Published online before print October 17, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
results in less fibrosis and earlier resolution of granulomatous experimental autoimmune thyroiditis

,
* Departments of Internal Medicine,
Pathology, and
Molecular Microbiology and Immunology, University of Missouri School of Medicine, Columbia, Missouri, USA; and
VA Research Service, Columbia, Missouri, USA
2Correspondence: Division of Immunology and Rheumatology, Dept. of Medicine, University of Missouri, M306 Medical Sciences, One Hospital Dr., Columbia, MO 65212, USA. E-mail: chenk{at}health.missouri.edu
|
|
|---|
is an important proinflammatory cytokine and apoptotic molecule involved in many autoimmune diseases. To study its role in G-EAT, anti-TNF-
mAb was given to recipient mice. Disease severity was comparable between mice with or without anti-TNF-
treatment at days 1921, the time of maximal severity of G-EAT, suggesting TNF-
is not essential for development of thyroid inflammation. However, thyroid lesions resolved at day 48 in anti-TNF-
-treated mice, while thyroids of rat Ig-treated controls had fibrosis. These results suggested that reducing TNF-
contributed to resolution of inflammation and inhibited fibrosis. Gene and protein expression of inflammatory molecules was examined by RT-PCR and immunostaining, and apoptosis was detected using TUNEL staining and an apoptosis kit. Thyroids of anti-TNF-
-treated controls had reduced proinflammatory and profibrotic molecules, e.g., IFN-
, IL-1ß, IL-17, inducible NOS and MCP-1, at day 19 compared with thyroids of rat Ig-treated mice. There were more apoptotic thyrocytes in rat Ig-treated controls than in anti-TNF-
-treated mice. The site of expression of the anti-apoptotic molecule FLIP also differed between rat Ig-treated and anti-TNF-
-treated mice. FLIP was predominantly expressed by inflammatory cells of rat Ig-treated mice and by thyrocytes of anti-TNF-
-treated mice. These results suggest that anti-TNF-
may regulate expression of proinflammatory cytokines and apoptosis in thyroids, resulting in less inflammation, earlier resolution, and reduced fibrosis.
Key Words: rodent autoimmunity cytokines
|
|
|---|
and other proinflammatory cytokines are up-regulated in thyroids of mice with G-EAT [10
]. Moreover, early resolution of G-EAT was observed in IFN-
/ recipients, and reduction of several cytokines, including TNF-
may contribute to G-EAT resolution in IFN-
/ mice [10
].
TNF-
is a proinflammatory cytokine that plays a critical role in diverse cellular events. The binding of TNF-
to TNF-
receptors triggers a series of intracellular events that ultimately result in production of inflammatory cytokines via NF-kB activation or apoptosis [11
, 12
]. Thus, TNF-
is a major mediator of apoptosis as well as inflammation and immunity. TNF-
is expressed in virtually all inflammatory autoimmune diseases and has been implicated in the pathogenesis of a wide spectrum of human autoimmune diseases, including rheumatoid arthritis, diabetes, multiple sclerosis, and inflammatory bowel disease [11
12
13
14
15
]. However, the pathophysiological effects of TNF-
in autoimmune diseases are still incompletely understood, and research with other animal models may further clarify its functions [14
]. TNF-
is also a profibrotic cytokine, but its role in fibrosis and its mechanism of action are not well defined [16
17
18
19
].
This study was undertaken to define the role of TNF-
in autoimmune thyroiditis and to determine whether anti-TNF-
antibodies might be useful for decreasing autoimmune inflammation and fibrosis. TNF-
neutralization significantly promoted resolution of inflammation and reduced development of fibrosis in G-EAT. By detecting expression of proinflammatory cytokines, fibrotic and apoptotic molecules, the mechanisms by which TNF-
contributes to G-EAT pathology, were determined.
|
|
|---|
Induction of G-EAT
G-EAT was induced as described previously [4
]. Briefly, mice were injected intravenously (i.v.) twice at 10-day intervals with 150 µg MTg prepared as previous described [6
] and 15 µg LPS (Escherichia coli 011:B4; Sigma Chemical, St. Louis, MO). Seven days later, donor spleen cells were restimulated in vitro with 25 µg/ml MTg and 5 ng/ml IL-12 [1
, 4
]. Cells were harvested after 72 h, washed twice, and 3.5 x 107 cells were transferred i.v. to 500-Rad irradiated syngeneic recipients. Recipient thyroids were removed at days 1921 (peak of disease) or 3856 days (resolution) after cell transfer [6
7
8
].
Anti-TNF-
treatment
Rat anti-mouse TNF-
(ATCC HB-10649) mAb was purified from culture supernatant using protein G-sepharose. Recipient mice were given 0.3 mg rat anti-mouse TNF-
mAb or normal rat IgG (Jackson Immunoresearch Laboratories, West Grove, PA) 12 days after cell transfer and every 34 days until termination of the experiment. The dosage of anti-TNF-
mAb was chosen based on use of anti-TNF-
mAb in other models [20
, 21
].
Evaluation of thyroiditis
Thyroids were collected, fixed in formalin, sectioned, and stained with hematoxylin and eosin (H and E), as described previously [4
]. Thyroids were scored quantitatively for EAT severity (the extent of thyroid follicle destruction) using a scale of 1+ to 5+, as described previously [6
7
8
]. 1+ thyroiditis is defined as an infiltrate of at least 125 cells in one or several foci; 2+ is 1020 foci of cellular infiltration involving up to 25% of the gland; 3+ indicates that 2550% of the gland is infiltrated; 4+ indicates that >50% of the gland is destroyed by infiltrating inflammatory cells; and 5+ indicates virtually complete destruction of the thyroid with few or no remaining follicles. Thyroid lesions were also evaluated qualitatively. Thyroid lesions designated as granulomatous had enlargement and proliferation of thyroid follicular cells, with numerous histiocytes, multinucleated giant cells, and increased numbers of neutrophils in addition to the mononuclear cell infiltration. The more severely inflamed granulomatous thyroids (45+ severity scores) also had microabscess formation, necrosis, and focal fibrosis, and inflammation extended beyond the thyroid to involve adjacent muscle and connective tissue [7
]. For evaluation of collagen deposition, some thyroid sections were stained using Massons Trichrome.
Serum thyroxine assay
Serum thyroxine (T4) levels were determined using a T4 enzyme immunoassay kit (Biotecx Labs, Houston, TX), according to the manufacturers instructions. Results are expressed as micrograms of T4 per deciliters of serum. Using this kit, we considered values >3 µg T4/dl of serum to be normal [22
].
Immunohistochemistry and confocal analysis
Myofibroblasts, important cells involved in development of fibrosis, were recognized by staining using a mouse anti-
-smooth muscle actin (
SMA) (clone 1A4, Sigma) on paraffin sections of thyroids. Staining of TNF-
, active TGFß, inducible NOS (iNOS), MCP-1, FLIP, and caspase-3 was performed using the immunoperoxidase method, as described previously [10
, 22
, 23
]. For IL-17 staining, rabbit anti-IL-17 [H-132; Santa Cruz Biotechnology, Santa Cruz, CA) was used. Following incubation with a secondary biotinylated goat anti-rabbit antibody (1:500) (Jackson ImmunoResearch Laboratories), immunoreactivity was demonstrated using the avidin-biotin complex immunoperoxidase system (Vector ABC peroxidase kit; Vector Laboratories, Burlingame, CA) with 3,3-diaminobenzidine tetrahydrochloride (DAB), Vector VIP (Vector Laboratories) or Vector NovaRED (Vector Laboratories) as the chromogen. Slides were counterstained with hematoxylin. Negative controls used nonimmune rat, rabbit, or goat Ig at a protein concentration equivalent to the respective primary antibodies. These controls were always negative.
Dual staining and confocal microscopy were used to detect apoptotic thyrocytes. Thyrocytes were identified by cytokeratin staining, and apoptosis was detected using an in situ cell death kit [23 ]. To more specifically detect apoptosis of thyrocytes, dual immunofluorescence and confocal laser scanning microscopy were done. Before staining, tissue sections were pretreated by microwave irradiation for antigen retrieval [23 ], and thyroid follicular cells were detected by pan-cytokeratin staining using FITC-labeled PCK-26 (Sigma). Apoptosis was detected using an in situ cell death kit (Roche, Indianapolis, IN). Slides were observed with a BioRad Radiance 2000 confocal system coupled to an Olympus IX70 inverted microscope.
RT-PCR amplification and real-time quantitative PCR
RT-PCR was performed as described previously [10
] using specific primers [22
, 24
]. To determine the relative initial amounts of target cDNA, each cDNA sample was serially diluted 1:5 and 1:25, and amplified with specific primers. Hypoxanthine phosphoribosyltransferase (HPRT) was used as a housekeeping gene to verify that the same amount of RNA was amplified. To compare relative levels of mRNA transcripts between different groups, samples were reverse transcribed and amplified at the same time using aliquots of reagent from the same master mix. The PCR products were analyzed using a digital imaging system (Life Sciences, St. Louis, MO). Samples within the linear relationship between input cDNA and final PCR products (usually 1/25 cDNA dilution) were collected, and empirically determined concentrations of first-strand cDNA were used in RT-PCR to ensure linear amplification of sequences. The densitometric units for each cytokine band were normalized to those for the corresponding HPRT band. Most cytokine gene primers used in this study have been described previously [22
, 24
]. Primer sequences for IL-17 were: sense: GGTCAACCTCAAAGTCTTTAACTC, anti-sense: TTAAAA ATGCAAGTAAGTTTGCTG.
Real-time PCR was performed using an ABI Prism 7000 Sequence Detection System using SYBR Green PCR Master Mix (ABgene, Surrey, UK) following manufacturers protocols. Primers used were IFN
sense: TCAAGTGGCATAGATGTG GAAGAA, IFN
anti-sense: TGGCTCTGCAGGATTTTC ATG. MCP-1 forward: GTTGGCTCAGCCAGATGCA, MCP-1 reverse: AGCCTACTCATTGG GATCATCTT G. IL-17F sense: CCCATGGGATTACAACATCACTC, IL-17F anti-sense: CACTGGG CCTCAGCGATC. IL-10 forward: CAGCCTTG GAGAAAAGAGAG, IL-10 reverse: GGAAGTGGGTGGTGTTATTG. Each sample was amplified in triplicate. Values represent relative expression levels normalized to HPRT.
Statistical analysis
All experiments were repeated at least three times. Statistical significance was evaluated using the Mann-Whitney U test. Values with a P value <0.05 were considered significant and are designated by * in the figure legends.
|
|
|---|
has no effect on development of G-EAT but decreases fibrosis and promotes resolution of inflammation
developed G-EAT that reached maximal severity 19 days after cell transfer (Fig. 1
). Rat Ig-treated control recipients always had very severe (45+) G-EAT 19 days after cell transfer, and anti-TNF-
had no significant effect on G-EAT severity at day 19 (P = 0.06). However, anti-TNF-
significantly reduced G-EAT severity 3856 days after cell transfer (P<0.05) (Fig. 1)
. Thyroids of most rat Ig-treated mice maintained disease severity scores of 5+ 3856 days after cell transfer, while thyroid lesions of 8 of 15 anti-TNF-
-treated mice were resolving, with a severity score of 13+. Thus, anti-TNF-
promoted resolution of inflammation in G-EAT.
![]() View larger version (10K): [in a new window] |
Figure 1. Effect of anti-TNF- on induction and outcome of G-EAT. G-EAT severity scores were evaluated 19 and 3856 days after cell transfer on a scale from 0 to 5+. Each symbol represents G-EAT severity scores of individual mice. A significant difference in the severity scores of anti-TNF- compared with rat Ig-treated mice at day 3856 is indicated by an asterisk (P<0.05). Results are pooled from three separate experiments.
|
with 5+ severity scores (Fig. 2E)
, but there were some residual thyroid follicles in thyroids with 4+ severity scores (Fig. 2B
and 2F
, short arrows). Inflammation persisted in rat-Ig-treated mice, with 5+ severity scores, and thyroids were atrophic (Fig. 2C
, arrows) with few or no thyroid follicles. Thyroids of rat-Ig-treated mice with 4 and 5+ severity scores had a few remaining follicles and persistent inflammation at day 40 (Fig. 2D)
. At day 40, thyroids of anti-TNF-
-treated mice with 4-5+ severity scores were less atrophic, and lesions had started to resolve in most mice (Fig. 2G)
, while thyroids of anti-TNF-
-treated mice with 2 and 3+ severity scores were resolving with many thyroid follicles and less inflammation (Fig. 2H)
.
![]() View larger version (142K): [in a new window] |
Figure 2. Histopathology of G-EAT and fibrosis in thyroids of rat Ig-treated and anti-TNF- -treated mice. (AH) H&E staining of thyroids from rat Ig-treated and anti-TNF- -treated mice at day 19 or day 40. G-EAT reached maximal severity in both control (A, B) and anti-TNF- -treated (E, F) mice with a score of 5+ (A, E) or 4+ (B, F) severity at day 19. Inflammation was sustained at day 40 with a score of 5+ (C) or 45+ severity (D) in rat Ig-treated mice (C, D), and thyroids with 5+ severity scores were atrophic (C). In anti-TNF- -treated mice, thyroids with 4 and 5+ severity scores were not atrophic (G), and inflammation was resolving at day 40 in thyroids with 2 and 3+ severity scores (H). (IP) Trichrome staining for collagen in rat Ig-treated and anti-TNF- -treated mice. Collagen was evident in thyroids of rat Ig-treated mice with 5+ (I) or 4+ (J) severity at day 19 (I, J: blue) and was more prominent in thyroids of rat Ig-treated mice with 5+ (K) or 4+ (L) severity at day 40. Collagen was also present in thyroids of anti-TNF- -treated mice with 5+ severity scores (M) but was minimal in thyroids with 4+ severity scores (N) at day 19. Fibrosis was minimal in thyroids of anti-TNF- -treated mice with 5+ severity scores (O) and was barely discernible in 3+ G-EAT thyroids (P) at day 40. (QT) Myofibroblasts were identified by -SMA staining in thyroids of both rat Ig-treated and anti-TNF- -treated mice at day 19 with 5+ severity scores. There were more myofibroblasts in thyroids of rat Ig-treated mice (Q and R) than in thyroids of anti-TNF- -treated mice at day 19 (S and T). Original magnification: AH: x100; I-T: x400. Photos are representative of 3 experiments for rat Ig-treated and anti-TNF- -treated mice.
|
-smooth muscle actin staining (Fig. 2Q
2R
2S
2T)
, respectively. Fibrosis developed at day 19 in thyroids of rat Ig-treated mice with 5+ (Fig. 2I)
or 4+ (Fig. 2J)
severity scores, as shown by the blue collagen staining. Collagen deposition increased considerably at day 40 in thyroids of rat Ig-treated mice with 5+ (Fig. 2K)
or 4+ (Fig. 2L)
severity scores. There was less collagen deposition in thyroids of anti-TNF-
-treated mice at day 19 (Fig. 2M
2N)
or day 40 (Fig. 2O
2P)
, and little or no collagen was present in thyroids of anti-TNF-
-treated mice with 3+ severity scores at day 40 (Fig. 2P)
. Myofibroblasts represent activated fibroblasts and are prominent inducers of collagen [25
, 26
]. Infiltration of myofibroblasts was more prominent at day 19 (Fig. 2Q)
and day 40 (Fig. 2R)
in thyroids of rat Ig-treated mice than in thyroids of anti-TNF-
-treated mice at day 19 (Fig. 2S)
or day 40 (Fig. 2T)
. Serum T4 level, which considered normal to be a value >3 µg/dl, is an indicator of thyroid function, and will be decreased during development of fibrosis. All mice with very severe thyroid destruction and fibrosis had 5+ severity scores and had low serum T4 (Fig. 3
). Serum T4 levels were similar for rat Ig-treated and anti-TNF-
-treated mice at day 19 (P =0.169) (Fig. 3)
. However, at days 3856, T4 levels for thyroids with 4 and 5+ severity scores were significantly lower in rat Ig-treated mice than in anti-TNF-
-treated mice (P<0.05) (Fig. 3)
. Serum T4 levels in mice with 13+ G-EAT severity scores were all normal (Fig. 3)
, and serum T4 was normal when lesions resolved in anti-TNF-
-treated mice.
![]() View larger version (12K): [in a new window] |
Figure 3. Serum T4 levels in rat Ig-treated and anti-TNF- -treated mice. Serum T4 levels were determined at day 19 or day 3856 using a T4 enzyme immunoassay kit as described in Methods. Results are expressed as micrograms of T4 per deciliter of serum. *Serum T4 levels that were higher at day 3856 in anti-TNF- -treated compared with rat Ig-treated mice (P<0.05).
|
-treated mice is solely due to inhibition of TNF-
and is not a nonspecific effect of rat IgG, since repeated and prolonged injection of rat IgG or no antibody both resulted in comparable severity of G-EAT at day 19 with atrophy and fibrosis at days 3560 [7
, 10
, 22
, 23
].
In conclusion, anti-TNF-
did not affect incidence, onset, or severity of G-EAT, suggesting that endogenous TNF-
is not essential for development of G-EAT induced by sensitized cells. However, resolution of G-EAT lesions was promoted, and fibrosis was reduced after TNF-
neutralization.
Effect of anti-TNF-
on expression of pro- and anti- inflammatory molecules
To determine whether anti-TNF modulated expression of cytokines in thyroids, expression of TNF-
, IFN-
, IL-1ß, iNOS, IL-17, IL4, IL-13, IL-5, and IL-10 were analyzed by RT-PCR. None of the cytokines were detected in normal thyroids, but mRNA was up-regulated in thyroids of rat Ig-treated and anti-TNF-
-treated mice at day 19 and declined at day 48 (Fig. 4A
). Compared with rat-Ig treated controls, thyroids of anti-TNF-
-treated mice had significantly lower expression of proinflammatory cytokines such as TNF-
, IFN-
, IL-1ß, iNOS, and IL-17 at day 19 (Fig. 4A)
. Th2 cytokines IL-4, IL13, IL-5, and IL-10 were also up-regulated in thyroids of both rat Ig-treated and anti-TNF-
-treated mice at day 19 (Fig. 4B)
, and anti-TNF-
had no effect on expression of IL-4, IL-13, IL-5 or IL-10 at day 19 (Fig. 4B)
. These results suggest that IL-4 and IL-13 are not involved in the development of fibrosis in G-EAT, although IL-4 and IL-13 are implicated in development of fibrosis in other models [27
28
29
]. Expression of all cytokines was very low at day 48 and only TNF-
was significantly decreased in anti-TNF-
-treated mice compared with rat Ig-treated mice (Fig. 4)
.
![]() View larger version (13K): [in a new window] |
Figure 4. Comparison of cytokine expression in rat Ig-treated and anti-TNF- -treated mice. mRNA expression levels of TNF- , IFN- , IL-1ß, iNOS, and IL-17 (A), IL-4, IL13, IL-5 and IL-10 (B) in thyroids of rat Ig-treated and anti-TNF- -treated mice 19 or 48 days after cell transfer. Bars represent mean results for thyroids of five individual mice ± SD. Results are expressed as the mean ratio of cytokine densitometric U/HPRT ± SD (x100) and are representative of two independent experiments. (C) Real-time PCR analysis of IFN- , MCP-1, IL-17, and IL-10 mRNA expression in thyroids of rat Ig-treated and anti-TNF- -treated mice at day 19. The results are the mean ± SD from two independent experiments. Data are presented as relative expression levels normalized against the housekeeping gene HPRT. A significant difference between rat Ig-treated and anti-TNF- -treated groups is indicated by *, P < 0.05. N in A and B represents normal thyroids. In A, B, and C, G-EAT severity was 4 and 5+ at day 19 in thyroids of both rat Ig-treated and anti-TNF- -treated mice. Thyroids of rat Ig-treated mice had 4 and 5+ severity scores and fibrosis at day 48, while G-EAT was resolving with a score of 04+ in thyroids of anti-TNF- -treated mice.
|
, MCP-1 and IL-17 in thyroids of anti-TNF-
-treated mice compared with rat-Ig treated mice (Fig. 4C)
. However, anti-TNF-
had no effect on mRNA for IL-10 (Fig. 4C)
.
To determine whether protein expression of proinflammatory and profibrotic cytokines was also reduced in anti-TNF-
-treated mice, immunostaining was used to examine expression of TNF-
, IL-17, iNOS, MCP-1, and active TGFß1 in G-EAT thyroids. The results confirmed that the protein expression of TNF-
(Fig. 5A
5B
), IL-17 (Fig. 5C
5D)
, iNOS (Fig. 5E
5F)
, and MCP-1 (Fig. 5G
5H)
at day 1921 correlated with expression of their transcripts, being reduced in thyroids of anti-TNF-
-treated mice (Fig. 5B
5D
5F
5H)
compared with rat-Ig treated mice (Fig. 5A
5C
5E
5G)
although G-EAT severity (4-5+) at day 19 was comparable in both groups. Active TGFß, which contributes to development of fibrosis, was highly expressed in thyroids of rat Ig-treated mice with 4 and 5+ severity scores at day 19 (Fig. 5I)
, whereas active TGFß1 appeared to be reduced in thyroids of anti-TNF-
-treated mice with 4 and 5+ G-EAT (Fig. 5J)
. Confocal analysis showed that IL-17 was expressed by infiltrating CD4+ T cells, and expression of IL-17 by CD4+ T cells was reduced in anti-TNF-
-treated mice compared with rat-Ig treated mice (data not shown).
![]() View larger version (103K): [in a new window] |
Figure 5. Protein expression of TNF- , IL-17, iNOS, MCP-1 and TGFß in thyroids of rat Ig-treated and anti-TNF- -treated mice. (AH) Representative areas of photomicrographs demonstrating TNF- (A, B: red), IL-17 (C, D: red), iNOS (E, F: brown), MCP-1 (G, H: red), and active TGFß (I, J: brown) at day 19 in thyroids of rat Ig-treated mice (A, C, E, G, I) and anti-TNF- -treated mice (B, D, F, H, J). G-EAT severity was 4 and 5+ at day 19 in thyroids of both rat Ig-treated and anti-TNF- -treated mice. Thyroids of mice given rat Ig-G had 4 and 5+ severity scores and fibrosis at day 40, but G-EAT lesions were resolving with little fibrosis at day 40 in thyroids of anti-TNF- -treated mice. Magnification: AH: x400.
|
modulated expression of proinflammatory and profibrotic cytokines but had no effect on expression of Th2 cytokines. Reduced protein expression of the profibrotic cytokines MCP-1 and active TGFß in thyroids of anti-TNF-
-treated mice may contribute to inhibition of fibrosis.
Effect of anti-TNF-
on apoptosis and expression of anti-apoptotic molecules
TNF-
is also a major mediator of apoptosis [11
, 12
, 30
]. To determine whether anti-TNF-
might regulate expression of apoptosis-related molecules in G-EAT thyroids, different methods were used to examine the effect of anti-TNF-
on proapoptotic and anti-apoptotic molecules and apoptosis in thyroids. TUNEL staining showed apoptotic cells in thyroids of both rat Ig-treated (Fig. 6A
) and anti-TNF-
-treated mice (Fig. 6B)
. Apoptotic cells were predominant in thyroid follicular cells in thyroids of rat Ig-treated mice (Fig. 6A
, arrows) but predominant in inflammatory cells in thyroids of anti-TNF-
-treated mice (Fig. 6B
, arrows). TNF-
signaling triggers apoptosis through cleavage of caspase-3, and results in production of active caspase-3, which represents cells undergoing apoptosis [31
]. Using a monoclonal antibody that recognizes the active form of caspase-3, we found that expression of active caspase-3 was predominant in thyroid follicular cells in rat Ig-treated mice (Fig. 6C
, arrows), but was predominant in inflammatory cells in anti-TNF-
-treated mice (Fig. 6D
, arrow). Confocal analysis confirmed that there were many apoptotic thyrocytes in rat Ig-treated mice (Fig. 6E)
, while there were fewer apoptotic thyrocytes in anti-TNF-
-treated mice (Fig. 6F)
. These results suggest TNF-
may contribute to apoptotic destruction of thyrocytes.
![]() View larger version (94K): [in a new window] |
Figure 6. Expression of apoptotic and antiapoptotic molecules in thyroids of mice given rat IgG and anti-TNF- 19 days after cell transfer. (A, B) TUNEL staining (brown) in thyroids of rat Ig-treated (A) and anti-TNF- treated mice (B). (C, D) Expression of active caspase-3 (reddish brown) in thyroids of rat Ig-treated (C) and anti-TNF- -treated mice (D). (E, F) Confocal analysis demonstrates apoptosis of cytokeratin+ thyrocytes in thyroids of mice given rat Ig-G (E) and anti-TNF- (F). Thyrocytes were identified by cytokeratin (green, cytoplasmic staining in E and F), and apoptosis (red, nuclear staining in E, F) was detected using an in situ cell death kit. (G, H) Expression of FLIP (red) in thyroids of rat Ig-treated (G) and anti-TNF- -treated mice (H). All thyroids had 45+ severity scores. Original magnification: A, B: x1000; C, D, G and H: x400; E and F, x600.
|
and Fas signaling pathways [12
, 31
] and has been implicated in resolution of G-EAT [10
]. Expression of FLIP was predominant on infiltrating inflammatory cells in thyroids of rat Ig-treated mice (Fig. 6G)
and predominant on thyroid follicular cells in thyroids of anti-TNF-
-treated mice (Fig. 6H)
. The expression pattern of FLIP in thyroids of anti-TNF-
-treated mice was similar to that in thyroids of IFN-
/ mice, in which G-EAT lesions spontaneously resolved [10
], suggesting FLIP may be an important molecule protecting against apoptotic destruction of thyroids in G-EAT. |
|
|---|
in development of thyroid inflammation and fibrosis. Our results indicate that TNF-
is not essential for the development of G-EAT, but sustained expression of TNF-
is important for maintenance of inflammation and for promoting fibrosis. Furthermore, neutralization of TNF-
contributes to resolution of inflammation and inhibits fibrosis.
TNF-
is not essential for development of G-EAT induced by sensitized cells since anti-TNF-
did not reduce disease severity at day 19. Anti-TNF-
also did not reduce disease severity in collagen-induced arthritis or experimental autoimmune encephalomyelitis [11
, 32
, 33
], and TNF-
-deficient mice develop arthritis [14
, 34
]. Our results, together with these data, are consistent with the notion that TNF-
is generally not critical for the induction of organ-specific autoimmune disease [14
, 35
]. By using knockout of different cytokines on the DBA/1 background, e.g., IFN-
/, IL-12/, and IL-4/ mice, we found that these individual cytokines were also not required for induction of severe G-EAT [6
, 10
, 36
]. Our results also suggest that it is not an individual cytokine but the combined effects of several proinflammatory cytokines that contribute to the pathogenesis of G-EAT. TNF-
may act together with other proinflammatory cytokines to induce thyroid destruction.
However, TNF-
contributes to the maintenance of inflammation in G-EAT as thyroid lesions were resolved earlier in mice given anti-TNF-
. One mechanism by which anti-TNF-
promotes G-EAT resolution may due to its ability to modulate production of other cytokines. TNF-
plays a key role in the inflammatory process by inducing transcription of several proinflammatory cytokines [11
]. Many proinflammatory cytokines such as TNF-
, IL-1ß, IFN-
, iNOS, and IL-17 are expressed in thyroids of mice with G-EAT. Inhibition of TNF-
reduced expression of proinflammatory cytokines at day 19 in the thyroid and had no significant effect on expression of Th2 cytokines, such as IL-4, IL-13, and IL-10. Thyroids with 4 and 5+ G-EAT severity scores at day 3560 are very small and atrophic and those in which inflammation has largely resolved have very few inflammatory cells remaining. Therefore, expression of cytokines is very low in both of these groups of thyroids regardless of G-EAT severity. The fact that TNF-
, IL-1ß, IFN-
, iNOS, and IL-17 were more highly expressed at day 19 in thyroids of rat Ig-treated mice compared with anti-TNF-
-treated mice, suggests that TNF-
has a proinflammatory role in thyroiditis [5
, 37
]. TNF-
may up-regulate production of IL-1ß, IFN-
, IL-17, and iNOS, which coordinate with TNF-
to maintain autoimmune inflammation in G-EAT. IL-17 contributes to the pathogenesis of many autoimmune and inflammatory diseases by acting as a proinflammatory mediator [38
39
40
41
42
]. The decreased expression of IL-17 in thyroids of anti-TNF-
-treated mice suggested that TNF-
may act directly or indirectly to modulate expression of IL-17. Proinflammatory cytokines, including TNF-
and iNOS, were also reduced in thyroids of IFN-
/ mice, in which G-EAT lesions spontaneously resolved [10
], suggesting that these cytokines may mutually stimulate each others production, further amplify inflammation, and contribute to sustained inflammation in G-EAT. Our study suggests that a complex interplay among cytokines produced by activated CD4+ T cells is likely to control the outcome of an autoimmune disease.
TNF-
, IFN-
, and IL-1ß can all affect apoptosis [11
, 12
, 31
, 37
, 43
44
45
]. Therefore, through modulation of proinflammatory cytokines, TNF-
may modulate the apoptosis of different cell types. Apoptosis of inflammatory cells was increased, whereas apoptotic thyrocytes were decreased in anti-TNF-
-treated mice (Fig. 6B
6D
6F)
. Indeed, anti-TNF-
treatment induced apoptosis of inflammatory cells in patients with arthritis and in animal models of Crohn's disease [30
, 46
]. FasL expression by thyrocytes and CD8+ T cells play an important role in mediating the killing of Fas+ inflammatory cells, contributing to G-EAT resolution [47
, 48
]. TNF-
and other proinflammatory cytokines IFN-
, IL-1ß, and iNOS could induce apoptosis in tissues cells, such as pancreatic islet cells and thyrocytes [10
, 37
, 44
, 45
, 49
]. The current study supports a role for TNF-
, IFN-
, IL-1ß, and iNOS in autoimmune thyroiditis both for perpetuation of the autoimmune disease and the induction of tissue damage via apoptosis of thyrocytes [10
, 37
, 44
]. Expression of FLIP was shown to protect cells against TNF-
- and/or Fas- induced apoptosis [31
, 48
, 50
]. High expression of FLIP by thyrocytes of anti-TNF-
-treated mice correlated with reduced apoptosis of thyrocytes (Fig. 6H)
and may protect thyrocytes in anti-TNF-
-treated mice from apoptosis.
The results of this study also support a role for TNF-
in development of fibrosis [16
17
18
, 51
52
53
54
55
56
]. The fact that profibrotic cytokines were reduced in thyroids of anti-TNF-
-treated mice suggests that TNF-
contributes to the development of fibrosis. Thyroids from rat IgG-treated control mice highly expressed TNF-
, myofibroblasts, and collagen. Our finding is consistent with other observations, indicating that increased levels of TNF-
correlate with increased collagen deposition and development of fibrosis in other animal models and also in humans [16
17
18
, 51
52
53
54
55
56
]. Thyroids of rat Ig-treated mice had extensive inflammation, and serum T4 levels began to decrease at day 19 and further decreased by days 3856 as a result of thyroid fibrosis. In contrast, G-EAT lesions began to resolve by days 3856 in anti-TNF-
-treated mice, fibrosis was reduced, and serum T4 levels were normal in anti-TNF-
-treated mice when lesions resolved. In the present study, reduced fibrosis in thyroids of mice given anti-TNF-
correlated with reduced expression of active TGFß and MCP-1 and decreased infiltration of myfbs in thyroids. Anti-TNF-
also markedly suppressed bleomycin-induced lung fibrosis [18
, 54
] and decreased expression of TGFß and MCP-1 in the lung [18
]. Anti-TNF-
may inhibit thyroid fibrosis through down-regulation of profibrotic cytokines such as TGFß and MCP-1 [22
, 57
]. Consistent with the results presented here, TNF-
has been shown to be profibrotic in several other different animal models and in human fibrotic disorders [16
17
18
, 51
52
53
54
55
56
], but TNF-
was also shown to inhibit fibrosis in some studies [19
, 58
]. The effect of TNF-
can differ depending on many factors, e.g., whether TNF-
is constitutively expressed or temporally blocked and what kind of cells expressed TNF-
[11
, 14
, 15
, 56
, 58
]. Fibrosis is a common response to injury and can be the outcome of perturbation in the function of any tissue. Fibrosis occurs as a result of autoimmune inflammation in systemic sclerosis and idiopathic pulmonary fibrosis. However, fibrotic diseases respond poorly to currently available therapy. Our results suggest that inhibition of TNF-
could provide an alternative therapeutic intervention for fibrosis due to autoimmune inflammation.
In conclusion, unregulated TNF-
production characterizes many autoimmune diseases. Our results showed that although development of G-EAT was not suppressed by blocking TNF-
, blocking TNF-
led to beneficial outcomes in G-EAT with earlier resolution of inflammation and inhibition of fibrosis. Expression of IFN-
, IL-1ß, IL-17, and iNOS was also decreased, suggesting that blocking TNF-
decreased production of proinflammatory cytokines, but had no effect on Th2 cytokines. TNF-
could also contribute to destruction of thyroids through its effect on apoptosis or through regulation of expression of proapoptotic and/or anti-apoptotic molecules. Our study supports a proinflammatory and/or disease-promoting role for TNF-
in G-EAT and indicates an important role for TNF-
in the pathogenesis of G-EAT and development of fibrosis that develops after sustained autoimmune inflammation.
Received June 16, 2006; revised September 1, 2006; accepted September 15, 2006.
|
|
|---|
expression in the development of diabetes Immunity 12,459-469[CrossRef][Medline]
J. Immunol. 175,7738-7745
and IL-6 signaling governs neutrophil trafficking and apoptosis during acute inflammation J. Clin. Invest. 112,598-607[CrossRef][Medline]
/TNF-
synergism as the final effector in autoimmune diabetes: A key role for STAT1/IFN regulatory factor-1 pathway in pancreatic ß cell death J. Immunol. 166,4481-4489This article has been cited by other articles:
![]() |
I. Horie, N. Abiru, Y. Nagayama, G. Kuriya, O. Saitoh, T. Ichikawa, Y. Iwakura, and K. Eguchi T Helper Type 17 Immune Response Plays an Indispensable Role for Development of Iodine-Induced Autoimmune Thyroiditis in Nonobese Diabetic-H2h4 Mice Endocrinology, November 1, 2009; 150(11): 5135 - 5142. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Y. Chen, H. Kimura, M. A. Landek-Salgado, J. Hagedorn, M. Kimura, K. Suzuki, W. Westra, N. R. Rose, and P. Caturegli Regenerative Potentials of the Murine Thyroid in Experimental Autoimmune Thyroiditis: Role of CD24 Endocrinology, January 1, 2009; 150(1): 492 - 499. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Fang, G. C. Sharp, and H. Braley-Mullen Interleukin-10 Promotes Resolution of Granulomatous Experimental Autoimmune Thyroiditis Am. J. Pathol., June 1, 2008; 172(6): 1591 - 1602. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Fang, Y. Wei, V. DeMarco, K. Chen, G. C. Sharp, and H. Braley-Mullen Murine FLIP Transgene Expressed on Thyroid Epithelial Cells Promotes Resolution of Granulomatous Experimental Autoimmune Thyroiditis in DBA/1 Mice Am. J. Pathol., March 1, 2007; 170(3): 875 - 887. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||