Originally published online as doi:10.1189/jlb.0506338 on October 20, 2006
Published online before print October 20, 2006
(Journal of Leukocyte Biology. 2007;81:297-305.)
© 2007
by Society for Leukocyte Biology
Apoptosis induced in HIV-1-exposed, resting CD4+ T cells subsequent to signaling through homing receptors is Fas/Fas ligand-mediated
Jiaxiang Ji1,
Jenny J-Y. Chen1,
Vivian L. Braciale and
Miles W. Cloyd2
Department of Microbiology and Immunology, The University of Texas Medical Branch, Galveston, Texas, USA
2Correspondence: Department of Microbiology and Immunology, University of Texas Medical Branch at Galveston, Galveston, TX 77555-1070, USA. E-mail: mcloyd{at}utmb.edu

ABSTRACT
The hallmark of HIV-1 disease is the gradual disappearance of
CD4
+ T cells from the blood. The mechanism of this depletion,
however, is still unclear. Evidence suggests that lymphocytes
die in lymph nodes, not in blood, and that uninfected bystander
cells are the predominant cells dying. Our and others
previous studies showed that the lymph node homing receptor,
CD62 ligand (CD62L), and Fas are up-regulated on resting CD4
+ T cells after HIV-1 binding and that these cells home to lymph
nodes at an enhanced rate. During the homing process, signals
are induced through various homing receptors, which in turn,
induced many of the cells to undergo apoptosis after they entered
the lymph nodes. The purpose of this study was to determine
how the homing process induces apoptosis in HIV-1-exposed, resting
CD4
+ T cells. We found that signaling through CD62L up-regulated
FasL. This resulted in apoptosis of only HIV-1-presignaled,
resting CD4
+ T cells, not normal CD4
+ T cells. This homing receptor-induced
apoptosis could be blocked by anti-FasL antibodies or soluble
Fas, demonstrating that the Fas-FasL interaction caused the
apoptotic event.
Key Words: human AIDS lymphocytes

INTRODUCTION
Infection with HIV-1 is usually characterized by a gradual and
inexorable depletion of CD4
+ T lymphocytes. The importance of
the loss of these cells in the development of AIDS is unquestioned,
as it correlates with the loss of immune capabilities and the
consequent occurrence and severity of opportunistic infections
and HIV-1-associated neoplasms. However, understanding the mechanisms
by which HIV-1 causes CD4
+ T cell loss remains one of the unanswered
questions in the AIDS field. Many mechanisms have been proposed
to explain how HIV-1 causes depletion of CD4
+ T cells and the
earliest theorized that virus replication in CD4
+ T cells resulted
in their death or that virus-specific CTLs killed these infected
cells. However, elimination of productively infected cells could
not explain the significant loss of CD4
+ T cells [
1
], as few
cells in vivo are producing virus at any given time (approximately
one in 10
5 cells) [
2
,
3
]. Recent studies suggest that depletion
of CD4
+ T cells mainly occurs in lymphoid tissues of the gastrointestinal
tract [
4
,
5
], but the loss of these cells in the gut is not
mirrored in the blood and lymph nodes. In fact, CD4
+ T cell
depletion occurs in the "effecter area" of gut (lamina propria)
not in the "inductive area" (Peyers patches), where most
of the cells producing virus reside. It has also been shown
that increased numbers of CD4
+ cells are dying in peripheral
lymphoid tissues of HIV-infected subjects, but cells replicating
HIV-1 are not the principal cells dying; uninfected, neighboring
cells are dying [
6
]. Therefore, most theories about how HIV-1
depletes CD4
+ T cells now depict ways uninfected bystander cells
can be eliminated. Some early studies indicated that HIVgp120
binding to CD4 and CXCR4 receptors induced apoptosis [
7
,
8
].
All of these studies used transformed cell lines, and studies
using normal CD4 lymphocytes did not find this phenomenon [
7
8
9
10
11
].
Also, the apoptosis induced in cell lines was not Fas/Fas ligand
(FasL)-mediated [
7
8
9
]. Recently, collagen deposition-associated
fibrosis and damaged lymphatic tissues that accompany immune
activation have been shown to be correlated inversely with blood
CD4
+ T cell count [
4
,
12
]. Some studies suggest that there
is a significant dysregulation of cytokine responses, which
likely, influences T cell susceptibility to apoptosis [
13
].
Many of these factors may play some roles in CD4
+ T cell depletion.
However, excessive apoptosis of uninfected CD4
+ T cells is thought
to be the major reason for depletion of CD4
+ T cells [
13
,
14
].
Our previous studies showed that HIV-1 binding to resting CD4+ T cells up-regulated the expression of CD62L, the receptor for homing to lymph nodes, on some cells and enhanced the homing of these cells from the blood into lymph nodes [15
16
17
]. Subsequent signaling through various homing receptors during the homing process on these abortively infected CD4+ T cells induced many of them to undergo apoptosis [16
]. These signaling events occur when the cells transendothelial migrate into lymph nodes, and it was shown that CD4+ T cells in the blood of HIV-infected people do home to lymph nodes and bone marrow at increased rates [18
]. However, how the secondary signaling through homing receptors on these cells induces apoptosis is not clear. Some studies of CD4+ T cells in HIV-1+ patients stated that HIV-1-induced CD4+ T cell depletion is mediated by Fas-FasL interactions [19
, 20
]. It has been demonstrated that high levels of Fas susceptibility were found in PBLs before highly active antiretroviral therapy (HAART), and these were reduced significantly after HAART [21
]. In addition, after HAART, it was found that the decline in tonsillar viral load was associated with a decrease in the proportion of apoptotic CD4+ T cells within the memory CD28+ Fas+ FasL+ population, suggesting that HIV-1 induces FasL-mediated CD4+ T cell apoptosis [22
]. However, others demonstrated a deficiency in FasL expression and activity in blood cells of HIV-1-infected patients, when compared with uninfected, healthy volunteers [23
]. We hypothesize this might be explained if FasL is induced after the cells migrate into lymphoid tissues. Mitra et al. [24
] observed that the in vitro spontaneous death of T cells taken from advanced HIV-1-infected patients was not inhibited by suppressing the Fas-FasL pathway, but it is not clear whether this in vitro phenomenon reflects how HIV depletes these cells in vivo. Thus, it is of great interest to determine whether the Fas-FasL pathway is involved in the homing receptor-induced apoptosis of HIV-1-signaled, resting CD4+ T cells.
It is known that HIV-1 up-regulates surface expression of Fas upon binding to CD4+ T cells [25
]. We hypothesize that signals, through homing receptors on the HIV-1-exposed, resting CD4+ T cells, would up-regulate FasL and prime the cells to undergo apoptosis. Blocking of the Fas-FasL interaction should prevent this apoptosis. To test our hypothesis, cell surface FasL expression and apoptosis were determined on HIV-1-exposed CD4+ T cells secondarily signaled through CD62L. Furthermore, anti-FasL antibody and soluble Fas (sFas) were used in blocking experiments of apoptosis.

MATERIALS AND METHODS
Antibodies and other reagents
Unless specified, all mAb specific for human cell surface molecules
were obtained from BD Biosciences (San Diego, CA). For CD4 cell
purification, a cocktail of purified mAb specific for CD8, CD14,
CD19, CD56, HLA-DR, -DP, and -DQ, and glycophorin A was used.
Anti-CD25-coated beads and goat antimouse IgG (GAM)-coated beads
were purchased from Dynal (Lake Success, NY). For FACS analyses,
FITC- or PE-conjugated mAb specific for CD4, CD25, CD95/Fas,
CD178/FasL (Ancell, Bayport, MN), and Bcl-2 and AnnexinV-PE
were used. For cross-linking of CD4 (RPA-T4) or CD62L (XLCD62L;
Clone Dreg56), anti-CD4 and anti-CD62L were used, respectively.
For blocking experiments, anti-FasL mAb (Clone NOK1) was used
[
26
]. FITC- or PE-labeled mouse or hamster IgG1, IgG2a, and
IgG2b isotype controls were applied as needed. The sFas/Fc chimeric
protein containing human extracellular domain was purchased
from R&D Systems (Minneapolis, MN).
Purification of resting CD4+ T cells
Blood was obtained from HIV-1-negative, healthy human volunteers. PBMC were isolated from heparinized venous blood by centrifugation through lymphocyte separation medium (Mediatech Inc., Herndon, VA) and washed twice with PBS. The cell pellet was resuspended in RPMI-1640 medium (Gibco, Carlsbad, CA), supplemented with 2% human AB serum. CD4+ T cells were purified from PBMC by negative selection using a cocktail of antibodies and magnetic beads (Dynal). Briefly, PBMC were incubated with appropriate amounts of antibody cocktail (anti-CD8, anti-CD14, anti-CD16, anti-CD19, anti-CD56, anti-HLA-DR, -DP, and -DQ, and antiglycophorin A) for 30 min on ice. After incubation with GAM-coated beads at room temperature for 30 min with gentle shaking, the supernatant was recovered after magnetic bead-positive cells were removed using a magnetic separator. Cells were then depleted of CD25+ cells using anti-CD25-coated beads. The purified cell preparations usually contained 9295% CD4+ cells with undetectable CD25+ cells,
55% CD45RA+ naïve cells, and
40% CD45RO+ memory cells, as analyzed by flow cytometry.
HIV-1 strains and exposure of CD4+ T cells
X4 virus HIV-1213 was isolated from PBMC of infected individuals as described [27
] and propagated in CEM cells. R5 virus HIV-1BaL was propagated in VB cells. Virus was collected when all of the cells were HIV antigen-positive. Uninfected culture supernatants were collected as mock control. CD4+ T cells were exposed with HIV-1 at a multiplicity of infection (MOI) equal to 1 and cultured in RPMI-1640 medium supplemented with 10% human AB serum, 5 U/ml recombinant IL-2, 100 U/ml penicillin-100 µg/ml streptomycin, and 2 mM L-glutamine. In some experiments, HIV-1 was UV-inactivated before infection as described [27
]. Virus, live or UV-inactivated, did not productively infect resting CD4 cells, as determined by PCR for HIV-1 gag region and p24 antigen-capture ELISA.
XLCD62L
Resting CD4+ T cells were exposed with or without HIV-1 (live or inactivated) overnight. After three washes, the cells were incubated with mouse antihuman CD4 or CD62L mAb (2 µg/105 cells) for 30 min on ice. (Each of these antibodies has been shown to be able to signal via cross-linking the receptor to which they bind [26
].) Cells were washed three times and cultured in 96-well plates in supplemented media containing GAM IgG antibody (0.51 µg/105 cells). In some experiment, plate-coated GAM was used in place of a soluble one. For the coating of GAM to the plates, 50 µl GAM in coating buffer (100 µg/ml in 30 mmol/L NaHCO3, 15 mmol/L Na2CO3, pH 9.6) was added to each well of 96-well plates, incubated at 4°C overnight, and washed five times with PBS.
Flow cytometric analysis
For surface staining, cells were incubated with normal mouse IgG for 15 min to block nonspecific binding sites, as well as to bind to any free arms of GAM IgG cross-linking antibody. Then, cells were stained with various FITC- or PE-conjugated mAb on ice for 30 min. Intracellular staining for Bcl-2 was measured, according to protocols provided by BD Biosciences. Briefly, cells were permeabilized with cytofix/cytoperm buffer for 20 min on ice, and intracellular staining was performed for 30 min on ice with PE-conjugated anti-Bcl-2 mAb. Cell staining was detected on a FACScan and analyzed using CellQuest software (Becton Dickinson, San Jose, CA).
RT-PCR for FasL mRNA
For the determination of FasL mRNA, RT-PCR was performed as described [28
]. In brief, total RNA was extracted with RNeasy mini kit (Qiagen, Inc., Valencia, CA) according to the manufacturers protocol. RT of RNA to cDNA and PCR were performed, according to the protocol of the OneStep RT-PCR kit (Qiagen). FasL-specific primer pairs and GAPDH were purchased from Sigma Chemical Co. (St. Louis, MO). Premier sequences for FasL 5' sense and 3' antisense were CTGGTGGCTCTGGTTGGAAT and GTTTAGGGGCTGGTTGTTGC, respectively. GAPDH was used as an internal control. All the RNA samples pre-ran the PCR without RT and found no detected FasL signals.
Apoptosis determinations
Cells undergoing apoptosis were detected by Annexin V-PE staining, and necrotic cells were determined by 7-amino-actinomycin (7-AAD) staining, according to protocols provided by BD Biosciences. Apoptotic cells were gated on Annexin V+ 7-AAD cells.
Statistical analysis
Differences between experimental groups were examined using the Students t-test. A difference in mean values was considered significant when the P value was <0.05 or very significant when the P value was <0.01.

RESULTS
HIV-1 exposure resulted in up-regulated expression of CD62L on resting CD4+ T cells
We showed previously that resting CD4
+ T cells abortively infected
with HIV-1 up-regulated CD62L, which is required for homing
into lymph nodes [
15
,
16
]. In contrast, Marschner et al. [
29
,
30
] reported CD4 ligation by anti-CD4 mAb cross-linking or
by coculturing with HIV-producing Jurkat cells, induced shedding
of CD62L, which reduces the homing of T cell to peripheral lymph
nodes. To clarify the effect of HIV-1 on CD62L expression, we
exposed purified, resting CD4
+ T cells (purity >95%) with
virus (HIV-1
213 or HIV-1
BaL), freshly collected or stored at
70°C. Confirming our previous observations, HIV-1
213 and HIV-1
BaL did up-regulate CD62L on CD4
+ T cells (
Fig. 1A
and 1B
).
The effects on CD62L expression could be observed by 24-h postexposure
and reached a peak at 48 h and then started declining by 72
h
(Fig. 1B)
. Cross-linking of CD4 by anti-CD4 plus soluble
GAM up-regulated the CD62L on CD4
+ T cells
(Fig. 1C)
. However,
if CD4 were cross-linked by anti-CD4 plus plate-coated GAM instead,
a decrease of CD62L was observed
(Fig. 1C)
, similar to observations
by Marschner et al. [
29
,
30
]. It is interesting that consistent
with our previous report [
29
,
30
], HIV-1 exposure could not
significantly alter expression of other home receptor molecules
such as CD44 and CD11a (data not shown).
XLCD62L on HIV-1-exposed, resting CD4+ T cells induced apoptosis and up-regulated FasL expression
Consistent with our previous results, increased expression of
Fas was also observed 2472 h after HIV-1
213 or HIV-1
BaL exposure
(Fig. 1D
and 1E)
. As detected by Annexin V staining
in
Figure 2A
and 2B
, 23 days after XLCD62L, significant
apoptosis was observed on HIV-1
213- or HIV-1
BaL-exposed CD4
+ T cells but not mock-treated cells. Similarly, cross-linking
of other homing receptors CD44 or CD11a with mAb induced 2535%
of HIV-1-exposed, resting CD4
+ T cells to undergo apoptosis.
Of note, HIV-1 or XLCD62L alone did not result in apoptosis
(Fig. 2A)
.
To determine how signaling through CD62L induces HIV-signaled
CD4
+ T cells to undergo apoptosis, we showed previously that
HIV-1 exposure up-regulated Fas expression on CD4
+ T cells,
suggesting the possible roles of Fas in apoptosis [
16
]. In
this study, we further examined the possible involvement of
FasL in apoptosis by determining FasL expression on HIV-1-exposed
CD4
+ T cells secondarily signaled through CD62L. We found upon
stimulation by XLCD62L, FasL expression was induced markedly
in HIV-1-exposed CD4
+ T cells (HIV-1
213, MFI=122±15,
P<0.01; HIV-1
BaL, MFI=116±12,
P<0.01) compared
with XLCD62L-signaled, mock controls (MFI=59±6;
Fig. 3A
and B
).
Similarly, cross-linking other homing receptors, CD44 and CD11a,
induced FasL expression on HIV-1-exposed CD4
+ T cells (data
not shown). Furthermore, as detected by RT-PCR, FasL mRNA was
also induced by XLCD62L in HIV-1
213-exposed CD4
+ T cells
(Fig. 3C)
.
It is interesting that XLCD62L alone up-regulated FasL transcription
but not its expression at protein levels, suggesting the level
of mRNA expression does not necessarily predict the level of
protein expression
(Fig. 3B
and 3C)
.
Apoptosis of HIV-1-exposed, resting CD4+ T cells upon stimulation with XLCD62L was blocked by sFas or anti-FasL mAb
We next examined whether XLCD62L-induced apoptosis on HIV-1-exposed,
resting CD4
+ T cells is mediated by Fas/FasL, by blocking of
apoptosis with sFas or anti-FasL mAb. For this purpose, sFas
or anti-FasL mAb was added into CD4
+ T cell cultures, and then
apoptosis was determined by Annexin V staining. As shown in
Figure 4
, XLCD62L-induced apoptosis of HIV-1
213-exposed CD4
+ T cells was inhibited significantly by sFas or specific blocking
anti-FasL mAb.
XLCD62L of HIV-1-exposed, resting CD4+ T cells down-regulated Bcl-2 expression
As Bcl-2 is a potent inhibitor of apoptosis [
31
,
32
], and
Bcl-2 expression has been reported to be impaired in T cells
from HIV-1-exposed individuals [
33
34
35
], we sought to investigate
the Bcl-2 expression in HIV-1-exposed CD4
+ T cells subsequent
to XLCD62L. Bcl-2 expression was found to be down-regulated
significantly on HIV-1-exposed CD4
+ T cells subsequent to XLCD62L
(HIV-1
213, MFI=226±25,
P<0.05; HIV-1
BaL, MFI=246±21,
P<0.01) compared with XLCD62-signaled, mock controls (MFI=400±25;
Fig. 5A
and 5B
). However, HIV-1 or XLCD62L alone did not alter
the Bcl-2 expression
(Fig. 5B)
.

DISCUSSION
In this study, we demonstrated that HIV-1 binding up-regulated
Fas expression on resting CD4
+ T cells, and additional signals
through homing receptors induced FasL expression, resulting
in apoptosis. Anti-FasL mAb and sFas could inhibit the XLCD62L-induced
apoptosis of HIV-1-exposed, resting CD4
+ T cells. Thus, apoptosis
of HIV-1-exposed, resting CD4
+ T cells subsequent to signaling
through homing receptors (CD62L) is Fas-FasL-mediated. Although
cross-linking of each of homing receptors CD62L, CD44, and CD11a
induced the expression of FasL and apoptosis in HIV-1-exposed
CD4
+ T cells, cross-linking of other surface molecules such
as HLA Class I did not affect the viability of HIV-1-exposed
CD4
+ T cells [
16
], demonstrating specificity of Fas-FasL-mediated
apoptosis following signaling through homing receptor(s). However,
HIV-1 only up-regulates the expression of CD62L expression but
not the expression of other homing receptors such as CD44 and
CD11a, suggesting that the signals for enhanced homing are mainly
via up-regulated CD62L. The subsequent signals for apoptosis
could be through multiple homing receptors or any one of them.
These studies are of particular importance in light of conflicting data regarding the effects of HIV-1 on homing and homing receptor regulation (Fig. 1A
1B
1C)
. Early studies showed that CD4+ lymphocytes increase in number in lymph nodes (lymphadenopathy) when blood levels of these cells begin to drop significantly [36
, 37
], suggesting the possibility of enhanced homing of CD4+ lymphocytes from the blood into lymph nodes. Furthermore, in agreement with these observations, our previous studies showed that HIV-1-abortive infection of resting CD4+ T cells up-regulated the expression of CD62L, the receptor for homing to lymph nodes, and these cells enhanced homing from the blood into lymph nodes [15
16
17
]. However, in contrast with these observation, studies by Marschner et al. [29
, 30
] showed that extensive CD4 cross-linking by plate-coated, anti-CD4 or contact with HIV-producing Jurkat cells led to CD62L shedding, which would reduce homing of T cells to peripheral lymph nodes. An explanation for shedding of CD62L in those studies may lie in the difference in experimental techniques. We used virus, which was freshly harvested as supernatants from infected CEM cells, to bind to resting CD4+ T cells. In contrast, Marschner et al. [29
, 30
] cocultured CD4+ T cells with HIV-1-infected Jurkat cells. We have performed similar experiments and found that extensive fusion occurred between the Jurkat cells and the normal CD4+ T cells (data not shown). Whether this technique resulted in reduction of CD62L expression because of the effects of fusion or negative factors released from Jurkat cells is not known. Comparing several cell lines that are used for HIV-1 culture on their cytokine production, we found that CEM cells produced undetectable IL-10. However, other cell lines such as H-9 cells produced high levels of IL-10 (500700 µg/ml), which can inhibit CD62L expression (data not shown).
TCR activation of T cells derived from transformed cell lines or hybridomas results in induction of FasL expression and rapid susceptibility to Fas-mediated apoptosis. In primary T lymphocytes, however, the process of activation-induced cell death requires a more prolonged period of time [38
39
40
]. Tateyama et al. [28
] demonstrated that XLCD4 on CD4+ T cells not only led to Fas up-regulation but also primed the CD4+ T cells to express FasL upon anti-CD3 stimulation and rendered the T cells susceptible to Fas-mediated apoptosis. We showed previously that HIV-1 binding to resting CD4+ T cells induced these cells to home into lymph nodes faster and induced apoptosis upon stimulation by cross-linking of homing receptors [15
16
17
]. Our present study shows that HIV-1 exposure, followed by cross-linking the homing receptor CD62L on CD4+ T cells, induced FasL expression and sensitized the cells for Fas-mediated apoptosis (Figs. 2
and 3)
. One of the major observations in this study is that apoptosis of HIV-1-exposed, resting CD4+ T cells, in which CD62L was cross-linked, could be inhibited significantly by blocking anti-FasL antibodies or sFas (Fig. 4)
. This indicated that apoptosis of HIV-1-exposed, resting CD4+ T cells, subsequently signaled through the homing receptor, is Fas-FasL-mediated. It is interesting that apoptosis was detected in resting CD4+ T cells exposed with X4 virus strain (HIV-1213) or R5 virus (HIV-1BaL) strain, subsequently signaled by XLCD62L, indicating that this is a common property of HIV-1 (Fig. 2)
. Furthermore, such effect seems to be independent of HIV-1 replication, as UV-inactivated, HIV-1-exposed, resting CD4+ T cells, upon XLCD62L, underwent apoptosis as well (data not shown). Although recent observations showed that HIV or SIV could productively infect resting, naïve CD4+ T cells in vivo [41
, 42
] or naïve CD4+ T cells cultured in conditioned media [43
] or with macrophages in vitro [44
], we have not detected any productive infection in resting CD4+ T cells derived from PBMC by p24 antigen-capture ELISA and PCR for virus gag sequence (data not shown), indicating our culture system lacked the factors [41
, 42
] that exist in vivo or conditioned media. Even if some nondivided CD4+ T cells in vivo were infected productively, that does not necessarily mean that they will be killed by virus. R5 virus is not cytopathic, but CD4+ T cells are eliminated in the gut early, when only that virus is present. In fact, it is likely that this early gut CD4+ T cell depletion involves homing, as the cells depleted in lamina propria, where CD4+ T cells migrate in from the blood and the Peyers patches, which contain most of the productively infected CD4 cells that are not depleted. Consistent with our current in vitro findings, Li et al. [45
] found Fas-FasL-mediated apoptotic pathway in lamina propria CD4+ T cells, indicating even in acute infection, apoptosis contributes to CD4+ T cell depletion. Futhermore, Boirivant et al. [46
] observed that lamina propria CD4+ T cells selectively up-regulated Fas and FasL and underwent apoptosis when exposed to recombinant gp120 upon the CD2 pathway stimulation in vitro. Based on our data, we proposed that in vivo, CD4+ T cells are infected with HIV in Peyers patches, where they may get the signals for homing fast and up-regulated Fas and get the further signals, such as FasL, through interaction between homing receptors and their ligand on lamina propria and finally, undergo apoptosis in lamina propria. We are currently working on the effects of HIV on gut homing receptor
4ß7 and consequence of cross-linking of
4ß7 on the HIV-exposed CD4+ T cells derived from lymph node bioautopsy. Although the evidence was circumstantial, susceptibility of CD4+ T cells to apoptosis induced by XLCD62L appears to be mediated by down-regulation of Bcl-2 (Fig. 5)
. These results provide a molecular basis to explain the mechanism of homing receptor signaling-induced, resting CD4+ T cell apoptosis.
Previous studies have been shown that CD4 activation primes T cells for apoptosis if a second signal from TCR engagement or if accessory cells were provided [47
48
49
]. It is known that a repeated signal through TCR induces the expression of FasL [39
, 40
, 50
], and APC constitutively express FasL [51
, 52
]. In this study, we found signals, which through homing receptor, such as XLCD62L, could provide a similar second signal to induce FasL (Fig. 3)
. Together with the Fas up-regulation within the same CD4+ T cell population (Fig. 1D
and 1E)
, the induction of FasL resulted in significant CD4+ T cell apoptosis in vitro. Unlike previous reports [53
], in which XLCD4 induced FasL expression rapidly in a transient manner, we could not find that HIV-1 signals alone could induce any FasL (Fig. 3B
and 3C)
. This suggests the CD4 signaling, via an interaction with HIV-1 virions or via envelope proteins expressed on the surface of infected cells, is not the same as XLCD4 through anti-CD4 antibodies. Furthermore, it is possible that HIV-1 could induce FasL expression slightly, but it sheds quickly in a manner as described previously [26
]. However, against this possibility, the addition of a matrix metalloproteinase inhibitor did not alter FasL expression significantly on HIV-1-exposed CD4+ T cells, with or without second signals through XLCD62L (data not shown). Tateyama et al. [28]
and others [38
, 54
] documented the difficulty in demonstrating surface FasL expression on lymphocytes. In the present study, we could detect FasL expression on the CD4+ T cells by flow cytometry, as described by Algeciras et al. [53
]. The major differences between previous observations and those in this report are the methods to purify CD4+ T cells and types of second signals. Of note, during purification of resting CD4+ T cells, we depleted CD4+CD25+ cellsregulatory cellswhich can suppress the function of CD4+CD25 cells [55
]. It remains to be determined whether CD4+CD25+ cells inhibit FasL induction in CD4+CD25 cells.
With respect to the in vivo relevance of our findings in the context of HIV-1 pathogenesis, our data implicate the following scenario to be operative in vivo and may act as a mechanism for the death of uninfected CD4+ cells. Resting CD4+ lymphocytes in lymphoid tissues (in gut, lymph nodes, etc.), coming into contact with HIV-1 virions, productively infected cells, or HIV-1-coated, follicular dendritic cells, result in induction of a partially activated phenotype, including up-regulation of homing receptors and Fas. Because of normal lymph node/blood circulation, in which most lymphocytes in lymphoid tissues migrate back to the blood within 2 days [56
], many of these cells will end up back in the blood at the time of maximum-induced expression of homing receptors. These cells would then home rapidly to peripheral lymph nodes or gut-associated, lymphatic tissue, dependent on the type of homing receptors (e.g., CD62L for peripheral lymph nodes;
4ß7 for gut). Following transendothelial migration, these CD4+ T cells receive signals through homing receptors, resulting in induction of FasL expression on some of the cells and rapid susceptibility of them to Fas-mediated apoptosis. Consequently, together with the increased Fas expression within the same CD4+ T cell population, approximately one-third of them would be depleted, and they do not produce HIV-1 [18
]. In support of this review, features that are characteristically associated with HIV-1 infection include the following. As CD4 lymphocytes disappear in the blood, their numbers do not drop, and the CD4/CD8 ratios do not invert in lymph nodes until late in disease [57
]; there is increased apoptosis of uninfected cells, mainly localized in lymph nodes or gut-associated lymphatic tissue [6
, 45
, 58
] but not in the blood [59
, 60
]; there is increased FasL-expressing cells with the morphology of macrophages and lymphocytes, and the degree of FasL in vivo has been shown to be correlated with the degree of apoptosis [61
]. Steroids, which are known to down-regulate CD62L and retard lymph node homing, have been shown to stop reduction of CD4 cells in the blood of patients [62
]. This may be the consequence as control of aberrant homing signals for the marked reduction in apoptosis. Future studies, testing whether inhibition of lymph node homing or homing receptor induction of apoptosis would prevent depletion of CD4+ cells in patients, are needed.

ACKNOWLEDGEMENTS
This work was supported by grants from National Institutes of
Health (AI 054291 and AI 51177) to M. W. C. We thank Dr. Samuel
Baron for critical reading of the manuscript.

FOOTNOTES
1 These authors contributed equally to this work.

Received May 19, 2006;
revised August 25, 2006;
accepted September 18, 2006.

REFERENCES
1 - Fauci, A. S. (1996) Host factors and the pathogenesis of HIV-induced disease Nature 384,529-534[CrossRef][Medline]
2 - Harper, M. E., Marselle, L. M., Gallo, R. C., Wong-Staal, F. (1986) Detection of lymphocytes expressing human T-lymphotropic virus type III in lymph nodes and peripheral blood from infected individuals by in situ hybridization Proc. Natl. Acad. Sci. USA 83,772-776[Abstract/Free Full Text]
3 - Embretson, J., Zupancic, M., Beneke, J., Till, M., Wolinsky, S., Ribas, J. L., Burke, A., Haase, A. T. (1993) Analysis of human immunodeficiency virus-infected tissues by amplification and in situ hybridization reveals latent and permissive infections at single-cell resolution Proc. Natl. Acad. Sci. USA 90,357-361[Abstract/Free Full Text]
4 - Brenchley, J. M., Schacker, T. W., Ruff, L. E., Price, D. A., Taylor, J. H., Beilman, G. J., Nguyen, P. L., Khoruts, A., Larson, M., Haase, A. T., Douek, D. C. (2004) CD4+ T cell depletion during all stages of HIV disease occurs predominantly in the gastrointestinal tract J. Exp. Med. 200,749-759[Abstract/Free Full Text]
5 - Mehandru, S., Poles, M. A., Tenner-Racz, K., Horowitz, A., Hurley, A., Hogan, C., Boden, D., Racz, P., Markowitz, M. (2004) Primary HIV-1 infection is associated with preferential depletion of CD4+T lymphocytes from effector sites in the gastrointestinal tract J. Exp. Med. 200,761-770[Abstract/Free Full Text]
6 - Finkel, T. H., Tudor-Williams, G., Banda, N. K., Cotton, M. F., Curiel, T., Monks, C., Baba, T. W., Ruprecht, R. M., Kupfer, A. (1995) Apoptosis occurs predominantly in bystander cells and not in productively infected cells of HIV- and SIV-infected lymph nodes Nat. Med. 1,129-134[CrossRef][Medline]
7 - Laurent-Crawford, A. G., Krust, B., Riviere, Y., Desgranges, C., Muller, S., Kieny, M. P., Dauguet, C., Hovanessian, A. G. (1993) Membrane expression of HIV envelope glycoproteins triggers apoptosis in CD4 cells AIDS Res. Hum. Retroviruses 9,761-773[Medline]
8 - Laurent-Crawford, A. G., Coccia, E., Krust, B., Hovanessian, A. G. (1995) Membrane-expressed HIV envelope glycoprotein heterodimer is a powerful inducer of cell death in uninfected CD4+ target cells Res. Virol. 146,5-17[CrossRef][Medline]
9 - Roggero, R., Robert-Hebmann, V., Harrington, S., Roland, J., Vergne, L., Jaleco, S., Devaux, C., Biard-Piechaczyk, M. (2001) Binding of human immunodeficiency virus type 1 gp120 to CXCR4 induces mitochondrial transmembrane depolarization and cytochrome c-mediated apoptosis independently of Fas signaling J. Virol. 75,7637-7650[Abstract/Free Full Text]
10 - Nair, M. P. N., Mahajan, S., Hou, J., Sweet, A. M., Schwartz, S. A. (2000) The stress hormone, cortisol, synergizes with HIV-1 gp-120 to induce apoptosis of normal human peripheral blood mononuclear cells Cell. Mol. Biol. (Noisy-le-grand) 46,1227-1238[Medline]
11 - Tuosto, L., Gilardini Montani, M. S., Lorenzetti, S., Cundari, E., Moretti, S., Lombardi, G., Piccolella, E. (1995) Differential susceptibility to monomeric HIV gp120-mediated apoptosis in antigen-activated CD4+ T cell populations Eur. J. Immunol. 25,2907-2916[Medline]
12 - Schacker, T. W., Nguyen, P. L., Beilman, G. J., Wolinsky, S., Larson, M., Reilly, C., Haase, A. T. (2002) Collagen deposition in HIV-1 infected lymphatic tissues and T cell homeostasis J. Clin. Invest. 110,1133-1139[CrossRef][Medline]
13 - Alimonti, J. B., Ball, T. B., Fowke, K. R. (2003) Mechanisms of CD4+ T lymphocyte cell death in human immunodeficiency virus infection and AIDS J. Gen. Virol. 84,1649-1661[Abstract/Free Full Text]
14 - Douek, D. C. (2003) Disrupting T-cell homeostasis: how HIV-1 infection causes disease AIDS Rev. 5,172-177[Medline]
15 - Wang, L., Robb, C. W., Cloyd, M. W. (1997) HIV induces homing of resting T lymphocytes to lymph nodes Virology 228,141-152[CrossRef][Medline]
16 - Wang, L., Chen, J. J., Gelman, B. B., Konig, R., Cloyd, M. W. (1999) A novel mechanism of CD4 lymphocyte depletion involves effects of HIV on resting lymphocytes: induction of lymph node homing and apoptosis upon secondary signaling through homing receptors J. Immunol. 162,268-276[Abstract/Free Full Text]
17 - Chen, J. J., Huang, J. C., Shirtliff, M., Briscoe, E., Ali, S., Cesani, F., Paar, D., Cloyd, M. W. (2002) CD4 lymphocytes in the blood of HIV(+) individuals migrate rapidly to lymph nodes and bone marrow: support for homing theory of CD4 cell depletion J. Leukoc. Biol. 72,271-278[Abstract/Free Full Text]
18 - Cloyd, M. W., Chen, J. J., Adeqboyega, P., Wang, L. (2001) How does HIV cause depletion of CD4 lymphocytes? A mechanism involving virus signaling through its cellular receptors Curr. Mol. Med. 1,545-550[CrossRef][Medline]
19 - Gehri, R., Hahn, S., Rothen, M., Steuerwald, M., Nuesch, R., Erb, P. (1996) The Fas receptor in HIV infection: expression on peripheral blood lymphocytes and role in the depletion of T cells AIDS 10,9-16[Medline]
20 - Katsikis, P. D., Wunderlich, E. S., Smith, C. A., Herzenberg, L. A., Herzenberg, L. A. (1995) Fas antigen stimulation induces marked apoptosis of T lymphocytes in human immunodeficiency virus-infected individuals J. Exp. Med. 181,2029-2036[Abstract/Free Full Text]
21 - Badley, A. D., Dockrell, D. H., Algeciras, A., Ziesmer, S., Landay, A., Lederman, M. M., Connick, E., Kessler, H., Kuritzkes, D., Lynch, D. H., Roche, P., Yagita, H., Paya, C. V. (1998) In vivo analysis of Fas/FasL interactions in HIV-infected patients J. Clin. Invest. 102,79-87[Medline]
22 - Dyrhol-Riise, A. M., Stent, G., Rosok, B. I., Voltersvik, P., Olofsson, J., Asjo, B. (2001) The Fas/FasL system and T cell apoptosis in HIV-1-infected lymphoid tissue during highly active antiretroviral therapy Clin. Immunol. 101,169-179[CrossRef][Medline]
23 - Sieg, S., Smith, D., Yildirim, Z., Kaplan, D. (1997) Fas ligand deficiency in HIV disease Proc. Natl. Acad. Sci. USA 94,5860-5865[Abstract/Free Full Text]
24 - Mitra, D., Steiner, M., Lynch, D. H., Staiano-Coico, L., Laurence, J. (1996) HIV-1 upregulates Fas ligand expression in CD4+ T cells in vitro and in vivo: association with Fas-mediated apoptosis and modulation by aurintricarboxylic acid Immunology 87,581-585[CrossRef][Medline]
25 - Wang, Z. Q., Dudhane, A., Orlikowsky, T., Clarke, K., Li, X., Darzynkiewicz, Z., Hoffmann, M. K. (1994) CD4 engagement induces Fas antigen-dependent apoptosis of T cells in vivo Eur. J. Immunol. 24,1549-1552[Medline]
26 - Kayagaki, N., Kawasaki, A., Ebata, T., Ohmoto, H., Ikeda, S., Inoue, S., Yoshino, K., Okumura, K., Yagita, H. (1995) Metalloproteinase-mediated release of human Fas ligand J. Exp. Med. 182,1777-1783[Abstract/Free Full Text]
27 - Cloyd, M. W., Moore, B. E. (1990) Spectrum of biological properties of human immunodeficiency virus (HIV-1) isolates Virology 174,103-166[CrossRef][Medline]
28 - Tateyama, M., Oyaizu, N., McCloskey, T. W., Than, S., Pahwa, S. (2000) CD4 T lymphocytes are primed to express Fas ligand by CD4 cross-linking and to contribute to CD8 T-cell apoptosis via Fas/FasL death signaling pathway Blood 96,195-202[Abstract/Free Full Text]
29 - Marschner, S., Freiberg, B. A., Kupfer, A., Hunig, T., Finkel, T. H. (1999) Ligation of the CD4 receptor induces activation-independent down-regulation of L-selectin Proc. Natl. Acad. Sci. USA 96,9763-9768[Abstract/Free Full Text]
30 - Wang, J., Marschner, S., Finkel, T. H. (2004) CXCR4 engagement is required for HIV-1-induced L-selectin shedding Blood 103,1218-1221[Abstract/Free Full Text]
31 - Chao, D. T., Korsmeyer, S. J. (1998) BCL-2 family: regulators of cell death Annu. Rev. Immunol. 16,395-419[CrossRef][Medline]
32 - Opferman, J. T., Korsmeyer, S. J. (2003) Apoptosis in the development and maintenance of the immune system Nat. Immunol. 4,410-415[CrossRef][Medline]
33 - Boudet, F., Lecoeur, H., Gougeon, M. L. (1996) Apoptosis associated with ex vivo down-regulation of Bcl-2 and up-regulation of Fas in potential cytotoxic CD8+ T lymphocytes during HIV infection J. Immunol. 156,2282-2293[Abstract]
34 - Zaunders, J. J., Moutouh-de Parseval, L., Kitada, S., Reed, J. C., Rought, S., Genini, D., Leoni, L., Kelleher, A., Cooper, D. A., Smith, D. E., Grey, P., Estaquier, J., Little, S., Richman, D. D., Corbeil, J. (2003) Polyclonal proliferation and apoptosis of CCR5+ T lymphocytes during primary human immunodeficiency virus type 1 infection: regulation by interleukin (IL)-2, IL-15, and Bcl-2 J. Infect. Dis. 187,1735-1747[CrossRef][Medline]
35 - Petrovas, C., Mueller, Y. M., Dimitriou, I. D., Bojczuk, P. M., Mounzer, K. C., Witek, J., Altman, J. D., Katsikis, P. D. (2004) HIV-specific CD8+ T cells exhibit markedly reduced levels of Bcl-2 and Bcl-xL J. Immunol. 172,4444-4453[Abstract/Free Full Text]
36 - Janossy, G., Pinching, A. J., Bofill, M., Weber, J., McLaughlin, J. E., Ornstein, M., Ivory, K., Harris, J. R., Favrot, M., Macdonald-Burns, D. C. (1985) An immunohistological approach to persistent lymphadenopathy and its relevance to AIDS Clin. Exp. Immunol. 59,257-266[Medline]
37 - Rosenberg, Y. J., Zack, P. M., White, B. D., Papermaster, S. F., Elkins, W. R., Eddy, G. A., Lewis, M. G. (1993) Decline in the CD4+ lymphocyte population in the blood of SIV-infected macaques is not reflected in lymph nodes AIDS Res. Hum. Retroviruses 9,639-646[Medline]
38 - Dhein, J., Walczak, H., Baumler, C., Debatin, K. M., Krammer, P. H. (1995) Autocrine T-cell suicide mediated by APO-1/(Fas/CD95) Nature 373,438-441[CrossRef][Medline]
39 - Ju, S. T., Panka, D. J., Cui, H., Ettinger, R., el-Khatib, M., Sherr, D. H., Stanger, B. Z., Marshak-Rothstein, A. (1995) Fas(CD95)/FasL interactions required for programmed cell death after T-cell activation Nature 373,444-448[CrossRef][Medline]
40 - Alderson, M. R., Tough, T. W., Davis-Smith, T., Braddy, S., Falk, B., Schooley, K. A., Goodwin, R. G., Smith, C. A., Ramsdell, F., Lynch, D. H. (1995) Fas ligand mediates activation-induced cell death in human T lymphocytes J. Exp. Med. 181,71-77[Abstract/Free Full Text]
41 - Nishimura, Y., Brown, C. R., Mattapallil, J. J., Igarashi, T., Buckler-White, A., Lafont, B. A., Hirsch, V. M., Roederer, M., Martin, M. A. (2005) Resting naive CD4+ T cells are massively infected and eliminated by X4-tropic simian-human immunodeficiency viruses in macaques Proc. Natl. Acad. Sci. USA 102,8000-8005[Abstract/Free Full Text]
42 - Mattapallil, J. J., Douek, D. C., Hill, B., Nishimura, Y., Martin, M., Roederer, M. (2005) Massive infection and loss of memory CD4+ T cells in multiple tissues during acute SIV infection Nature 434,1093-1097[CrossRef][Medline]
43 - Kreisberg, J. F., Yonemoto, W., Greene, W. C. (2006) Endogenous factors enhance HIV infection of tissue naive CD4 T cells by stimulating high molecular mass APOBEC3G complex formation J. Exp. Med. 203,865-870[Abstract/Free Full Text]
44 - Ancuta, P., Autissier, P., Wurcel, A., Zaman, T., Stone, D., Gabuzda, D. (2006) CD16+ monocyte-derived macrophages activate resting T cells for HIV infection by producing CCR3 and CCR4 ligands J. Immunol. 176,5760-5771[Abstract/Free Full Text]
45 - Li, Q., Duan, L., Estes, J. D., Ma, Z. M., Rourke, T., Wang, Y., Reilly, C., Carlis, J., Miller, C. J., Haase, A. T. (2005) Peak SIV replication in resting memory CD4+ T cells depletes gut lamina propria CD4+ T cells Nature 434,1148-1152[Medline]
46 - Boirivant, M., Viora, M., Giordani, L., Luzzati, A. L., Pronio, A. M., Montesani, C., Pugliese, O. (1998) HIV-1 gp120 accelerates Fas-mediated activation-induced human lamina propria T cell apoptosis J. Clin. Immunol. 18,39-47[CrossRef][Medline]
47 - Banda, N. K., Bernier, J., Kurahara, D. K., Kurrle, R., Haigwood, N., Sekaly, R. P., Finkel, T. H. (1992) Crosslinking CD4 by human immunodeficiency virus gp120 primes T cells for activation-induced apoptosis J. Exp. Med. 176,1099-1106[Abstract/Free Full Text]
48 - Oyaizu, N., McCloskey, T. W., Coronesi, M., Chirmule, N., Kalyanaraman, V. S., Pahwa, S. (1993) Accelerated apoptosis in peripheral blood mononuclear cells (PBMCs) from human immunodeficiency virus type-1 infected patients and in CD4 cross-linked PBMCs from normal individuals Blood 82,3392-3400[Abstract/Free Full Text]
49 - Oyaizu, N., McCloskey, T. W., Than, S., Hu, R., Kalyanaraman, V. S., Pahwa, S. (1994) Cross-linking of CD4 molecules upregulates Fas antigen expression in lymphocytes by inducing interferon-
and tumor necrosis factor-
secretion Blood 84,2622-2631[Abstract/Free Full Text] 50 - Yang, Y., Mercep, M., Ware, C. F., Ashwell, J. D. (1995) Fas and activation-induced Fas ligand mediate apoptosis of T cell hybridomas: inhibition of Fas ligand expression by retinoic acid and glucocorticoids J. Exp. Med. 181,1673-1682[Abstract/Free Full Text]
51 - Badley, A. D., McElhinny, J. A., Leibson, P. J., Lynch, D. H., Alderson, M. R., Paya, C. V. (1996) Upregulation of Fas ligand expression by human immunodeficiency virus in human macrophages mediates apoptosis of uninfected T lymphocytes J. Virol. 70,199-206[Abstract/Free Full Text]
52 - Kiener, P. A., Davis, P. M., Starling, G. C., Mehlin, C., Klebanoff, S. J., Ledbetter, J. A., Liles, W. C. (1997) Differential induction of apoptosis by Fas-Fas ligand interactions in human monocytes and macrophages J. Exp. Med. 185,1511-1516[Abstract/Free Full Text]
53 - Algeciras, A., Dockrell, D. H., Lynch, D. H., Paya, C. V. (1998) CD4 regulates susceptibility to Fas ligand- and tumor necrosis factor-mediated apoptosis J. Exp. Med. 187,711-720[Abstract/Free Full Text]
54 - Hosaka, N., Oyaizu, N., Kaplan, M. H., Yagita, H., Pahwa, S. (1998) Membrane and soluble forms of Fas (CD95) and Fas ligand in peripheral blood mononuclear cells and in plasma from human immunodeficiency virus-infected persons J. Infect. Dis. 178,1030-1039[Medline]
55 - McGuirk, P., Mills, K. H. (2002) Pathogen-specific regulatory T cells provoke a shift in the Th1/Th2 paradigm in immunity to infectious diseases Trends Immunol. 23,450-455[CrossRef][Medline]
56 - Ford, W. L., Gowans, J. L. (1969) The traffic of lymphocytes Semin. Hematol. 6,67-83[Medline]
57 - Mangkornkanok-Mark, M., Mark, A. S., Dong, J. (1984) Immunoperoxidase evaluation of lymph nodes from acquired immune deficieny patients Clin. Exp. Immunol. 55,581-586[Medline]
58 - Davis, I. C., Girard, M., Fultz, P. N. (1998) Loss of CD4+ T cells in human immunodeficiency virus type 1-infected chimpanzees is associated with increased lymphocyte apoptosis J. Virol. 72,4623-4632[Abstract/Free Full Text]
59 - Groux, H., Torpier, G., Monte, D., Mouton, Y., Capron, A., Ameisen, J. C. (1992) Activation-induced death by apoptosis in CD4+ T cells from human immunodeficiency virus-infected asymptomatic individuals J. Exp. Med. 175,331-340[Abstract/Free Full Text]
60 - Gougeon, M. L., Laurent-Crawford, A. G., Hovanessian, A. G., Montagnier, L. (1993) Direct and indirect mechanisms mediating apoptosis during HIV infection: contribution to in vivo CD4 T cell depletion Semin. Immunol. 5,187-194[CrossRef][Medline]
61 - Dockrell, D. H., Badley, A. D., Villacian, J. S., Heppelmann, C. J., Algeciras, A., Ziesmer, S., Yagita, H., Lynch, D. H., Roche, P. C., Leibson, P. J., Paya, C. V. (1998) The expression of Fas ligand by macrophages and its upregulation by human immunodeficiency virus infection J. Clin. Invest. 101,2394-2405[Medline]
62 - Andrieu, J. M., Lu, W., Levy, R. (1995) Sustained increases in CD4 cell count in asymptomatic HIV-1-seropositive patients treated with prednisolon for 1 year J. Infect. Dis. 171,523-530[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
P. Clarke, J. D. Beckham, J. S. Leser, C. C. Hoyt, and K. L. Tyler
Fas-Mediated Apoptotic Signaling in the Mouse Brain following Reovirus Infection
J. Virol.,
June 15, 2009;
83(12):
6161 - 6170.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Ji and M. W. Cloyd
HIV-1 binding to CD4 on CD4+CD25+ regulatory T cells enhances their suppressive function and induces them to home to, and accumulate in, peripheral and mucosal lymphoid tissues: an additional mechanism of immunosuppression
Int. Immunol.,
March 1, 2009;
21(3):
283 - 294.
[Abstract]
[Full Text]
[PDF]
|
 |
|