science pharmaceutical expo biotech jobs
Originally published online as doi:10.1189/jlb.1105692 on October 6, 2006

Published online before print October 6, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.1105692v1
81/1/284    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nan, X.
Right arrow Articles by Stamatos, N. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nan, X.
Right arrow Articles by Stamatos, N. M.
(Journal of Leukocyte Biology. 2007;81:284-296.)
© 2007 by Society for Leukocyte Biology

Sialidase expression in activated human T lymphocytes influences production of IFN-{gamma}

Xinli Nan*, Ivan Carubelli* and Nicholas M. Stamatos*,{dagger},1

* Institute of Human Virology, University of Maryland, Baltimore, Maryland, USA; and
{dagger} Division of Infectious Diseases, Department of Medicine, University of Maryland Medical Center, Baltimore, Maryland, USA

1Correspondence: Institute of Human Virology, University of Maryland Medical System, 725 West Lombard Street, Baltimore, MD 21201, USA. E-mail: stamatos{at}umbi.umd.edu


arrow
ABSTRACT
 
Sialidases influence cellular activity by removing terminal sialic acid from glycoproteins and glycolipids. Four genetically distinct sialidases (Neu1–4) have been identified in mammalian cells. In this study, we demonstrate that only lysosomal Neu1 and plasma membrane-associated Neu3 are detected in freshly isolated and activated human T lymphocytes. Activation of lymphocytes by exposure to anti-CD3 and anti-CD28 IgG resulted in a ninefold increase in Neu1-specific activity after growth of cells in culture for 5 days. In contrast, the activity of Neu3 changed minimally in activated lymphocytes. The increase in Neu1 enzyme activity correlated with increased synthesis of Neu1-specific mRNA. Neu1 was present on the surface of freshly isolated and activated CD4 and CD8 T lymphocytes, as determined by staining intact cells with anti-Neu1 IgG and analysis by flow cytometry and by Western blot analysis of biotin-labeled cell surface proteins. Cell surface Neu1 was found tightly associated with a subunit of protective protein/cathepsin A (PPCA). Compared with freshly isolated lymphocytes, activated cells expressed more surface binding sites for galactose-recognizing lectins Erythrina cristagalli (ECA) and Arachis hypogaea. Growth of cells in the presence of sialidase inhibitors 2,3-dehydro-2-deoxy-N-acetylneuraminic acid or 4-guanidino-2-deoxy-2,3-dehydro-N-acetylneuraminic acid resulted in a smaller increase in number of ECA-binding sites and a greater amount of cell surface sialic acid in activated cells. Inhibition of sialidase activity also resulted in reduced expression of IFN-{gamma} in activated cells. The down-regulation of IFN-{gamma} occurred at the transcriptional level. Thus, sialidase activity in activated T lymphocytes contributes to the hyposialylation of specific cell surface glycoconjugates and to the production of IFN-{gamma}.

Key Words: activation • sialic acid • cytokines


arrow
INTRODUCTION
 
Sialic acid is present on glycoproteins and glycolipids that are distributed widely throughout nature. It imparts great structural and functional diversity to these glycoconjugates given its capacity for numerous modifications and different glycosidic linkages (reviewed in ref. [1 ]). Modulation of the sialic acid content on the surface of diverse types of cells influences the interaction with ligands, microbes, and neighboring cells [2 3 4 5 6 7 8 9 10 11 12 13 14 ] as well as events in cellular activation, differentiation, and transformation [15 16 17 18 ]. The functional activity of cells comprising the immune system is influenced greatly by removal of terminal sialic acid moieties from cell surface glycoconjugates [5 , 12 , 13 , 19 20 21 22 23 ]. These changes in cell activity may be attributable to unmasking of ligand-binding sites with subsequent increase in binding affinity [3 ], lowering of the cellular activation threshold [24 ], or removal of inhibitory signals [4 , 23 ].

Sialidases are enzymes that influence cellular activity by removing terminal sialic acid residues from glycolipids and glycoproteins. Four genetically distinct forms of mammalian sialidase have been characterized, each with a predominant cellular localization (lysosomal, cytosolic, or plasma membrane-associated) and substrate specificity [25 26 27 28 29 30 31 32 33 ]. Lysosomal sialidase (Neu1) has a catabolic role in desialylating glycoproteins and glycolipids in lysosomes [34 ] but is also present in extralysosomal locations at the periphery of activated lymphocytes [35 ]. Neu3 is associated with the plasma membrane [29 , 30 ] and by preferentially desialylating gangliosides, is believed to have a regulatory role in cellular activation, differentiation, and transformation [15 16 17 18 ]. The cytosolic sialidase (Neu2) can desialylate glycoproteins and gangliosides [28 ] and appears to have a role in myoblast differentiation [36 ]. The function of the recently characterized Neu4 sialidase has not been established [31 32 33 , 37 ].

Endogenous sialidase activity increases in cells of the immune system during cell activation [13 , 20 , 38 39 40 41 42 ] or differentiation [43 ]. In one study, the expression of Neu1 and Neu3 was shown to be up-regulated in activated, unfractionated human lymphocytes [40 ]. In contrast, other investigators reported that activated murine CD8 lymphocytes expressed increased amounts of only Neu3 [44 ]. Although specific immune functions of Neu1 and Neu3 in human cells remain to be determined, Neu1 activity in activated murine lymphocytes was associated with increased production of IL-4 but had no effect on the production of Th1 cytokines IL-2 or IFN-{gamma} [20 ]. Desialylation of gangliosides GM1 and/or GM3 by Neu1 was postulated as an early event in the signaling pathway leading to IL-4 production [20 , 45 ]. Neu1 and Neu3 are also expressed in monocytes during differentiation into macrophages, and the activity of Neu1 was specifically up-regulated [43 ]. As desialylation of monocytes by exogenous neuraminidase activated the ERK1/2 and p38 MAPK signaling pathways and led to increased production of IL-6, IL-1ß, MIP-1{alpha}, and MIP-1ß [21 , 46 ], it is possible that Neu1 and/or Neu3 activities in differentiating monocytes are involved in these processes.

Multiple approaches have been used to study the role of endogenous sialidase activity in cell function [17 , 20 , 22 , 45 , 47 ]. The association of Neu1 with IL-4 production was established in lymphocytes from the SM/J mouse strain, which is partially deficient in Neu1 [20 , 48 ]. Silencing the expression of Neu3 with small interfering RNAs showed the importance of this enzyme in the development of the generating growth cone of neurons [47 ]. Polyclonal antibodies prepared against Clostridium perfringens neuraminidase inhibited in vivo the transendothelial migration of neutrophils into the bronchoalveolar compartment of mice intranasally challenged with IL-8 [22 ]. Chemical sialidase inhibitors, such as the sialic acid analogue 2,3-dehydro-2-deoxy-N-acetylneuraminic acid (DANA), have also been used to reverse the changes in cell activity that are associated with the action of sialidases [17 , 20 ]. 4-Guanidino-2-deoxy-2,3-dehydro-N-acetylneuraminic acid (zanamivir) is another inhibitor, claimed to be specific for influenza virus neuraminidase [49 ], which is available for the prophylaxis and treatment of infection by influenza virus [50 , 51 ]. Although this compound has recently been shown to inhibit the activity of purified Neu3 sialidase as efficiently in vitro as DANA [52 ], it has not yet been used to study the role of mammalian sialidases in cells grown in culture.

In this report, we characterize the endogenous sialidase activity of freshly isolated and activated human T lymphocytes and evaluate its role in production of cytokines. In particular, we show that Neu1 and Neu3 sialidases are expressed in activated lymphocytes, that the expression of only Neu1 is specifically up-regulated, and that Neu1 is present on the surface of freshly isolated and activated CD4 and CD8 cells. Furthermore, we show that zanamivir and DANA inhibit endogenous sialidase activity of activated lymphocytes grown in culture, as evidenced by an altered sialylation pattern of cell surface proteins, and that this inhibition of sialidase activity results in reduced production of IFN-{gamma} RNA and protein.


arrow
MATERIALS AND METHODS
 
Isolation of PBMC and purification of lymphocytes
PBMC were isolated by leukophoresis of blood from HIV-1 and hepatitis B and C seronegative donors followed by centrifugation over Ficoll-Paque Plus (Amersham Biosciences, Uppsala, Sweden) gradients using standard procedures. Lymphocytes were purified from PBMC by negative selection using StemSep T cell enrichment cocktail and separation columns (Stem Cell Technologies, Vancouver, BC, Canada) as per the manufacturer’s suggested protocol. The purity of T lymphocytes exceeded 96% as determined by flow cytometry after staining cells with a PE-conjugated mAb to CD3 and isotypic control IgG (mAb from BD PharMingen, San Diego, CA). The viability of lymphocytes was greater than 98% as determined by trypan blue dye exclusion.

Culture conditions for purified lymphocytes
Freshly isolated T lymphocytes were suspended at 1 x 106 cells/ml in RPMI-1640 medium containing 10% heat-inactivated FCS (both from Gibco, Invitrogen, Carlsbad, CA) and were maintained at 3 x 106 cells/well in six-well tissue culture plates (Costar, Corning Inc., Corning, NY) at 37°C in a humidified 5% CO2 incubator. Wells of the tissue culture plates contained immobilized anti-CD3 and anti-CD28 IgG (both from Calbiochem, San Diego, CA) and were prepared by exposure to a 1 ml solution of each IgG at 1 µg/ml for 15 h at 4°C. After 48 h of culture, cells were transferred to a new plate without immobilized IgG, medium was supplemented with recombinant human (rh)IL-2 (Roche, Nutley, NJ) at 20 units/ml, and cells were harvested at the indicated times for analysis.

In experiments where endogenous sialidase activity was inhibited, freshly isolated T lymphocytes (3x106) were seeded in wells of an untreated, six-well plate in RPMI medium containing 10% FCS for 18 h in the presence or absence of 2 mM zanamivir (GlaxoSmithKline, Research Triangle Park, NC) or 1 mM DANA (Calbiochem). Cells were activated after 18 h by transferring cells and culture medium to wells of a new six-well plate that contained immobilized anti-CD3 and anti-CD28 IgG as indicated above. After 4 days in culture, medium was collected for cytokine measurements by ELISA, and cells were harvested for analysis of mRNA expression and sialic acid content.

Differentiation of purified monocytes into mature dendritic cells (DC)
DC were generated in culture from monocytes that were purified from human PBMC by negative selection using the StemSep monocyte enrichment protocol (Stem Cell Technologies). Purified monocytes were maintained at 2.5 x 106 cells/well in six-well tissue culture plates in RPMI-1640 medium containing 10% FCS and 1 mM pyruvate (Gibco, Invitrogen), 1% MEM nonessential amino acids and 50 µM 2-ME (Sigma-Aldrich, St. Louis, MO), and rhGM-CSF at 50 ng/ml and rhIL-4 at 50 ng/ml (R&D Systems, Inc., Minneapolis, MN). Immature DC were differentiated further into mature DC by addition of LPS (from Escherichia coli, Sigma-Aldrich) at 1 ng/ml to the culture medium after 4 days in culture and incubation for an additional 24 h. Cells were harvested after 5 days in culture by gentle scraping with a polyethylene cell scraper (Nalge Nunc International, Rochester, NY).

Measurement of sialidase activity
Sialidase activity of freshly isolated lymphocytes and of activated cells, which were maintained in culture for 2, 24, 48, and 120 h, was determined using the artificial substrate 2'-(4-methylumbelliferyl)-{alpha}-D-N-acetylneuraminic acid (4-MU-NANA; Sigma-Aldrich) and mixed bovine brain gangliosides (Calbiochem) as described previously [43 ]. In the assay using 4-MU-NANA, activity was measured in 5 x 106 solubilized, freshly isolated lymphocytes and in lymphocytes that were activated for 2 h. At subsequent time points, activity in 2 x 106 activated cells was measured. In the ganglioside assay, 1 x 107 cells were used to measure sialidase activity in freshly isolated cells and in lymphocytes activated for 2 h. Sialidase activity against gangliosides was also measured in 5 x 106 cells maintained in culture for 24 h and in 2 x 106 cells in culture for 48 h and 120 h after stimulation. The units of activity represent sialidase activity per milligram of protein. A unit of sialidase activity was defined as the amount of enzyme that released 1 nmole sialic acid per hour at 37°C. Protein concentration was measured by the Bradford method using a Bio-Rad protein assay kit (Bio-Rad, Hercules, CA).

The ability of zanamivir to inhibit sialidase activity in vitro was determined using enzyme from solubilized human monocyte-derived DC. Cells (2x106) were suspended in 0.20 ml solution containing 0.1% Triton X-100, 0.05 M sodium acetate, pH 4.4, and 0.1% BSA (Pentex bovine albumin fraction V, Miles Inc., Kankakee, IL) in the presence of increasing concentrations (0, 0.01, 0.1, 1, and 2 mM) of zanamivir. Exogenous 4-MU-NANA or mixed bovine brain gangliosides were not added to the reaction mixture, and thus, the free sialic acid detected in this assay is that released from cellular sialylconjugates (i.e., where activity reflects the release of sialic acid from endogenous cellular sialylconjugates). After a 60 min incubation at 37°C, the reaction mixture was microfuged 2 min at 12,000 g to remove cellular debris, and 0.02 ml of each supernatant was analyzed for sialic acid content using a Dionex DX600 chromatography system (Dionex Corporation, Sunnyvale, CA) as described previously [43 ]. One unit of sialidase activity was defined as the amount of enzyme that liberated 1 nmole sialic acid per hour at 37°C. The amount of activity measured in each sample was corrected based on protein concentration to represent activity per milligram of protein.

Characterization of cell surface and intracellular proteins
Proteins on the surface of lymphocytes were biotinylated and separated from intracellular proteins using a Pinpoint cell surface protein isolation kit (Pierce, Rockford, IL) as per the manufacturer’s suggested protocol. Biotinylated surface proteins from 1 x 107 freshly isolated or activated (Day 5) lymphocytes were collected directly in 0.20 ml SDS-PAGE gel loading buffer. The nonbiotinylated proteins (intracellular fraction) were collected in 0.50 ml lysis buffer provided in the kit. Proteins from a portion of each sample (0.03 ml from the biotinylated sample and 0.01 ml from the nonbiotinylated sample) were resolved by electrophoresis on a 10% SDS/polyacrylamide gel and electrotransferred by a semi-wet method to a Sequi-Blot polyvinyldifluoride membrane (Bio-Rad) and probed with polyclonal rabbit anti-Neu1 IgG as described previously [43 ]. Blots were also probed with 0.5 µg/ml rabbit polyclonal IgG against protective protein/ cathepsin A (PPCA) (kindly provided by Dr. Alessandra d’Azzo, St. Jude Children’s Research Hospital, Memphis, TN) and 0.15 µg/ml rabbit anti-ß actin mAb (Cell Signaling Technology, Danvers, MA).

Determination of cell surface sialic acid
Lymphocytes were washed three times in PBS, resuspended at 1 x 107 cells in PBS, pH 7.4, containing 0.5% BSA, and were incubated for 5 h at 37°C with 500 mU/ml bacterial neuraminidase (crystalline, type X, from C. perfringens, Sigma-Aldrich). The insoluble cell material was collected by centrifugation for 2 min at 10,000 g, and the sialic acid released into the supernatant was quantitated by HPLC using a Dionex as described above.

Treatment of activated lymphocytes with purified Neu1
Lymphocytes were purified from PBMC, activated by exposure to anti-CD3 and anti-CD28 IgG, and grown in culture for 4 days as described above. Cells were collected, resuspended at 1 x 107 cells in 1 ml PBS, pH 7.4, containing 0.5% BSA and in 0.15 M sodium acetate, pH 4.4, containing 0.5% BSA, and mock-treated or treated with 7.5 µg/ml of purified murine Neu1 sialidase alone or in combination with 3.0 µg/ml protective protein/cathepsin A (both enzymes were kindly provided by Dr. Alessandra d’Azzo, St. Jude Children’s Research Hospital). Cells were incubated in a CO2 incubator at 37°C for 1 h, washed three times with PBS, pH 7.4, and stained with FITC-labeled Erythrina cristagalli (ECA) and evaluated by flow cytometry as described below.

Isolation of RNA and real-time RT-PCR
Freshly isolated and activated lymphocytes were harvested at the indicated times, and total RNA was isolated using an RNeasy mini kit (Qiagen, Valencia, CA) following the protocol suggested by the manufacturer. The RNA preparation was treated with DNase I (Gibco, Invitrogen) at 37°C for 30 min to remove contaminating DNA. DNase was then removed by binding to Blue Sorb DNase affinity slurry (Clonogene, St. Petersburg, Russia). Semiquantitative, real-time RT-PCR was performed using a QuantiTect SYBR green RT-PCR kit (Qiagen, Valencia, CA) with an ABI sequence detection system (ABI Prism 5700) as described previously [43 ]. To detect gene expression of Neu1 (GenBank Accession X78687), Neu2 (GenBank Accession NM_005383), Neu3 (GenBank Accession Y18563), Neu4 (GenBank Accession NM_080741), ST3Gal III (GenBank Accession NM_174966), ST3Gal IV (GenBank Accession NM_006278), ST6Gal I (GenBank Accession NM_173216), IFN-{gamma} (GenBank Accession NM_000619), and 18S rRNA (GenBank Accession X03205), the following primers were selected using DNAsis Max software (Hitachi, Japan) and were synthesized by Qiagen (Germantown, MD): Neu1 [forward, nucleotide (nt) 854–873] 5'ATGAATGCCAGCCCTATGAG3' and (reverse, nt 983–964) 5'TCACGGGGCCTTAGTGTATC3' yielding a 130-bp product; Neu2 (forward, nt 194–213) 5'AGGTTCAGTGGCAAGCTCAG3' and (reverse, nt 320–303) 5'CCAGGGATGGCAATGAAG3' yielding a 127-bp product; Neu3 (forward, nt 1010–1028) 5'GGTCCAGTGCAGAGGTCAT3' and (reverse, nt 1154–1137) 5'TCTGCAAAGGCCAGGAAG3' yielding a 145-bp product; Neu4 (forward, nt 451–470) 5'TGCAGGACTGGGCCACATT3' and (reverse, nt 610–591) 5'CATCGCTGTAGAAGGCGAAG3' yielding a 160-bp product; ST3Gal III (forward, nt 677–696) 5'GCGTTCTTGCCAACAAGTCT3' and (reverse, nt 800–782) 5'GTGATGCGCAGTGTCGTTT3' yielding a 124-bp product; ST3Gal IV (forward, nt 301–320) 5'GCAGAGAGCAAGGCCTCTAA3' and (reverse, nt 437–418) 5'AGATCCTCACTCCCCTTGGT3' yielding a 137-bp product; ST6Gal I (forward, nt 917–937) 5'CCTCTGAATGGGAGGGTTAT3' and (reverse, nt 1053–1034) 5'TGCGTCATGATCATCGATTT3' yielding a 137-bp product; IFN-{gamma} (forward, nt 404–424) 5'TGGAGACCATCAAGGAAGACA3' and (reverse, nt 551–532) 5'TCAGCCATCACTTGGATGAG3' yielding a 148-bp product; and 18S rRNA (forward, nt 1279–1298) 5'CGGACAGGATTGACAGATTG3' and (reverse, nt 1397–1378) 5'ATGCCAGAGTCTCGTTCGTT3' yielding a 119-bp product. Primer and template concentrations were optimized to assure equal efficiency of each PCR reaction.

Semiquantitative analysis was based on the cycle number [comparative threshold cycle (CT)] at which the SYBR green fluorescent signal crossed a threshold in the log-linear range of RT-PCR, indicating the relative amount of starting template in each sample. The fold change in expression of Neu1 and Neu3 RNAs in freshly isolated lymphocytes compared with activated cells was normalized to the expression of 18S rRNA and was calculated by the equation:

Formula
The differences in expression of the sialidase and sialyltransferase genes in cells grown in the presence of inhibitors compared with control cells were similarly determined. All reactions were run in triplicate. The accuracy of each reaction was monitored by analysis of the distinct dissociation curve, expected size, and sequence of each amplicon.

Staining reagents and flow cytometry
Immunofluorescent detection of proteins on the surface of lymphocytes was determined by resuspending cells at 2 x 106 cells in 1 ml PBS containing 2% heat-inactivated human AB serum (HS; Gemini Bioproducts, Calabasas, CA) and reacting cells at 4°C for 30 min with PE-conjugated mAb to CD3, CD4, CD8, CD25, and isotypic control IgG (all mAb were from BD PharMingen). Where indicated, cells were costained with polyclonal rabbit IgG to Neu1 at 100 µg/ml or to Neu3 at 50 µg/ml. The polyclonal rabbit anti-Neu1 IgG (kindly provided by Alexei Pshezhetsky, University of Montreal, Canada) were generated by immunizing rabbits with rhNeu1 sialidase and were described elsewhere [53 ]. Rabbit polyclonal anti-Neu3 IgG were generated by immunizing rabbits with a synthetic peptide corresponding to amino acids 109–128 of the human Neu3 sialidase, as referred to previously [43 ]. Bound rabbit IgG were detected using 8 µg/ml FITC-conjugated goat anti-rabbit F(ab')2 fragment (Alexa Fluor® 488, Molecular Probes, Eugene, OR) at 4°C for 30 min. Where indicated, cells were reacted with 2 µg/ml FITC-conjugated lectins ECA or Arachis hypogaea (PNA; EY Laboratories, San Mateo, CA). ECA binds to the exposed galactose on glycoconjugates bearing a Galß1-4GlcNAc motif; PNA binds to Galß1-3GalNAc. Following incubation with antibodies or lectins, cells were washed with 2 ml PBS containing 2% HS and fixed with 1% paraformaldehyde. Cells were analyzed using a Becton Dickinson FACSCaliber (Mountain View, CA), and data were analyzed using FlowJo data analysis software (Tree Star, Ashland, OR).

Determination of cytokine levels
ELISA was used to determine cytokine levels in the medium from cells grown in the presence or absence of DANA or zanamivir using kits for IFN-{gamma}, IL-2, IL-4, and IL-10 (R&D Systems).


arrow
RESULTS
 
Activation of human lymphocytes results in increased expression of Neu1 sialidase
To determine whether activation of human lymphocytes is associated with changes in expression of the four genetically distinct sialidases (Neu1–4), lymphocytes were purified from the peripheral blood of human donors and were maintained in culture after being activated by exposure to anti-CD3 and anti-CD28 IgG. The relative amount of RNA encoding Neu1, Neu2, Neu3, and Neu4 in freshly isolated lymphocytes and in activated cells was determined by real-time RT-PCR. The amount of RNA for each sialidase was compared with the amount of RNA encoding 18S rRNA, an internal control for gene expression in freshly isolated and activated cells. RNAs encoding Neu1 and Neu3 were detected in freshly isolated lymphocytes and activated cells, but no RNAs encoding Neu2 or Neu4 were detected in either cell (data not shown). The amount of RNA encoding Neu1 relative to 18S rRNA increased 7.0 ± 0.8-fold within 2 h of cell activation (Fig. 1A , left panel), and enhanced expression continued to be detected after 5 days in culture. In contrast, the relative amount of Neu3-specific RNA increased only 2.4 ± 0.4-fold within 24 h of cell activation but returned to its level detected in freshly isolated cells 5 days after activation (Fig. 1A , right panel). At all times analyzed, the absolute amount of Neu1 RNA exceeded that of Neu3 (crossover thresholds CT during PCR for Neu1 and Neu3 RNAs in cells 24 h after activation were 24.56±0.17 and 27.30±0.12, respectively). The results were specific for each gene, as confirmed by the distinct dissociation curve, expected size, and sequence of each amplicon.


Figure 1
View larger version (15K):
[in this window]
[in a new window]

 
Figure 1. Activation of lymphocytes is associated with increased expression of endogenous sialidase. Lymphocytes were purified from the peripheral blood of human donors, activated, and maintained in culture as described in Materials and Methods. (A) Total RNA was purified from freshly isolated lymphocytes (0 h) and from cells after 2, 24, 48, and 120 h following activation, and the amount of mRNA encoding Neu1 (left panel) and Neu3 (right panel) relative to the amount of the internal control 18S rRNA was detected by semiquantitative real-time RT-PCR as described in Materials and Methods. The expression of Neu1 and Neu3 in freshly isolated cells was set to 1, as noted by the dotted, horizontal line. (B) Sialidase activity in lymphocytes was determined immediately after isolation of lymphocytes (0 h) and after 2, 24, 48, and 120 h following activation using 4-MU-NANA (left panel) or mixed bovine gangliosides (right panel) as substrates as described in Materials and Methods. (A and B) Data represent the mean ± SEM of samples from one donor run in triplicate and are representative of data from five experiments using cells from five different donors.

To determine whether the changes in expression of Neu1 and Neu3 RNAs correlated with changes in the level of endogenous sialidase activity, the amount of sialidase activity in freshly isolated and activated lymphocytes was determined using the exogenous sialidase substrates 4-MU-NANA and mixed bovine gangliosides. These substrates are used with different efficiencies in vitro by the four genetically distinct mammalian sialidases [26 , 29 , 30 , 43 , 54 ], but as we showed previously in monocyte-derived cells, the activity detected with 4-MU-NANA and with gangliosides correlated closely with the enzymatic activity of Neu1 and Neu3, respectively [43 ]. With 4-MU-NANA as substrate, 3.9 ± 0.1 nmoles sialic acid were liberated per hour by the sialidase activity in 1 mg total protein from freshly isolated lymphocytes, with little change in the amount of activity within 2 h of cell activation (0 and 2 h, Fig. 1B , left panel). The amount of this activity against 4-MU-NANA per milligram of protein rose to 22.7 ± 0.7 units 24 h after these cells had been activated and increased further to 33.8 ± 0.1 units after cells had been maintained in culture for 5 days (Fig. 1B) . The 3.7 ± 0.4 units of sialidase activity in freshly isolated lymphocytes detected when exogenous gangliosides were used as substrate remained relatively constant following activation (Fig. 1B , right panel). The increased expression of RNA encoding Neu1 and of sialidase activity detected using 4-MU-NANA as substrate suggests that Neu1 is specifically up-regulated following activation of lymphocytes.

Neu1 is present on the surface of freshly isolated and activated lymphocytes
Lysosomal Neu1 sialidase was shown recently to localize to the periphery of PBMC, which were activated with Con A [35 ]. To determine whether activation of CD4 and CD8 human lymphocytes through the TCR resulted in translocation of lysosomal Neu1 to the outer cell surface, intact, freshly isolated and activated lymphocytes were evaluated by flow cytometry after staining with antibodies to CD25, CD4, CD8, and Neu1. Exposure of freshly isolated lymphocytes to anti-CD3 and anti-CD28 IgG resulted in activation of nearly 70% of cells within 24 h as seen by up-regulation of cell surface CD25, a marker for early lymphocyte activation (Fig. 2A and 2B , middle panels). When costained with antibodies against Neu1, most of these activated cells (CD25+) also expressed an increased amount of Neu1 on the cell surface after 24 h and 48 h of cell activation when compared with activated cells stained with preimmune rabbit IgG (Fig. 2 , A vs. B, middle and right panels). A small percentage of freshly isolated cells (12.5%) stained weakly for cell surface Neu1 (Fig. 2B , left panel), as did ~16% of cells that did not express detectable amounts of CD25 after 24 h and 48 h following exposure to anti-CD3 and anti-CD28 IgG (Fig. 2B , middle and right panels). CD4 and CD8 lymphocytes were activated by exposure to anti-CD3 and anti-CD28 IgG and growth in the above culture conditions, and between 74% and 91% of these cells expressed increased amounts of Neu1 on their surface when analyzed 24 h and 48 h after cell activation (Fig. 2C and D , middle and right panels).


Figure 2
View larger version (42K):
[in this window]
[in a new window]

 
Figure 2. Neu1 is expressed on the surface of CD4 and CD8 lymphocytes. Freshly isolated lymphocytes (0 h) and cells grown in culture for 24 h and 48 h after activation by exposure to anti-CD3 and anti-CD28 IgG were stained with PE-conjugated mAb specific for CD25 (A and B), CD4 (C), and CD8 (D) and costained with rabbit preimmune IgG (A) or anti-Neu1 IgG (B–D), followed by FITC-conjugated goat anti-rabbit IgG as described in Materials and Methods. Quadrants in the dot plot for each time-point were constructed in a manner such that the fluorescence of cells costained with relevant PE-labeled isotype control IgG and the preimmune rabbit IgG, followed by FITC-labeled anti-rabbit IgG, was contained in the lower left quadrant. The percentage of T lymphocytes expressing the relevant markers is shown. Data are derived from cells of an individual donor and are representative of data from five experiments using cells from five different donors.

To confirm the presence of Neu1 on the surface of lymphocytes, proteins on the surface of intact, freshly isolated and activated cells were biotinylated, separated from intracellular proteins by binding to immobilized Neutravidin, and analyzed by Western blot using anti-Neu1 IgG. As expected, the 44- to 46-kDa Neu1 was present in the fraction of non-biotinylated, intracellular proteins from freshly isolated and activated cells (Fig. 3A , Non-Biotinylated, Days 0 and 5). The 44- to 46-kDa Neu1 was barely detectable in the fraction of biotinylated, cell surface proteins from lymphocytes on Days 0 and 5 after a 1 h exposure of the Western blot (data not shown). In contrast, there was a prominent band that migrated at 68 kDa in the biotinylated material from freshly isolated and activated lymphocytes (Fig. 3A , Biotinylated, Days 0 and 5). As Neu1 exists in lysosomes in a multienzyme complex that contains ß-galactosidase and PPCA, a protein that protects and activates Neu1 [55 56 57 58 ], the biotinylated sample from activated lymphocytes was also probed on Western blot with antibody to PPCA. The 68 kDa protein was also detected with this antibody (Fig. 3B) , suggesting that Neu 1 on the surface of lymphocytes is tightly bound to the 20- or 32-kDa subunits of PPCA. The Western blot was also probed with an antibody against ß-actin, a protein with an intracellular location, to confirm that intracellular proteins were not biotinylated. As expected, a band was detected only in the nonbiotinylated, intracellular fraction (Fig. 3C) . Thus, these data support the results obtained with flow cytometry and show that Neu1 is present on the surface of freshly isolated and activated cells and that it is predominantly associated with a subunit of PPCA when present on the cell surface.


Figure 3
View larger version (61K):
[in this window]
[in a new window]

 
Figure 3. Neu1 is present in complex with protective protein cathepsin A (PPCA) on the surface of lymphocytes. Proteins on the surface of freshly isolated (Day 0) and activated (Day 5) lymphocytes were biotinylated, separated from intracellular proteins, and analyzed on Western blots using antibodies to Neu1 (A), PPCA (B), and ß-actin (C) as described in Materials and Methods. Proteins from a portion of each sample (0.03 ml from the 0.20 ml total volume of biotinylated material and 0.01 ml from the total volume of 0.50 ml non-biotinylated material) were committed to the respective lanes. Molecular weight markers are shown on the left of the gels. These results are representative of data from three different donors.

The expression of Neu3 on the cell surface was also determined using anti-Neu3 antibodies and flow cytometry as described above for Neu1. Neu3 was detected on the surface of freshly isolated lymphocytes, but the amount on the surface remained relatively constant following activation (data not shown). Thus, activation of CD4 and CD8 lymphocytes leads to the presence of Neu1 and Neu3 on the cell surface.

Sialidase activity during lymphocyte activation is associated with desialylation of specific glycoconjugates on the cell surface
To determine whether the sialic acid content of glycoconjugates on the surface of lymphocytes changed after lymphocyte activation, freshly isolated and activated lymphocytes were stained with FITC-labeled lectins PNA and ECA, which bind to the exposed galactose of specific, desialylated glycoconjugates, and were evaluated by flow cytometry. PNA and ECA have different binding specificities for terminal glycomoieties: PNA binds to Galß1-3GalNAc, and ECA binds to Galß1-4GlcNAc. Desialylated glycoconjugates were present on the surface of freshly isolated lymphocytes as seen by the binding of PNA and ECA to these cells (Fig. 4A and 4B , Day 0, shaded areas). The amount of these lectins bound to the cell surface increased after cell activation (Fig. 4A and 4B , Day 4, shaded areas). The median fluorescence intensity (MFI) of PNA- and ECA-stained, activated lymphocytes on Day 4 compared with freshly isolated cells (Day 0) increased from 7.31 to 87 and 111 to 854, respectively. The binding specificity of these lectins was confirmed by a reduction in binding of each lectin when cells were stained in the presence of galactose.


Figure 4
View larger version (29K):
[in this window]
[in a new window]

 
Figure 4. Changes in binding of PNA and ECA to the surface of activated T lymphocytes grown in the absence or presence of sialidase inhibitors. Freshly isolated lymphocytes (Day 0) and activated cells that were grown in culture for 4 days (Day 4) in the absence or presence of 2 mM zanamivir or 1 mM DANA were stained with FITC-conjugated lectins PNA (A) or ECA (B) and evaluated by flow cytometry as described in Materials and Methods. Thin, solid line, Unstained cells grown without inhibitors; shaded area, cells grown without inhibitors; dark, solid line, cells grown in the presence of zanamivir; dotted line, cells grown in the presence of DANA. The histograms for unstained cells grown in the presence of zanamivir or DANA overlapped the histogram of unstained, control cells and are not shown. Data shown are representative of five experiments using cells from five different donors.

To determine whether the change in surface sialylation, as demonstrated by changes in PNA and ECA binding, was at least partly a consequence of the sialidase activity in activated lymphocytes, cells were activated and maintained in culture in the presence of competitive sialidase inhibitors DANA and zanamivir. DANA inhibits a wide range of bacterial, viral, and mammalian sialidases to include Neu1 and Neu3 [17 , 20 ]. Zanamivir is a sialic acid analog, which was designed specifically to inhibit the neuraminidase from influenza virus but was shown recently to inhibit purified Neu3 in vitro [52 ]. To confirm that zanamivir could inhibit sialidases of human PBMC, sialidase activity in solubilized, mature DC (comprised mostly of Neu1 and Neu3) was measured in vitro in the presence of increasing concentrations of zanamivir using endogenous sialylconjugates as substrate. Lysates from DC were selected to determine the effectiveness of zanamivir against Neu1 and Neu3 given the large amount of sialidase activity in these cells that can be demonstrated in vitro against endogenous sialylconjugates (unpublished results). Greater than 99% of total sialidase activity against endogenous sialylconjugates was inhibited under these conditions when zanamivir was used at a concentration of 2 mM (Fig. 5 ), suggesting that zanamivir could inhibit Neu1 and Neu3 sialidases in lymphocytes grown in culture.


Figure 5
View larger version (10K):
[in this window]
[in a new window]

 
Figure 5. Zanamivir effectively inhibits endogenous sialidase activity of PBMC. Monocytes were purified from PBMC and were differentiated in vitro into DC as described in Materials and Methods. Mature DC were collected after 5 days in culture, and sialidase activity using endogenous sialylconjugates (i.e., in the absence of exogenous 4-MU-NANA or mixed bovine gangliosides) was determined in solubilized cells that were incubated with increasing concentrations of zanamivir. Sialidase activity was determined by measuring the amount of sialic acid that was released into the supernatant by HPLC on a Dionex, as described in Materials and Methods. Data represent triplicate determinations ± SEM using cells from one donor and were representative of data from three different experiments using cells from three different donors.

When cells were grown in the presence of DANA or zanamivir, the increased binding of ECA to the cell surface could be partly reversed, as evidenced by a decline in MFI of ECA binding from 854 to 604 or 428, respectively (Fig. 4B , Day 4, dotted and solid lines, respectively). In contrast, there was minimal or no change in the binding of PNA to the surface of these same cells (data not shown). The changes in binding of ECA were reflective of total changes in cell surface sialic acid on cells grown in the presence of DANA and zanamivir. When freshly isolated lymphocytes were exposed to exogenous, bacterial neuraminidase to remove accessible cell surface sialic acid, 3.2 ± 0.7 nmoles of sialic acid per mg cellular protein were released from the cell surface. The amount of removable sialic acid increased to 6.6 ± 0.4 nmoles per mg protein in activated cells and even further, to 9.0 ± 0.5 and 10.8 ± 1.3 nmoles of sialic acid in cells maintained in culture in the presence of DANA and zanamivir, respectively. DANA and zanamivir had no effect on the viability of cells in culture, as determined by staining with trypan blue or by reduction of tetrazolium in a 3-(4,5-dimethylthiazol-2-yl)-2,5-dimethyltetrazolium bromide assay (data not shown).

To confirm that the reduction in ECA-binding sites on glycoconjugates on the surface of activated lymphocytes was not the result of a down-regulation in expression of Neu1 or Neu3 sialidases and/or an up-regulation in expression of sialyltransferases (ST3Gal III, ST3Gal IV, and ST6Gal I) of cells grown in the presence of DANA and zanamivir, the relative amount of RNA encoding these enzymes in control cells and cells grown in the presence of DANA and zanamivir was determined. There was an equal or a slightly greater amount of RNA encoding Neu1 and Neu3 in relation to 18S rRNA in cells grown in the presence of DANA or zanamivir (P values ranged from 0.07 to 0.48) in comparison with control cells (Fig. 6 ). In addition, there was no significant increase in the amount of RNA encoding the three sialyltransferases, which are capable of adding sialic acid to ECA motifs on glycoconjugates (P values >0.05; Fig. 6 ). Thus, the sialidase activity of Neu1 and/or Neu3 in activated lymphocytes contributes to the hyposialylation of glycoconjugates that possess potential ECA binding sites.


Figure 6
View larger version (24K):
[in this window]
[in a new window]

 
Figure 6. Growth of T lymphocytes in the presence of sialidase inhibitors does not significantly affect the expression of RNAs encoding Neu1, Neu3, or relevant sialyltransferases. Total RNA was isolated from T lymphocytes that were activated and grown for 4 days in the absence (Control) or presence of sialidase inhibitors (Zanamivir or DANA), and the relative amount of RNA encoding each gene product under each condition was determined by semiquantitative real-time RT-PCR. Activation and growth of cells ± sialidase inhibitors, isolation of RNA, and real-time RT-PCR were performed as described in Materials and Methods. The change in expression of each gene in activated cells compared with freshly isolated cells was normalized to the expression of 18S rRNA, and the expression of each gene in control cells was set to 1, as noted by the dotted, horizontal line. Data shown represent the mean ± SEM of samples from one donor run in triplicate and are representative of data from three experiments using cells from three different donors.

To establish that a cell surface-associated Neu1 has the potential to generate ECA-binding sites by desialylating specific glycoconjugates on the cell surface, lymphocytes were exposed to an exogenous source of purified Neu1 and were then evaluated for ECA binding. When freshly isolated or activated lymphocytes were exposed at pH 7.4 to purified Neu1, alone or in combination with PPCA, a component of the lysosomal Neu1 complex that stabilizes and activates Neu1, there was no detectable change in the amount of ECA bound to the cell surface (data not shown). In contrast, when activated lymphocytes were exposed to purified Neu1 at pH 4.4, the optimum pH for Neu1 activity in vitro, there was an increase in the amount of ECA that bound to the cell surface (Fig. 7 ). The addition of PPCA to Neu1 had little effect on the amount of ECA bound to the surface of cells that were treated with Neu1 alone (Fig. 7) . There was no detectable change in ECA binding when freshly isolated cells were treated with Neu1 at pH 4.4 (data not shown). Thus, Neu1 in an acidic environment is capable of generating ECA-binding sites on the surface of activated lymphocytes by desialylating specific glycoconjugates.


Figure 7
View larger version (20K):
[in this window]
[in a new window]

 
Figure 7. Neu1 is capable of generating ECA-binding sites on the surface of activated lymphocytes by desialylating cell surface glycoconjugates. Lymphocytes were purified from PBMC, activated by exposure to anti-CD3 and anti-CD28 IgG, and grown in culture for 4 days as described in Materials and Methods. Cells were mock-treated (shaded region) or treated with 7.5 µg/ml purified murine Neu1 sialidase (solid, dark line) alone (A) or in combination with 3.0 µg/ml PPCA (B) and were stained with FITC-labeled ECA and evaluated by flow cytometry as described in Materials and Methods. Thin, solid line: unstained, Neu1-treated cells; shaded area: ECA-stained, mock-treated cells; solid, dark line: ECA-stained, NANase- or NANase/PPCA-treated cells. Data shown are representative of three experiments using cells from three different donors.

Inhibition of endogenous sialidases of activated lymphocytes reduces production of IFN-{gamma}
It has been shown previously that sialidase activity in murine lymphocytes is required for the production of IL-4 [20 ]. To determine the impact of inhibiting sialidase activity on synthesis of Th1 and Th2 cytokines in activated human lymphocytes, cells were grown in the presence of DANA or zanamivir, and the amount of specific cytokines released into the medium was measured. Under the conditions of cell activation and growth that were used, minimal or no IL-2, TNF-{alpha}, IL-4, IL-10, or IL-12 was detected in the medium of cells after 4 days in culture (data not shown). In contrast, IFN-{gamma} was robustly produced in these cells with 842 pg/ml present in the medium when measured on Day 4 after cell activation (Fig. 8A , Control). When activated lymphocytes were grown in the presence of zanamivir or DANA though, the amount of IFN-{gamma} present in the medium of cells after 4 days was reduced to 514 and 341 pg/ml, respectively (both P values <0.001). Inhibition of sialidase activity affected the production of IFN-{gamma} at the transcriptional level. In cells grown in the presence of DANA and zanamivir, the amount of RNA encoding IFN-{gamma} was reduced to 62% of its level in control cells (both P values <0.005; Fig. 8B ). These results demonstrate that removal of sialic acid from glycoconjugates on the surface of activated human lymphocytes promotes the production of the Th1 cytokine IFN-{gamma}.


Figure 8
View larger version (17K):
[in this window]
[in a new window]

 
Figure 8. Production of IFN-{gamma} is down-regulated in T lymphocytes grown in the presence of sialidase inhibitors. (A) Activated lymphocytes were grown in culture for 4 days in the absence (Control) or presence of 2 mM zanamivir or 1 mM DANA, and the amount of IFN-{gamma} present in the medium was determined by ELISA. (B) Total RNA was isolated from the cells described in A, and the relative amount of RNA encoding IFN-{gamma} under each condition was determined by semiquantitative real-time RT-PCR. Real-time RT-PCR and presentation of the data are as described in Materials and Methods. (A) Numbers over each bar represent the absolute amount of IFN-{gamma} produced in each condition. (B) Numbers over each bar represent the amount of RNA in each condition relative to control cells. Data shown in A and B represent the mean ± SEM of triplicate samples from one donor and are representative of data from five experiments using cells from five different donors.


arrow
DISCUSSION
 
We have described in this report that endogenous sialidase activity of freshly isolated human lymphocytes increases during cell activation. Much of the increased activity in activated cells is attributed to Neu1, some of which is present on the surface of CD4 and CD8 T lymphocytes. The expression of RNA encoding Neu1 was up-regulated rapidly within 2 h of cell activation and remained elevated for at least 5 days. In contrast, the synthesis of RNA encoding plasma membrane-associated Neu3 remained relatively unchanged throughout the 5 day culture period, and no RNA encoding Neu2 or Neu4 was detected in freshly isolated or activated cells. The amount of Neu3 enzymatic activity that was detected using mixed bovine gangliosides changed minimally in activated lymphocytes, consistent with the pattern of Neu3-specific RNA synthesis. Neu1 enzymatic activity detected with 4-MU-NANA was up-regulated in activated cells, as was the expression of Neu1-specific RNA, but the rise in Neu1 activity lagged behind the rapid increase in synthesis of RNA encoding Neu1. This temporal discordance between RNA synthesis and enzymatic activity of Neu1 may be the result of several factors. Neu1 exists in lysosomes in a multienzyme complex that contains ß-galactosidase and PPCA, a protein that protects and activates Neu1 [55 56 57 58 ]. Factors that regulate the ability of Neu1 to associate with PPCA (e.g., changes in expression of PPCA in activated lymphocytes) may influence the rate that Neu1 activity changes in activated lymphocytes. In addition, Neu1 has several potential glycosylation sites and is phosphorylated in activated lymphocytes [35 ]. It is possible that the enzymatic activity of Neu1 is influenced by the rate and extent of these post-translational modifications.

Our findings differ quantitatively from a previous report that described a two- to threefold increase in Neu1 and Neu3 in human lymphocytes stimulated with anti-CD3 and anti-CD28 IgG [40 ]. The difference in results may be related to the cyclic cell stimulation protocol used in that study. A conflicting pattern of Neu1 expression was detected in murine splenic CD8 lymphocytes in which Neu1 RNA expression declined fourfold when measured 72 h after stimulation with anti-CD3 IgG [44 ]. Although human and murine sialidases are presumed to have similar functions, this discrepancy may be related to differences between species or in conditions for activating and culturing cells (i.e., exogenous IL-4 was added to the medium of murine cells). It is of note that the expression of Neu1 is up-regulated in monocytes as they differentiate into macrophages [43 ] and DC (unpublished results).

Neu1 sialidase is present in lysosomes, where it catabolizes glycoproteins and glycolipids. Yet, the function of Neu1 in influencing production of IL-4 in mice by desialylating cell surface gangliosides suggested that it might also be present on the cell surface [20 ]. A previous study used confocal immunofluorescent microscopy to show that Neu1 localized to the cell periphery in Con A-stimulated PBMC [35 ], but microscopy was performed on cells that had been permeabilized prior to staining with anti-Neu1 Ig. Thus, localization on the outer cell surface was not shown convincingly. A recent study, though, using immunofluorescent microscopy of intact human aortic smooth muscle cells demonstrated the presence of Neu1 on the outer cell surface [59 ]. We show in our report that Neu1 is present on the surface of intact CD4 and CD8 lymphocytes using anti-Neu1 IgG and flow cytometry. Although the intensity of staining with anti-Neu1 IgG increases in activated cells, Neu1 appears also to be present on the surface of unactivated CD25neg cells. The MFI of unactivated cells stained with anti-Neu1 IgG is slightly greater than the MFI of these cells stained with preimmune IgG (Fig. 2A and 2B , left and middle panels), and thus, the minor shift in intensity of staining in our analysis does not make it possible to determine whether all freshly isolated lymphocytes express Neu1 on the cell surface. Using biotin to label proteins on the surface of intact cells and to separate them from intracellular proteins, we show that Neu1 is clearly present on the surface of freshly isolated and activated lymphocytes. There was a clear, qualitative difference between Neu1 on the cell surface and intracellular Neu1; namely, surface Neu1 was tightly associated with the 20- or 32-kDa subunit of PPCA. It is of note that we did not detect PPCA on the surface of intact, freshly isolated, or activated lymphocytes using anti-PPCA polyclonal IgG and flow cytometry (unpublished results), suggesting that the epitope(s) recognized by the IgG are not readily accessible on the surface of intact cells or that the IgG recognize only denatured, linear epitopes. The mechanism for Neu1 translocation to the cell surface has not been established, although phosphorylation of the carboxyl terminus in activated cells appears to be involved [35 ]. It remains to be determined whether a larger proportion of total cellular Neu1 is present on the surface of activated versus resting lymphocytes, implying a specific mechanism for translocation.

An important question raised by our results is whether cell surface Neu1 actively desialylates cell surface glycoconjugates. We show in this report that exogenous, purified Neu1 is capable of removing sialic acid from glycoconjugates on the surface of activated lymphocytes at pH 4.4 but not at pH 7.4. In addition, we have not been able to detect sialidase activity in vitro in activated lymphocytes or even in DC, which express greater amounts of sialidase activity, when tested at pH 7.4 using 4-MU-NANA as substrate (unpublished data). This does not preclude Neu1 activity at the cell surface though. It is possible that lysosomal Neu1 may travel to the cell surface in endocytic vesicles that fuse with the cell membrane and release acidic contents into an extracellular microenvironment. Thus, there may be a transient acidic pocket in which Neu1 could be active. Alternatively, there may be factors yet to be described that change the pH requirements for Neu1 on the cell surface (e.g., association with other proteins). Plasma membrane-associated Neu3 also has an acidic pH optimum when assayed in vitro, but it has been shown to desialylate gangliosides on the surface of neighboring cells, presumably in a neutral pH extracellular milieu [60 ]. It is also possible that the activity of Neu1 may occur at intracellular sites for proteins and gangliosides that are targeted to the cell surface. If Neu1 is functionally active on the cell surface, it is possible that the two sialidases (Neu1 and Neu3), likely with differing substrate specificities, work in concert to modulate the sialic acid content of cell surface and extracellular glycoconjugates.

Changes in the sialic acid content of cell surface proteins during lymphocyte activation have been demonstrated using lectins that recognize terminal galactose moieties of glycoconjugates [39 , 44 ]. Consistent with these reports, we show that the number of binding sites for PNA (Galß1-3GalNAc) and ECA (Galß1-4GlcNAc) increases on the surface of activated lymphocytes. The increase in PNA- and ECA-binding sites in activated cells compared with resting lymphocytes is likely not all attributable to sialidase activity but may be partly related to down-regulation in sialyltransferase activity. Indeed, others have shown that increased binding of PNA to the surface of activated CD8 T lymphocytes, a result of hyposialylation of CD45, was related to down-regulation of sialyltransferase ST3Gal I, rather than to up-regulation of sialidases [44 ]. This conclusion was based partly on the lack of effect of DANA on PNA binding in those cells. We also found in our study that growth of activated lymphocytes in the presence of DANA has little effect on the amount of PNA bound to cells. In contrast, the amount of ECA bound to these cells was reduced significantly. Thus, sialidase activity likely contributes to the hyposialylation of an increased number of glycoconjugates that contain the ECA motif in activated lymphocytes. It is to be noted that the ECA- and PNA-binding sites comprise only a portion of the total potential cell surface sialylation sites, and thus, what occurs at these sites may not represent global changes in sialylation on the cell surface. Indeed, we show in this report that the total amount of cell surface sialic acid increases during activation of lymphocytes.

DANA is an effective inhibitor of a broad range of sialidases and has been shown to alter the activity of lymphocytes and other cells in culture [17 , 20 ]. Conversely, zanamivir was designed to inhibit specifically influenza virus neuraminidases and was shown initially to be a poor inhibitor of mammalian sialidases [49 ]. We demonstrate in this report that zanamivir is indeed an effective inhibitor in vivo of sialidase activity of human lymphocytes. In fact, zanamivir was as effective as DANA in reversing the hyposialylation of cell surface glycoconjugates containing the ECA motif and in increasing the total amount of cell surface sialic acid in activated lymphocytes. This finding in vivo is supported by a recent report that showed that zanamivir was as active as DANA in inhibiting the in vitro activity of Neu3 sialidase, which was purified from human neurons [52 ] and by our demonstration in this report that zanamivir efficiently inhibits the endogenous sialidase activity (Neu1 and Neu3) from DC when assayed against endogenous sialylconjugates. The prior demonstration that zanamivir was a relatively ineffective inhibitor of mammalian sialidases compared with DANA was likely attributable to use of the artificial substrate 4-MU-NANA rather than the more physiologic, endogenous sialyconjugates that we used. Changes in sialic acid content of glycoconjugates containing the ECA-binding motif can be mediated by sialidases or by the ST3Gal III, ST3Gal IV, and ST6Gal I sialyltransferases [61 , 62 ]. The specificity of each sialidase inhibitor used in culture with lymphocytes in our study was supported by the insignificant differences in the change of expression of Neu1 and Neu3 and of the relevant sialyltransferase genes when cells were grown in the absence or presence of inhibitor.

Lymphocytes respond to diverse extracellular stimuli by producing specific cytokines to potentiate immune activities. The proinflammatory cytokine IFN-{gamma} is produced by activated Th1 lymphocytes and has antimicrobial, antiproliferative, and immunomodulatory effects [63 ]. The conditions for cell activation and growth used in our studies led to brisk IFN-{gamma} production but only minimal expression of other Th1 (IL-2, IL-12) or Th2 (IL-4, IL-10) cytokines. Inhibition of sialidase activity resulted in a significant reduction in synthesis of IFN-{gamma}. The minor amount of other cytokines produced by activated lymphocytes made it difficult to determine whether sialidase activity also affected their production. In other studies in murine lymphocytes, sialidase activity and desialylation of cell surface glycoconjugates have been implicated in the production of IL-4 [20 , 45 ] and of Th1 and Th2 cytokines [64 ]. In each of these studies, though, factors in addition to sialidase activity may have contributed to cytokine production. The role of Neu1 in production of IL-4 was demonstrated in lymphocytes that were purified from Neu1-deficient SM/J mice [20 ]. However, these cells retain ~30% residual Neu1 activity [48 ], thus raising the possibility that the reduced production of IL-4 was related to other genetic features of these mice. In the second study, murine lymphocytes produced Th1 and Th2 cytokines when exposed in a mixed cell reaction to the viral neuraminidase in influenza virus-infected DC [64 ]. In this system, lymphocyte-DC interactions and the action of an exogenous viral neuraminidase activity likely influenced the ultimate cytokine profile. Thus, in contrast to these reports, our results demonstrate directly in human lymphocytes that endogenous sialidase activity (Neu1 and/or Neu3) promotes the production of IFN-{gamma}, most likely by modulating the content of cell surface sialic acid.

Sialylated gangliosides on the surface of murine lymphocytes are involved in the regulation of intracellular signaling pathways and thus, help regulate the production of specific cytokines [65 , 66 ]. The involvement of Neu1 in desialylation of gangliosides was previously suggested to be related to the production of IL-4 in murine lymphocytes [20 , 45 ]. Although the up-regulation of Neu1 in activated lymphocytes suggests a role in desialylation of glycoconjugates and in cytokine production, Neu3, which is present on the cell surface in lipid rafts [67 , 68 ], preferentially desialylates gangliosides. The expression of Neu3 does not change significantly during lymphocyte activation as evidenced by the in vitro sialidase assay, but its functional activity in vivo may be modulated by interactions with other regulatory molecules. Thus, Neu1 and Neu3 have the potential to desialylate cell surface gangliosides and consequently, to activate intracellular signaling pathways, such as JAK-STAT, which mediate induction of IFN-{gamma} [63 ]. Neu1 and Neu3 sialidases may also activate intracellular signaling, which leads to cytokine production, by desialylating cell surface glycoproteins, such as TCR, CD4, CD8, CD43, CD45, IFN-{gamma} receptor, and ligands for siglecs [3 , 4 , 23 , 24 ]. Future experiments using lymphocytes from individuals with genetic lysosomal storage disorders of sialidosis (primary deficiency of Neu1) and galactosialidosis (secondary Neu1 deficiency resulting from defective PPCA) may help establish the specific substrates for Neu1 and Neu3 and the contribution of each enzyme to the production of IFN-{gamma}.

In addition to influencing the production of IFN-{gamma}, Neu1 and/or Neu3 sialidases may play a role in some of the other immune functions of human lymphocytes. This prospect raises the possibility that inhibition of the activity of cellular sialidases with anti-sialidase antibodies or pharmacologic inhibitors may have therapeutic value in treating inflammation and infection. It should be noted though that sialidases act in a cellular milieu in which sialic acid is continuously being added back to glycoconjugates by sialyltransferases. Thus, sialyltransferases may compete with or complement the action of sialidases to remodel cell surface glycoconjugates. Establishing the role of human sialidases during activation of lymphocytes clearly presents great challenges.


arrow
ACKNOWLEDGEMENTS
 
This work was supported in part by National Institutes of Health Grant K08 HL72176-01 to N. M. S. and by institutional funds provided by Drs. Redfield and Gallo at the Institute of Human Virology. We thank Lai-Xi Wang for quantitation of sialic acid content by Dionex HPLC in several experiments.

Received November 27, 2005; revised August 30, 2006; accepted September 11, 2006.


arrow
REFERENCES
 
    1
  1. Schauer, R. (2004) Sialic acids: fascinating sugars in higher animals and man Zoology 107,49-64
  2. 2
  3. Moody, A. M., North, S. J., Reinhold, B., Van Dyken, S. J., Rogers, M. E., Panico, M., Dell, A., Morris, H. R., Marth, J. D., Reinherz, E. L. (2003) Sialic acid capping of CD8ß core 1-O-glycans controls thymocyte-major histocompatibility complex class I interaction J. Biol. Chem. 278,7240-7246[Abstract/Free Full Text]
  4. 3
  5. Pappu, B. P., Shrikant, P. A. (2004) Alteration of cell surface sialylation regulates antigen-induced naive CD8+ T cell responses J. Immunol. 173,275-284[Abstract/Free Full Text]
  6. 4
  7. Ikehara, Y., Ikehara, S. K., Paulson, J. C. (2004) Negative regulation of T cell receptor signaling by Siglec-7 (p70/AIRM) and Siglec-9 J. Biol. Chem. 279,43117-43125[Abstract/Free Full Text]
  8. 5
  9. Bagriacik, E. U., Miller, K. S. (1999) Cell surface sialic acid and the regulation of immune cell interactions: the neuraminidase effect reconsidered Glycobiology 9,267-275[Abstract/Free Full Text]
  10. 6
  11. Hayes, G. R., Lockwood, D. H. (1986) The role of cell surface sialic acid in insulin receptor function and insulin action J. Biol. Chem. 261,2791-2798[Abstract/Free Full Text]
  12. 7
  13. Stamatos, N. M., Gomatos, P. J., Cox, J., Fowler, A., Dow, N., Wohlhieter, J. A., Cross, A. S. (1997) Desialylation of peripheral blood mononuclear cells promotes growth of HIV-1 Virology 228,123-131[CrossRef][Medline]
  14. 8
  15. Iorio, R. M., Field, G. M., Sauvron, J. M., Mirza, A. M., Deng, R., Mahon, P. J., Langedijk, J. P. (2001) Structural and functional relationship between the receptor recognition and neuraminidase activities of the Newcastle disease virus hemagglutinin-neuraminidase protein: receptor recognition is dependent on neuraminidase activity J. Virol. 75,1918-1927[Abstract/Free Full Text]
  16. 9
  17. Matsui, S., Okuno, T., Shiraki, K. (1994) Functional roles of terminal glycomoieties in varicella-zoster virus infection Virology 198,50-58[CrossRef][Medline]
  18. 10
  19. Ming, M., Chuenkova, M., Ortega-Barria, E., Pereira, M. E. (1993) Mediation of Trypanosoma cruzi invasion by sialic acid on the host cell and trans-sialidase on the trypanosome Mol. Biochem. Parasitol. 59,243-252[CrossRef][Medline]
  20. 11
  21. Ohuchi, M., Feldmann, A., Ohuchi, R., Klenk, H. D. (1995) Neuraminidase is essential for fowl plague virus hemagglutinin to show hemagglutinating activity Virology 212,77-83[CrossRef][Medline]
  22. 12
  23. Boog, C. J., Neefjes, J. J., Boes, J., Ploegh, H. L., Melief, C. J. (1989) Specific immune responses restored by alteration in carbohydrate chains of surface molecules on antigen-presenting cells Eur. J. Immunol. 19,537-542[Medline]
  24. 13
  25. Taira, S., Nariuchi, H. (1988) Possible role of neuraminidase in activated T cells in the recognition of allogeneic Ia J. Immunol. 141,440-446[Abstract]
  26. 14
  27. Fanales-Belasio, E., Zambruno, G., Cavani, A., Girolomoni, G. (1997) Antibodies against sialophorin (CD43) enhance the capacity of dendritic cells to cluster and activate T lymphocytes J. Immunol. 159,2203-2211[Abstract/Free Full Text]
  28. 15
  29. Wu, G., Ledeen, R. W. (1991) Stimulation of neurite outgrowth in neuroblastoma cells by neuraminidase: putative role of GM1 ganglioside in differentiation J. Neurochem. 56,95-104[CrossRef][Medline]
  30. 16
  31. Hasegawa, T., Yamaguchi, K., Wada, T., Takeda, A., Itoyama, Y., Miyagi, T. (2000) Molecular cloning of mouse ganglioside sialidase and its increased expression in Neuro2a cell differentiation J. Biol. Chem. 275,8007-8015[Abstract/Free Full Text]
  32. 17
  33. Kopitz, J., Muhl, C., Ehemann, V., Lehmann, C., Cantz, M. (1997) Effects of cell surface ganglioside sialidase inhibition on growth control and differentiation of human neuroblastoma cells Eur. J. Cell Biol. 73,1-9[Medline]
  34. 18
  35. Kakugawa, Y., Wada, T., Yamaguchi, K., Yamanami, H., Ouchi, K., Sato, I., Miyagi, T. (2002) Up-regulation of plasma membrane-associated ganglioside sialidase (Neu3) in human colon cancer and its involvement in apoptosis suppression Proc. Natl. Acad. Sci. USA 99,10718-10723[Abstract/Free Full Text]
  36. 19
  37. Sorice, M., Longo, A., Garofalo, T., Mattei, V., Misasi, R., Pavan, A. (2004) Role of GM3-enriched microdomains in signal transduction regulation in T lymphocytes Glycoconj. J. 20,63-70[Medline]
  38. 20
  39. Chen, X. P., Enioutina, E. Y., Daynes, R. A. (1997) The control of IL-4 gene expression in activated murine T lymphocytes: a novel role for neu-1 sialidase J. Immunol. 158,3070-3080[Abstract]
  40. 21
  41. Stamatos, N. M., Curreli, S., Zella, D., Cross, A. S. (2004) Desialylation of glycoconjugates on the surface of monocytes activates the extracellular signal-related kinases ERK 1/2 and results in enhanced production of specific cytokines J. Leukoc. Biol. 75,307-313[Abstract/Free Full Text]
  42. 22
  43. Cross, A. S., Sakarya, S., Rifat, S., Held, T. K., Drysdale, B. E., Grange, P. A., Cassels, F. J., Wang, L. X., Stamatos, N., Farese, A., Casey, D., Powell, J., Bhattacharjee, A. K., Kleinberg, M., Goldblum, S. E. (2003) Recruitment of murine neutrophils in vivo through endogenous sialidase activity J. Biol. Chem. 278,4112-4120[Abstract/Free Full Text]
  44. 23
  45. Crocker, P. R., Varki, A. (2001) Siglecs in the immune system Immunology 103,137-145[CrossRef][Medline]
  46. 24
  47. Merry, A. H., Gilbert, R. J., Shore, D. A., Royle, L., Miroshnychenko, O., Vuong, M., Wormald, M. R., Harvey, D. J., Dwek, R. A., Classon, B. J., Rudd, P. M., Davis, S. J. (2003) O-glycan sialylation and the structure of the stalk-like region of the T cell co-receptor CD8 J. Biol. Chem. 278,27119-27128[Abstract/Free Full Text]
  48. 25
  49. Pshezhetsky, A. V., Richard, C., Michaud, L., Igdoura, S., Wang, S., Elsliger, M. A., Qu, J., Leclerc, D., Gravel, R., Dallaire, L., Potier, M. (1997) Cloning, expression and chromosomal mapping of human lysosomal sialidase and characterization of mutations in sialidosis Nat. Genet. 15,316-320[CrossRef][Medline]
  50. 26
  51. Milner, C. M., Smith, S. V., Carrillo, M. B., Taylor, G. L., Hollinshead, M., Campbell, R. D. (1997) Identification of a sialidase encoded in the human major histocompatibility complex J. Biol. Chem. 272,4549-4558[Abstract/Free Full Text]
  52. 27
  53. Miyagi, T., Konno, K., Emori, Y., Kawasaki, H., Suzuki, K., Yasui, A., Tsuik, S. (1993) Molecular cloning and expression of cDNA encoding rat skeletal muscle cytosolic sialidase J. Biol. Chem. 268,26435-26440[Abstract/Free Full Text]
  54. 28
  55. Tringali, C., Papini, N., Fusi, P., Croci, G., Borsani, G., Preti, A., Tortora, P., Tettamanti, G., Venerando, B., Monti, E. (2004) Properties of recombinant human cytosolic sialidase HsNEU2. The enzyme hydrolyzes monomerically dispersed GM1 ganglioside molecules J. Biol. Chem. 279,3169-3179[Abstract/Free Full Text]
  56. 29
  57. Monti, E., Bassi, M. T., Papini, N., Riboni, M., Manzoni, M., Venerando, B., Croci, G., Preti, A., Ballabio, A., Tettamanti, G., Borsani, G. (2000) Identification and expression of NEU3, a novel human sialidase associated to the plasma membrane Biochem. J. 349,343-351[CrossRef][Medline]
  58. 30
  59. Miyagi, T., Wada, T., Iwamatsu, A., Hata, K., Yoshikawa, Y., Tokuyama, S., Sawada, M. (1999) Molecular cloning and characterization of a plasma membrane-associated sialidase specific for gangliosides J. Biol. Chem. 274,5004-5011[Abstract/Free Full Text]
  60. 31
  61. Comelli, E. M., Amado, M., Lustig, S. R., Paulson, J. C. (2003) Identification and expression of Neu4, a novel murine sialidase Gene 321,155-161[CrossRef][Medline]
  62. 32
  63. Monti, E., Bassi, M. T., Bresciani, R., Civini, S., Croci, G. L., Papini, N., Riboni, M., Zanchetti, G., Ballabio, A., Preti, A., Tettamanti, G., Venerando, B., Borsani, G. (2004) Molecular cloning and characterization of NEU4, the fourth member of the human sialidase gene family Genomics 83,445-453[CrossRef][Medline]
  64. 33
  65. Seyrantepe, V., Landry, K., Trudel, S., Hassan, J. A., Morales, C. R., Pshezhetsky, A. V. (2004) Neu4, a novel human lysosomal lumen sialidase, confers normal phenotype to sialidosis and galactosialidosis cells J. Biol. Chem. 279,37021-37029[Abstract/Free Full Text]
  66. 34
  67. Pshezhetsky, A. V., Ashmarina, M. (2001) Lysosomal multienzyme complex: biochemistry, genetics, and molecular pathophysiology Prog. Nucleic Acid Res. Mol. Biol. 69,81-114[Medline]
  68. 35
  69. Lukong, K. E., Seyrantepe, V., Landry, K., Trudel, S., Ahmad, A., Gahl, W. A., Lefrancois, S., Morales, C. R., Pshezhetsky, A. V. (2001) Intracellular distribution of lysosomal sialidase is controlled by the internalization signal in its cytoplasmic tail J. Biol. Chem. 276,46172-46181[Abstract/Free Full Text]
  70. 36
  71. Fanzani, A., Giuliani, R., Colombo, F., Zizioli, D., Presta, M., Preti, A., Marchesini, S. (2003) Overexpression of cytosolic sialidase Neu2 induces myoblast differentiation in C2C12 cells FEBS Lett. 547,183-188[CrossRef][Medline]
  72. 37
  73. Yamaguchi, K., Hata, K., Koseki, K., Shiozaki, K., Akita, H., Wada, T., Moriya, S., Miyagi, T. (2005) Evidence for mitochondrial localization of a novel human sialidase (NEU4) Biochem. J. 390,85-93[CrossRef][Medline]
  74. 38
  75. Katoh, S., Miyagi, T., Taniguchi, H., Matsubara, Y., Kadota, J., Tominaga, A., Kincade, P. W., Matsukura, S., Kohno, S. (1999) Cutting edge: an inducible sialidase regulates the hyaluronic acid binding ability of CD44-bearing human monocytes J. Immunol. 162,5058-5061[Abstract/Free Full Text]
  76. 39
  77. Galvan, M., Murali-Krishna, K., Ming, L. L., Baum, L., Ahmed, R. (1998) Alterations in cell surface carbohydrates on T cells from virally infected mice can distinguish effector/memory CD8+ T cells from naive cells J. Immunol. 161,641-648[Abstract/Free Full Text]
  78. 40
  79. Wang, P., Zhang, J., Bian, H., Wu, P., Kuvelkar, R., Kung, T. T., Crawley, Y., Egan, R. W., Billah, M. M. (2004) Induction of lysosomal and plasma membrane-bound sialidases in human T-cells via T-cell receptor Biochem. J. 380,425-433[CrossRef][Medline]
  80. 41
  81. Landolfi, N. F., Leone, J., Womack, J. E., Cook, R. G. (1985) Activation of T lymphocytes results in an increase in H-2-encoded neuraminidase Immunogenetics 22,159-167[CrossRef][Medline]
  82. 42
  83. Gee, K., Kozlowski, M., Kumar, A. (2003) Tumor necrosis factor-{alpha} induces functionally active hyaluronan-adhesive CD44 by activating sialidase through p38 mitogen-activated protein kinase in lipopolysaccharide-stimulated human monocytic cells J. Biol. Chem. 278,37275-37287[Abstract/Free Full Text]
  84. 43
  85. Stamatos, N. M., Liang, F., Nan, X., Landry, K., Cross, A. S., Wang, L. X., Pshezhetsky, A. V. (2005) Differential expression of endogenous sialidases of human monocytes during cellular differentiation into macrophages FEBS J. 272,2545-2556[CrossRef][Medline]
  86. 44
  87. Amado, M., Yan, Q., Comelli, E. M., Collins, B. E., Paulson, J. C. (2004) Peanut agglutinin high phenotype of activated CD8+ T cells results from de novo synthesis of CD45 glycans J. Biol. Chem. 279,36689-36697[Abstract/Free Full Text]
  88. 45
  89. Chen, X. P., Ding, X., Daynes, R. A. (2000) Ganglioside control over IL-4 priming and cytokine production in activated T cells Cytokine 12,972-985[CrossRef][Medline]
  90. 46
  91. Lajaunias, F., Dayer, J. M., Chizzolini, C. (2005) Constitutive repressor activity of CD33 on human monocytes requires sialic acid recognition and phosphoinositide 3-kinase-mediated intracellular signaling Eur. J. Immunol. 35,243-251[CrossRef][Medline]
  92. 47
  93. Da Silva, J. S., Hasegawa, T., Miyagi, T., Dotti, C. G., Abad-Rodriguez, J. (2005) Asymmetric membrane ganglioside sialidase activity specifies axonal fate Nat. Neurosci. 8,606-615[CrossRef][Medline]
  94. 48
  95. Rottier, R. J., Bonten, E., d’Azzo, A. (1998) A point mutation in the neu-1 locus causes the neuraminidase defect in the SM/J mouse Hum. Mol. Genet. 7,313-321[Abstract/Free Full Text]
  96. 49
  97. Von Itzstein, M., Wu, W. Y., Kok, G. B., Pegg, M. S., Dyason, J. C., Jin, B., Van Phan, T., Smythe, M. L., White, H. F., Oliver, S. W., et al (1993) Rational design of potent sialidase-based inhibitors of influenza virus replication Nature 363,418-423[CrossRef][Medline]
  98. 50
  99. Hayden, F. G., Gubareva, L. V., Monto, A. S., Klein, T. C., Elliot, M. J., Hammond, J. M., Sharp, S. J., Ossi, M. J. (2000) Inhaled zanamivir for the prevention of influenza in families. Zanamivir Family Study Group N. Engl. J. Med. 343,1282-1289[Abstract/Free Full Text]
  100. 51
  101. Hayden, F. G., Osterhaus, A. D., Treanor, J. J., Fleming, D. M., Aoki, F. Y., Nicholson, K. G., Bohnen, A. M., Hirst, H. M., Keene, O., Wightman, K. (1997) Efficacy and safety of the neuraminidase inhibitor zanamivir in the treatment of influenzavirus infections. GG167 Influenza Study Group N. Engl. J. Med. 337,874-880[Abstract/Free Full Text]
  102. 52
  103. Oehler, C., Kopitz, J., Cantz, M. (2002) Substrate specificity and inhibitor studies of a membrane-bound ganglioside sialidase isolated from human brain tissue Biol. Chem. 383,1735-1742[CrossRef][Medline]
  104. 53
  105. Vinogradova, M. V., Michaud, L., Mezentsev, A. V., Lukong, K. E., El-Alfy, M., Morales, C. R., Potier, M., Pshezhetsky, A. V. (1998) Molecular mechanism of lysosomal sialidase deficiency in galactosialidosis involves its rapid degradation Biochem. J. 330,641-650
  106. 54
  107. Wang, Y., Yamaguchi, K., Shimada, Y., Zhao, X., Miyagi, T. (2001) Site-directed mutagenesis of human membrane-associated ganglioside sialidase: identification of amino-acid residues contributing to substrate specificity Eur. J. Biochem. 268,2201-2208[Medline]
  108. 55
  109. Van der Horst, G. T., Galjart, N. J., d’Azzo, A., Galjaard, H., Verheijen, F. W. (1989) Identification and in vitro reconstitution of lysosomal neuraminidase from human placenta J. Biol. Chem. 264,1317-1322[Abstract/Free Full Text]
  110. 56
  111. Tranchemontagne, J., Michaud, L., Potier, M. (1990) Deficient lysosomal carboxypeptidase activity in galactosialidosis Biochem. Biophys. Res. Commun. 168,22-29[CrossRef][Medline]
  112. 57
  113. Galjart, N. J., Morreau, H., Willemsen, R., Gillemans, N., Bonten, E. J., d’Azzo, A. (1991) Human lysosomal protective protein has cathepsin A-like activity distinct from its protective function J. Biol. Chem. 266,14754-14762[Abstract/Free Full Text]
  114. 58
  115. Pshezhetsky, A. V., Potier, M. (1994) Direct affinity purification and supramolecular organization of human lysosomal cathepsin A Arch. Biochem. Biophys. 313,64-70[CrossRef][Medline]
  116. 59
  117. Hinek, A., Pshezhetsky, A. V., von Itzstein, M., Starcher, B. (2006) Lysosomal sialidase (neuraminidase-1) is targeted to the cell surface in a multiprotein complex that facilitates elastic fiber assembly J. Biol. Chem. 281,3698-3710[Abstract/Free Full Text]
  118. 60
  119. Papini, N., Anastasia, L., Tringali, C., Croci, G., Bresciani, R., Yamaguchi, K., Miyagi, T., Preti, A., Prinetti, A., Prioni, S., Sonnino, S., Tettamanti, G., Venerando, B., Monti, E. (2004) The plasma membrane-associated sialidase MmNEU3 modifies the ganglioside pattern of adjacent cells supporting its involvement in cell-to-cell interactions J. Biol. Chem. 279,16989-16995[Abstract/Free Full Text]
  120. 61
  121. Gagneux, P., Cheriyan, M., Hurtado-Ziola, N., van der Linden, E. C., Anderson, D., McClure, H., Varki, A., Varki, N. M. (2003) Human-specific regulation of {alpha} 2-6-linked sialic acids J. Biol. Chem. 278,48245-48250[Abstract/Free Full Text]
  122. 62
  123. Harduin-Lepers, A., Vallejo-Ruiz, V., Krzewinski-Recchi, M. A., Samyn-Petit, B., Julien, S., Delannoy, P. (2001) The human sialyltransferase family Biochimie 83,727-737[Medline]
  124. 63
  125. Platanias, L. C. (2005) Mechanisms of type-I- and type-II-interferon-mediated signaling Nat. Rev. Immunol. 5,375-386[CrossRef][Medline]
  126. 64
  127. Oh, S., Eichelberger, M. C. (2000) Polarization of allogeneic T-cell responses by influenza virus-infected dendritic cells J. Virol. 74,7738-7744[Abstract/Free Full Text]
  128. 65
  129. Irani, D. N., Lin, K., Griffin, D. (1996) Brain-derived gangliosides regulate the cytokine production and proliferation of activated T cells J. Immunol. 157,4333-4340[Abstract]
  130. 66
  131. Kanda, N., Watanabe, S. (2001) Gangliosides GD1b, GT1b, and GQ1b enhance IL-2 and IFN-{gamma} production and suppress IL-4 and IL-5 production in phytohemagglutinin-stimulated human T cells J. Immunol. 166,72-80[Abstract/Free Full Text]
  132. 67
  133. Wang, Y., Yamaguchi, K., Wada, T., Hata, K., Zhao, X., Fujimoto, T., Miyagi, T. (2002) A close association of the ganglioside-specific sialidase Neu3 with caveolin in membrane microdomains J. Biol. Chem. 277,26252-26259[Abstract/Free Full Text]
  134. 68
  135. Kalka, D., von Reitzenstein, C., Kopitz, J., Cantz, M. (2001) The plasma membrane ganglioside sialidase cofractionates with markers of lipid rafts Biochem. Biophys. Res. Commun. 283,989-993[CrossRef][Medline]



This article has been cited by other articles:


Home page
Antimicrob. Agents Chemother.Home page
K. Hata, K. Koseki, K. Yamaguchi, S. Moriya, Y. Suzuki, S. Yingsakmongkon, G. Hirai, M. Sodeoka, M. von Itzstein, and T. Miyagi
Limited Inhibitory Effects of Oseltamivir and Zanamivir on Human Sialidases
Antimicrob. Agents Chemother., October 1, 2008; 52(10): 3484 - 3491.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.1105692v1
81/1/284    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nan, X.
Right arrow Articles by Stamatos, N. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nan, X.
Right arrow Articles by Stamatos, N. M.