text]
  4. Lira, S. A., Martin, A. P., Marinkovic, T., Furtado, G. C. (2005) Mechanisms regulating lymphocytic infiltration of the thyroid in murine models of thyroiditis Crit. Rev. Immunol. 25,251-262[CrossRef][Medline]
  5. Zaccone, P., Fehervari, Z., Cooke, A. (2003) Tumour necrosis factor-alpha is a fundamental cytokine in autoimmune thyroid disease induced by thyroglobulin and lipopolysaccharide in interleukin-12 p40 deficient C57BL/6 mice Immunology 108,50-54[CrossRef][Medline]
  6. Braley-Mullen, H., Johnson, M., Sharp, G. C., Kyriakos, M. (1985) Induction of experimental autoimmune thyroiditis in mice with in vitro activated splenic T cells Cell. Immunol. 93,132-143[CrossRef][Medline]
  7. Braley-Mullen, H., Sharp, G. C., Tang, H., Chen, K., Kyriakos, M., Bickel, J. T. (1998) Interleukin-12 promotes activation of effector cells that induce a severe destructive granulomatous form of murine experimental autoimmune thyroiditis Am. J. Pathol. 152,1347-1358[Abstract]
  8. Braley-Mullen, H., Sharp, G. C. (2000) Adoptive transfer murine model of granulomatous experimental autoimmune thyroiditis Int. Rev. Immunol. 19,535-555[Medline]
  9. Braley-Mullen, H., McMurray, R. W., Sharp, G. C., Kyriakos, M. (1994) Regulation of the induction and resolution of granulomatous experimental autoimmune thyroiditis in mice by CD8+ T cells Cell. Immunol. 153,492-504[CrossRef][Medline]
  10. Chen, K., Wei, Y., Sharp, G. C., Braley-Mullen, H. (2003) Mechanisms of spontaneous resolution versus fibrosis in granulomatous experimental autoimmune thyroiditis J. Immunol. 171,6236-6243[Abstract/Free Full Text]
  11. Aggarwal, B. B. (2003) Signalling pathways of the TNF superfamily: a double-edged sword Nat. Rev. Immunol. 3,745-756[CrossRef][Medline]
  12. Muppidi, J. R., Tschopp, J., Siegel, R. M. (2004) Life and death decisions: secondary complexes and lipid rafts in TNF receptor family signal transduction Immunity 21,461-465[CrossRef][Medline]
  13. Yang, X. D., Tisch, R. S., Singer, M., Cao, Z. A., Liblau, R. S., Schreiber, R. D., McDevitt, H. O. (1994) Effect of tumor necrosis factor alpha on insulin-dependent diabetes mellitus in NOD mice. I. The early development of autoimmunity and the diabetogenic process J. Exp. Med. 180,995-1004[Abstract/Free Full Text]
  14. Kassiotis, G., Kollias, G. (2001) TNF and receptors in organ-specific autoimmune disease: multi-layered functioning mirrored in animal models J. Clin. Invest. 107,1507-1508[Medline]
  15. Green, E. A., Flavell, R. A. (2000) The temporal importance of TNF{alpha} expression in the development of diabetes Immunity 12,459-469[CrossRef][Medline]
  16. Booth, M., Mwatha, J. K., Joseph, S., Jones, F. M., Kadzo, H., Ireri, E., Kazibwe, F., Kemijumbi, J., Kariuki, C., Kimani, G., et al (2004) Periportal fibrosis in human Schistosoma mansoni infection is associated with low IL-10, low IFN-gamma, high TNF-alpha, or low RANTES, depending on age and gender J. Immunol. 172,1295-1303[Abstract/Free Full Text]
  17. Chou, D. H., Lee, W., McCulloch, C. A. (1996) TNF-alpha inactivation of collagen receptors: implications for fibroblast function and fibrosis J. Immunol. 156,4354-4362[Abstract]
  18. Zhang, K., Gharaee-Kermani, B., McGarry, M., Remick, D., Phan, S. H. (1997) TNF-alpha-mediated lung cytokine networking and eosinophil recruitment in pulmonary fibrosis J. Immunol. 158,954-959[Abstract]
  19. Fujita, M., Shannon, J. M., Morikawa, O., Gauldie, J., Hara, N., Mason, R. J. (2003) Overexpression of tumor necrosis factor-{alpha} diminishes pulmonary fibrosis induced by bleomycin or transforming growth factor-ß Am. J. Respir. Cell Mol. Biol. 29,669-676[Abstract/Free Full Text]
  20. Marinova-Mutafchieva, L., Williams, R. O., Funa, K., Maini, R. N., Zvaifler, N. J. (2002) Inflammation is preceded by tumor necrosis factor-dependent infiltration of mesenchymal cells in experimental arthritis Arthritis Rheum. 46,507-513[CrossRef][Medline]
  21. Butler, D. M., Malfait, A. M., Maini, R. N., Brennan, F. M., Feldmann, M. (1999) Anti-IL-12 and anti-TNF antibodies synergistically suppress the progression of murine collagen-induced arthritis Eur. J. Immunol. 29,2205-2212[CrossRef][Medline]
  22. Chen, K., Wei, Y., Sharp, G. C., Braley-Mullen, H. (2002) Inhibition of TGFß1 by anti-TGFß1 antibody or lisinopril reduces thyroid fibrosis in granulomatous experimental autoimmune thyroiditis J. Immunol. 169,6530-6538[Abstract/Free Full Text]
  23. Chen, K., Wei, Y., Sharp, G. C., Braley-Mullen, H. (2005) Balance of proliferation and cell death between thyrocytes and myofibroblasts regulates thyroid fibrosis in granulomatous experimental autoimmune thyroiditis (G-EAT) J. Leukoc. Biol. 77,166-172[Abstract/Free Full Text]
  24. Tang, H., Sharp, G. C., Chen, K., Braley-Mullen, H. (1998) The kinetics of cytokine gene expression in the thyroids of mice developing granulomatous experimental autoimmune thyroiditis J. Autoimmun. 11,581-589[CrossRef][Medline]
  25. Zhang, K., Rekhter, M. D., Gordon, D., Phan, S. H. (1994) Myofibroblasts and their role in lung collagen gene expression during pulmonary fibrosis. A combined immunohistochemical and in situ hybridization study Am. J. Pathol. 145,114-125[Abstract]
  26. Phan, S. H. (2002) The myofibroblast in pulmonary fibrosis Chest 122,286S-289S
  27. Liu, T., Jin, H., Ullenbruch, M., Hu, B., Hashimoto, N., Moore, B., McKenzie, A., Lukacs, N. W., Phan, S. H. (2004) Regulation of found in inflammatory zone 1 expression in bleomycin-induced lung fibrosis: role of IL-4/IL-13 and mediation via STAT-6 J. Immunol. 173,3425-3431[Abstract/Free Full Text]
  28. Sempowski, G. D., Beckmann, M. P., Derdak, S., Phipps, R. P. (1994) Subsets of murine lung fibroblasts express membrane-bound and soluble IL-4 receptors. Role of IL-4 in enhancing fibroblast proliferation and collagen synthesis J. Immunol. 152,3606-3614[Abstract]
  29. Zhu, Z., Homer, R. J., Wang, Z., Chen, Q., Geba, G. P., Wang, J., Zhang, Y., Elias, J. A. (1999) Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and eotaxin production J. Clin. Invest. 103,779-788[Medline]
  30. Catrina, A. I., Trollmo, C., af, K. E., Engstrom, M., Lampa, J., Hermansson, Y., Klareskog, L., Ulfgren, A. K. (2005) Evidence that anti-tumor necrosis factor therapy with both etanercept and infliximab induces apoptosis in macrophages, but not lymphocytes, in rheumatoid arthritis joints: extended report Arthritis Rheum. 52,61-72[CrossRef][Medline]
  31. Thome, M., Tschopp, J. (2001) Regulation of lymphocyte proliferation and death by FLIP Nat. Rev. Immunol. 1,50-58[CrossRef][Medline]
  32. Suryaprasad, A. G., Prindiville, T. (2003) The biology of TNF blockade Autoimmun. Rev. 2,346-357[CrossRef][Medline]
  33. Liu, J., Marino, M., Wong, W. G., Grail, D., Dunn, A., Bettadapura, J., Slavin, A. J., Old, L., Bernard, C. C. (1998) TNF is a potent anti-inflammatory cytokine in autoimmune-mediated demyelination Nat. Med. 4,78-83[CrossRef][Medline]
  34. Campbell, I. K., O'Donnell, K., Lawlor, K. E., Wicks, I. P. (2001) Severe inflammatory arthritis and lymphadenopathy in the absence of TNF J. Clin. Invest. 107,1519-1527[Medline]
  35. Cantor, J., Haskins, K. (2005) Effector function of diabetogenic CD4 Th1 T cell clones: A central role for TNF-{alpha} J. Immunol. 175,7738-7745[Abstract/Free Full Text]
  36. Tang, H., Sharp, G. C., Peterson, K. E., Braley-Mullen, H. (1998) Induction of granulomatous experimental autoimmune thyroiditis in IL-4 gene-disrupted mice J. Immunol. 160,155-162[Abstract/Free Full Text]
  37. Wang, S. H., Bretz, J. D., Phelps, E., Mezosi, E., Arscott, P. L., Utsugi, S., Baker, J. R., Jr (2002) A unique combination of inflammatory cytokines enhances apoptosis of thyroid follicular cells and transforms nondestructive to destructive thyroiditis in experimental autoimmune thyroiditis J. Immunol. 168,2470-2474[Abstract/Free Full Text]
  38. Park, H., Li, Z., Yang, X. O., Chang, S. H., Nurieva, R., Wang, Y. H., Wang, Y., Hood, L., Zhu, Z., Tian, Q., et al (2005) A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17 Nat. Immunol. 6,1133-1141[CrossRef][Medline]
  39. Wynn, T. A. (2005) T(H)-17: a giant step from T(H)1 and T(H)2 Nat. Immunol. 6,1069-1070[CrossRef][Medline]
  40. Veldhoen, M., Hocking, R. J., Atkins, C. J., Locksley, R. M., Stockinger, B. (2006) TGFß in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells Immunity 24,179-189[CrossRef][Medline]
  41. Stark, M. A., Huo, Y., Burcin, T. L., Morris, M. A., Olson, T. S., Ley, K. (2005) Phagocytosis of apoptotic neutrophils regulates granulopoiesis via IL-23 and IL-17 Immunity 22,285-294[CrossRef][Medline]
  42. Nakae, S., Komiyama, Y., Nambu, A., Sudo, K., Iwase, M., Homma, I., Sekikawa, K., Asano, M., Iwakura, Y. (2002) Antigen-specific T cell sensitization is impaired in IL-17-deficient mice, causing suppression of allergic cellular and humoral responses Immunity 17,375-387[CrossRef][Medline]
  43. McLoughlin, R. M., Witowski, J., Robson, R. L., Wilkinson, T. S., Hurst, S. M., Williams, A. S., Williams, J. D., Rose-John, S., Jones, S. A., Topley, N. (2003) Interplay between IFN-{gamma} and IL-6 signaling governs neutrophil trafficking and apoptosis during acute inflammation J. Clin. Invest. 112,598-607[CrossRef][Medline]
  44. Bretz, J. D., Mezosi, E., Giordano, T. J., Gauger, P. G., Thompson, N. W., Baker, J. R., Jr (2002) Inflammatory cytokine regulation of TRAIL-mediated apoptosis in thyroid epithelial cells Cell Death Differ 9,274-286[CrossRef][Medline]
  45. Taverne, J., Rayner, D. C., Van der Meide, P. H., Lydyard, P. M., Bidey, S. P., Cooke, A. (1987) Cytotoxicity of tumor necrosis factor for thyroid epithelial cells and its regulation by interferon-gamma Eur. J. Immunol. 17,1855-1858[Medline]
  46. Van Den Brande, J. M., Peppelenbosch, M. P., Van Deventer, S. J. (2002) Treating Crohn's disease by inducing T lymphocyte apoptosis Ann. N.Y. Acad. Sci. 973,166-180[Abstract/Free Full Text]
  47. Wei, Y., Chen, K., Sharp, G. C., Yagita, H., Braley-Mullen, H. (2001) Expression and regulation of Fas and Fas ligand on thyrocytes and infiltrating cells during induction and resolution of granulomatous experimental autoimmune thyroiditis J. Immunol. 167,6678-6686[Abstract/Free Full Text]
  48. Wei, Y., Chen, K., Sharp, G. C., Braley-Mullen, H. (2004) Fas ligand is required for resolution of granulomatous experimental autoimmune thyroiditis J. Immunol. 173,7615-7621[Abstract/Free Full Text]
  49. Suk, K., Kim, S., Kim, Y. H., Kim, K. A., Chang, I., Yagita, H., Shong, M., Lee, M. S. (2001) IFN-{gamma}/TNF-{alpha} synergism as the final effector in autoimmune diabetes: A key role for STAT1/IFN regulatory factor-1 pathway in pancreatic ß cell death J. Immunol. 166,4481-4489[Abstract/Free Full Text]
  50. Guiet, C., Silvestri, E., De, S. E., Franzoso, G., Vito, P. (2002) c-FLIP efficiently rescues TRAF-2–/– cells from TNF-induced apoptosis Cell Death Differ 9,138-144[CrossRef][Medline]
  51. Miyazaki, Y., Araki, K., Vesin, C., Garcia, I., Kapanci, Y., Whitsett, J. A., Piguet, P. F., Vassalli, P. (1995) Expression of a tumor necrosis factor-alpha transgene in murine lung causes lymphocytic and fibrosing alveolitis. A mouse model of progressive pulmonary fibrosis J. Clin. Invest. 96,250-259[Medline]
  52. Hasegawa, M., Fujimoto, M., Kikuchi, K., Takehara, K. (1997) Elevated serum tumor necrosis factor-alpha levels in patients with systemic sclerosis: association with pulmonary fibrosis J. Rheumatol. 24,663-665[Medline]
  53. Peng, J., Gurantz, D., Tran, V., Cowling, R. T., Greenberg, B. H. (2002) Tumor necrosis factor-alpha-induced AT1 receptor upregulation enhances angiotensin II-mediated cardiac fibroblast responses that favor fibrosis Circ. Res. 91,1119-1126[Abstract/Free Full Text]
  54. Piguet, P. F., Collart, M. A., Grau, G. E., Kapanci, Y., Vassalli, P. (1989) Tumor necrosis factor/cachectin plays a key role in bleomycin-induced pneumopathy and fibrosis J. Exp. Med. 170,655-663[Abstract/Free Full Text]
  55. Vassallo, R., Matteson, E., Thomas, C. F., Jr (2002) Clinical response of rheumatoid arthritis-associated pulmonary fibrosis to tumor necrosis factor-alpha inhibition Chest 122,1093-1096
  56. Lundblad, L. K., Thompson-Figueroa, J., Leclair, T., Sullivan, M. J., Poynter, M. E., Irvin, C. G. (2005) Tumor necrosis factor-alpha overexpression in lung disease: a single cause behind a complex phenotype Am. J. Respir. Crit. Care Med. 171,1363-1370[Abstract/Free Full Text]
  57. Lloyd, C. M., Minto, A. W., Dorf, M. E., Proudfoot, A., Wells, T. N., Salant, D. J., Gutierrez-Ramos, J. C. (1997) RANTES and monocyte chemoattractant protein-1 (MCP-1) play an important role in the inflammatory phase of crescentic nephritis, but only MCP-1 is involved in crescent formation and interstitial fibrosis J. Exp. Med. 185,1371-1380[Abstract/Free Full Text]
  58. Saika, S., Ikeda, K., Yamanaka, O., Flanders, K. C., Okada, Y., Miyamoto, T., Kitano, A., Ooshima, A., Nakajima, Y., Ohnishi, Y., et al (2006) Loss of tumor necrosis factor alpha potentiates transforming growth factor beta-mediated pathogenic tissue response during wound healing Am. J. Pathol. 168,1848-1860[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Pathol.Home page
Y. Fang, G. C. Sharp, and H. Braley-Mullen
Interleukin-10 Promotes Resolution of Granulomatous Experimental Autoimmune Thyroiditis
Am. J. Pathol., June 1, 2008; 172(6): 1591 - 1602.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
Y. Fang, Y. Wei, V. DeMarco, K. Chen, G. C. Sharp, and H. Braley-Mullen
Murine FLIP Transgene Expressed on Thyroid Epithelial Cells Promotes Resolution of Granulomatous Experimental Autoimmune Thyroiditis in DBA/1 Mice
Am. J. Pathol., March 1, 2007; 170(3): 875 - 887.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0606402v1
81/1/306    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow