Pepro Tech
Originally published online as doi:10.1189/jlb.1005580 on October 4, 2006

Published online before print October 4, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.1005580v1
81/1/205    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tachado, S. D.
Right arrow Articles by Koziel, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tachado, S. D.
Right arrow Articles by Koziel, H.
(Journal of Leukocyte Biology. 2007;81:205-211.)
© 2007 by Society for Leukocyte Biology

Pneumocystis-mediated IL-8 release by macrophages requires coexpression of mannose receptors and TLR2

Souvenir D. Tachado*, Jianmin Zhang*, Jinping Zhu*, Naimish Patel*, Melanie Cushion{dagger} and Henry Koziel*,1

* Division of Pulmonary, Critical Care and Sleep Medicine, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts, USA; and
{dagger} Veterans Administration Medical Center, University of Cincinnati, Cincinnati, Ohio, USA

1Correspondence: Division of Pulmonary, Critical Care and Sleep Medicine, Kirstein Hall, Room E/KSB-23, Beth Israel Deaconess Medical Center, 330 Brookline Avenue, Boston, MA 02215, USA. E-mail: hkoziel{at}bidmc.harvard.edu

ABSTRACT

Interaction with the unique fungus Pneumocystis (Pc) promotes IL-8 release by human alveolar macrophages (AM), although the receptor(s) mediating IL-8 release have not been identified. TLR2 recognizes fungal components and mediates release of host defense cytokines and chemokines, although whether TLR2 mediates signaling in response to Pc is not known. In the current study, Pc induced IL-8 release by human AM, and AM pretreatment with anti-TLR2 neutralizing antibody reduced IL-8 release. However, in nonphagocytic human embryonic kidney (HEK)293 cells transfected with human TLR2 cDNA, incubation with Pc did not induce IL-8 release, whereas these same cells released IL-8 in response to the TLR2 agonist lipoteichoic acid. Targeted gene silencing of AM mannose receptors (MR; phagocytic receptors for Pc) using small interfering RNA also reduced Pc-mediated IL-8 release in human AM. However, HEK293 cells transfected with human MR cDNA alone did not release IL-8 in response to Pc. In contrast, HEK293 cells cotransfected with human TLR2 and human MR cDNA released IL-8 in response to Pc. In human AM, Pc promoted direct interaction of MR and TLR2, IL-8 release was reduced markedly upon simultaneous blocking of TLR2 and gene silencing of MR, and IL-8 release was dependent in part on transcription factor NF-{kappa}B and ERK1/2 and JNK MAPKs. These studies demonstrate that Pc-mediated IL-8 release by human AM requires the coexpression of MR and TLR2 and further supports the concept that combinatorial interactions of macrophage innate receptors provide specificity of host defense cell responses to infectious challenge.

Key Words: innate immunity • host defense • chemokine • signal transduction • CXCL8

INTRODUCTION

Pneumocystis jirovecci, the causative agent in Pneumocystis (Pc) pneumonia, is a unique fungus that causes life-threatening pneumonia in immunocompromised persons [1 , 2 ], although the underlying mechanisms contributing to disease pathogenesis remain incompletely understood. Alveolar macrophages (AM) are the predominant resident host defense cells in the alveolar airspaces and are critical components of an effective host response to Pc [3 4 5 6 7 8 9 10 11 ]. Recognition of unopsonized Pc organisms by human AM is mediated predominantly via mannose receptors (MR), and results in binding and phagocytosis [12 , 13 ], release of reactive oxygen species (ROS) [14 ], and activation of the nuclear transcription factor NF-{kappa}B [15 ]. Our recent investigation demonstrates that Pc organisms promote the release of the chemokine IL-8 [16 ], an important molecule implicated in the pathogenesis of Pc pneumonia [17 18 19 20 ]. However, the mechanism(s) of Pc-mediated IL-8 (or CXCL8) release by macrophages have not been examined.

Macrophages recognize potential pathogens through an array of surface recognition receptors, such as MR, ß-glucan receptors, scavenger receptors, and TLRs. The family of mammalian TLRs serves an important role in the early host defense response of innate immunity through recognition of conserved molecules derived from microbial pathogens, leading to activation of NF-{kappa}B and release of host defense cytokines and chemokines. TLR2 serves a critical role in the discrimination of "self" from "infectious nonself" in the early response to Gram-positive bacterial components [lipoteichoic acid (LTA) and peptidoglycans] and fungal wall components [21 ]. TLR2 plays a significant role in the host defense response to invasive pulmonary infection with the fungus Aspergillus fumigatus [22 ]. However, whether the fungus Pc activates TLR2 signaling in human AM has not been investigated. To further define the role of human AM in the innate immune response to opportunistic lung pathogens, the purpose of this study was to investigate the AM receptors that promote IL-8 release in response to Pc challenge in vitro, with particular focus on macrophage TLR2 and MR.

MATERIALS AND METHODS

Reagents
LTA (from Staphylococcus aureus and specific TLR2 ligand) and protease inhibitor cocktail were purchased from Sigma Chemical Co. (St. Louis, MO), Thermoscript RT-PCR kit was from Invitrogen (Carlsbad, CA), and analytical or HPLC-grade chloroform, methanol, and diethyl ether were from Fisher Scientific (Pittsburgh, PA). Anti-TLR2 and isotype antibody were purchased from Santa Cruz Biotechnology (CA), anti-MR antibodies were purchased from HyCult Biotechnology (Uden, The Netherlands), and anti-ß-actin antibody was from Sigma Chemical Co. Inhibitors for MEK (UO126), p38 (SB203580), and JNK (SP600125) and A/G beads were purchased from Promega (Madison, WI). Inhibitor for NF-{kappa}B (SN50) was purchased from Biomol Research Laboratories (Plymouth Meeting, PA).

Human AM
Research bronchoscopy subjects included prospectively recruited healthy 18- to 55-year-old adults without evidence for active pulmonary disease and with normal spirometry. Subjects were without known risk factors for HIV infection and confirmed to be HIV-seronegative by ELISA. Pulmonary immune cells were obtained by bronchoalveolar lavage (BAL) using a standard technique as described previously [13 ]. All procedures were performed on consenting adults through protocols fully approved by the Beth Israel Deaconess Medical Center Institutional Review Board (Boston, MA). The cells were separated from the pooled BAL fluid as described previously [13 ] and counted on a hemacytometer with light microscopy. AM were isolated by adherence to plastic-bottom tissue-culture plates (3x106 cells/well in six-well plates for Western blotting, 2.5–7.5x105 cells/well in 24-well plates for ELISA) as described previously [23 ]. Isolation of AM from all healthy persons yielded cells that were ≥98% viable, as determined by trypan blue dye exclusion, and demonstrated >95% positive, nonspecific esterase staining by light microscopy.

Human embryonic kidney (HEK)293 cell line transfections
Stable cell lines of HEK293 cells expressing human TLR2 or the empty vector pcDNA (generous gift of Douglas Golenbock, University of Massachusetts, Worcester) were maintained in DMEM (BioWhittaker, Walkersville, MD), supplemented with 10% FCS and 0.5 mg G418/ml at 37°C in 5% CO2 [24 , 25 ]. Genetic complementation with TLR2 renders HEK293 cells responsive to TLR2 ligands [25 ]. For select experiments, HEK293 cells were used to generate transient transfection with human MR cDNA in a pCDM8 vector (generous gift of Phil D. Stahl, Washington University, St. Louis, MO). Briefly, 2.5 x 105 HEK293 cells were incubated overnight without antibiotics or FCS and then transfected with pCDM8-MR (1 µg/ml) using Lipofectamine for 48–72 h at 37°C in 5% CO2 according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Following trypsin treatment, transfected HEK293 cells were then plated onto 24-well tissue-culture plates and further cultured with Pc or LTA or maintained unstimulated as a control condition. Expression of TLR2 or MR protein was verified by Western blot.

Pc organisms
As sustainable cultivation of Pc is not possible, and Pc derived from human disease (P. jirovecci [26 ]) is rarely available, Pc organisms were obtained from chronically immunosuppressed male Lewis rats (University of Cincinnati Lab Animal Medicine Facility, OH) as described previously [15 ]. Isolated Pc mixed-life cycle preparations yield ~90% trophozoite and 10% cyst forms, and viability was >85% [27 ]. Pc preparations were relatively free of contaminating rat-derived proteins [14 ], and preparations were endotoxin-free (<1.0 endoxotin units/ml) as determined by E-toxate Limulus polyphemus assay (Sigma Chemical Co.).

Protein detection in cultured supernatants by ELISA
Human AM are incubated with Pc for 24 h at 37°C in humidified 5% CO2. Culture supernatants are harvested and centrifuged to remove cellular debris, and aliquots were stored at –80°C until assayed. Specific immunoreactivity for human IL-8 in culture supernatants was measured by ELISA according to the manufacturer’s protocol (R&D Systems, Minneapolis, MN). Samples are assayed in duplicate on a Biotek plate reader, and quantitation was performed compared with a standard curve. Select experiments used the TLR2-specific ligand LTA (S. aureus, Sigma Chemical Co.).

Flow cytometry analysis
Cell surface expression of TLR2 was determined by Epics XL flow cytometer (Beckman/Coulter, Miami, FL) as described previously [23 ]. Macrophages were incubated with an anti-TLR2 antibody or isotype control on ice for 60 min, washed x3, incubated with a PE-conjugated secondary antibody for 30 min on ice protected from light, fixed in Optilyse® (Beckman/Coulter) at room temperature for 5–10 min, and analyzed by flow cytometry. Data were expressed as a log of mean relative fluorescence units (RFU) and the percentage of cells staining positive. Samples were prepared and analyzed in duplicate, and a minimum of 5000 cells was counted for each sample.

Immunoprecipitation and immunoblotting
Adherent human AM were incubated with Pc [multiplicity of infection (MOI)=10:1] for 10 min and then treated with lysis buffer [containing 1% Triton X-100, 20 mM Tris-HCl (pH 8.0), 137 mM NaCl, 10% glycerol, 2 mM EDTA, and protease inhibitor cocktail] on ice for 20 min. The Triton X-100-soluble protein was separated by centrifugation at 10,000 g for 15 min at 4°C. Lysates were subjected to immunoprecipitation and immunoblotting as described [23 ].

Small interfering (si)RNA gene silencing of AM MR
To determine the specific contribution of MR to Pc-mediated IL-8 release, siRNA gene silencing was used to produce functional "knock-down" of human AM MR as described previously [15 ]. Experiments used the following oligonucleotide (annealed dssiRNA, Qiagen, Valencia, CA) for human MR siRNA (MR siRNA3): DNA target sequences, AAGTGGTACGCAGATTGCACG from 528 bp to 549 bp; 5'-GUGGUACGCAGAUUGCACG-3'; and 3'-CGUGCAAUCUGCGUACCAC-5'. MR siRNA was transfected into AM using TransMessenger transfection reagent (Qiagen). dssiRNA3 specifically targeted different domains of the MR and provided the most robust suppression of MR mRNA [28 ]. Laminarin dssiRNA and MR sssiRNA are used as controls to examine specificity of gene silencing. The nonsilencing rhodamine-labeled siRNA is used to determine transfection efficiency.

Statistical analysis
Experimental conditions were performed in duplicate or triplicate and repeated with AM from at least three different individuals. Data were analyzed with an Apple G3 Power PC computer using StatView (SAS Institute, Inc., Cary, NC) and INSTAT2 (GraphPad Software, San Diego, CA) statistical software. Nonparametric data were analyzed by Fischer Exact test or ANOVA. Statistical significance was accepted for P < 0.05.

RESULTS

Unopsonized Pc organisms induced IL-8 release by human AM
To examine the ability of Pc to induce IL-8 release, adherent human AM were incubated with unopsonized Pc organisms, and release of IL-8 into the cultured supernatants was determined by ELISA. Unstimulated adherent human AM demonstrated minimal spontaneous release of IL-8 after 24 h (Fig. 1 ). Following incubation with Pc organisms, AM IL-8 release increased over a range of increasing multiplicities of Pc:AM. As expected, LTA (TLR2 agonist) induced IL-8 release by human AM.


Figure 1
View larger version (7K):
[in this window]
[in a new window]

 
Figure 1. Unopsonized Pc organisms induce IL-8 release by human AM. Human AM were incubated with Pc organisms over a range of MOI (Pc:AM ratios of 0, 1:1, 5:1, and 10:1) or the TLR2 ligand LTA (10 µg/ml) for 18–24 h and cell-free, cultured supernatants assayed for IL-8 by ELISA. Data represent results from one experiment, and results are similar to other experiments performed using AM from at least three different individuals. Values are mean ± SEM.

Neutralizing anti-TLR2 antibody reduced Pc-mediated IL-8 release by human AM
To determine whether IL-8 release was dependent in part on TLR2, human AM were incubated with Pc in the presence and absence of TLR2 neutralizing antibodies. Human AM expressed TLR2 as determined by flow cytometry (Fig. 2A ). As above, incubation of AM with Pc promoted IL-8 release (Fig. 2B) . However, in the presence of neutralizing antibody against TLR2, IL-8 release was reduced by 41–57%. These data suggest that Pc-mediated IL-8 release by human AM is mediated in part through TLR2.


Figure 2
View larger version (13K):
[in this window]
[in a new window]

 
Figure 2. Neutralizing anti-TLR2 antibodies reduced Pc-mediated IL-8 release by human AM. (A) TLR2 surface expression on human AM by flow cytometry using PE-labeled anti-TLR2 antibody (right-hand tracing) compared with PE-labeled isotype control antibody (left-hand tracing). (B) Human AM were incubated with Pc organisms at MOI (Pc:AM ratios) of 1:1 and 10:1 in the presence of neutralizing anti-human TLR2 antibody (anti-TLR2) or isotype control antibody (IgG isotype). After 18–24 h, cell-free, cultured supernatants were assayed for IL-8 by ELISA. Data represent results from one experiment, and results are similar to other experiments performed using AM from at least three different individuals. Values are mean ± SEM (n=3). *, P < 0.05, compared with unstimulated conditions.

TLR2 alone was not sufficient to mediate IL-8 release in response to Pc organisms
To determine whether TLR2 is sufficient to mediate signaling by Pc, nonphagocytic HEK293 cells were transfected with human cDNA for TLR2. HEK293 cells did not release IL-8 in response to Pc (data not shown). In unstimulated, TLR2-transfected HEK293 cells, spontaneous IL-8 release was low (Fig. 3 ). Following incubation with Pc, no significant IL-8 release was detected in the cultured supernatants by 24 h. In contrast, incubation of these same TLR2-transfected HEK293 cells with LTA (a TLR2 agonist) resulted in IL-8 release as expected. These data suggested that TLR2 alone was not sufficient to induce IL-8 release in response to Pc organisms.


Figure 3
View larger version (9K):
[in this window]
[in a new window]

 
Figure 3. TLR2 alone is not sufficient to mediate IL-8 release in response to Pc organisms. Human HEK293 cells transfected with human TLR2 cDNA or vector alone were cultured with unopsonized Pc organisms (MOI 10:1) or the TLR2 ligand LTA (10 µg/ml). After 18–24 h, cell-free, cultured supernatants were assayed for IL-8 by ELISA. Data represent results from one experiment, and results are similar to and representative of at least three other experiments. Values are mean ± SEM (n=3). *, P < 0.05, compared with unstimulated (unstim) conditions.

Functional gene silencing of human MR reduced Pc-mediated IL-8 release by human AM
For human AM, MR mediate Pc binding and phagocytosis [12 ], promote release of ROS [14 ], and activate NF-{kappa}B [15 ]. To next examine the potential role of macrophage MR in IL-8 release in response to Pc, experiments used targeted functional gene silencing of MR using siRNA as previously reported [15 ]. As above, unstimulated, adherent human AM released low levels of IL-8, and IL-8 release increased following incubation with Pc organisms. However, following targeted gene silencing of MR, Pc-mediated IL-8 release was reduced significantly (Fig. 4 ). As a control condition, TLR2-mediated IL-8 release by LTA was not influenced by targeted gene silencing of MR. These data demonstrate that specific gene silencing of macrophage MR reduced IL-8 release in response to unopsonized Pc organisms and suggested that MR contributed to Pc-mediated IL-8 release by macrophages.


Figure 4
View larger version (7K):
[in this window]
[in a new window]

 
Figure 4. Functional gene silencing of human MR reduced Pc-mediated IL-8 release by human AM. Human AM were pretreated with siRNA targeted to the human MR (MR siRNA) or using irrelevant siRNA, and macrophages then incubated with unopsonized Pc organisms (MOI 10:1) or the TLR2 ligand LTA (10 µg/ml). After 18–24 h, cell-free, cultured supernatants were assayed for IL-8 by ELISA. Data represent results from one experiment, and results are similar to other experiments performed using AM from at least three different individuals. Values are mean ± SEM. *, P < 0.05, compared with irrelevant siRNA-pretreated AM incubated with Pc or LTA.

MR alone was not sufficient to promote IL-8 release in response to Pc but required coexpression of TLR2
To determine the specificity of the above observations, experiments next examined IL-8 release in HEK293 cells transfected with human MR cDNA. HEK293 cells transfected with MR cDNA expressed MR protein (Fig. 5A ) and released low levels of IL-8 in unstimulated conditions (Fig. 5B) , and IL-8 release did not increase in response to Pc (Fig. 5B) . As the above data with human AM suggested that TLR2 and MR may each contribute to Pc-mediated IL-8 release, experiments next examined the possible role of coexpression of these receptors using HEK293 cells cotransfected with human cDNA for TLR2 and MR. Unstimulated HEK293 cells cotransfected with TLR2 and MR expressed TLR2 and MR protein (Fig. 5A) and released low levels of IL-8 (Fig. 5B) . In contrast to HEK293 cells transfected with TLR2 alone or MR alone, Pc stimulation of HEK293 cells, cotransfected with human TLR2 and MR, increased IL-8 release (Fig. 5B) . Stimulation of HEK293-cotransfected cells by LTA (TLR2 agonist) also promoted IL-8 release comparable with HEK293 cells transfected with TLR2 alone. These data suggest that Pc-mediated IL-8 release by human AM requires coexpression of TLR2 and MR.


Figure 5
View larger version (15K):
[in this window]
[in a new window]

 
Figure 5. MR alone were not sufficient to promote IL-8 release in response to Pc but required coexpression of TLR2. Human HEK293 cells were transfected with human MR cDNA alone, cotransfected with human MR cDNA and human TLR2 cDNA, or with vector alone. (A) Western blot analysis of HEK293-transfected cells using antibodies against human MR and TLR2. (B) Transfected HEK293 cells were cultured with unopsonized Pc organisms (MOI 10:1) or the TLR2 ligand LTA (10 µg/ml) for 18–24 h, and cell-free, cultured supernatants were assayed for IL-8 by ELISA. Data represent results from one experiment, and results are similar to and representative of at least three other experiments. Values are mean ± SEM (n=3). *, P < 0.05, compared with unstimulated conditions.

Pc organisms promoted direct interaction of MR and TLR2 in human AM
To further define the nature and significance of the observed requirement for receptor coexpression for IL-8 release, experiments next determined whether TLR2 and MR directly interacted upon incubation with Pc organisms. Using clinically relevant human AM, immunoprecipitation by anti-MR antibodies following incubation with Pc demonstrated evidence for coprecipitation of TLR2 and MR (Fig. 6A ). As expected, MR were readily identified using anti-MR antibodies (Fig. 6A) . To demonstrate the specificity of the Pc response, TLR4 was not detected in these same immunoprecipitation specimens (Fig. 6A) . Evidence for TLR2-MR coprecipitation was also observed in experiments by immunoprecipitation with anti-TLR2 antibodies followed by immunoblotting with anti-MR antibodies (data not shown).


Figure 6
View larger version (12K):
[in this window]
[in a new window]

 
Figure 6. Pc-mediated interactions of MR and TLR2 in human AM. (A) Evidence for direct interaction (coprecipitation) of MR and TLR2 following stimulation by unopsonized Pc. Human AM were incubated with Pc (MOI 10:1) for 10 min at 37°C followed by immunoprecipitation (IP) with anti ({alpha})-MR antibodies and then immunoblotting (IB) with anti-TLR antibodies or anti-MR antibodies as described in Materials and Methods. (B) Reduced Pc-mediated IL-8 release following simultaneous, functional knock-down of MR by siRNA and neutralizing anti-TLR2 antibody in human AM, which were incubated with Pc (MOI 10:1) for 24 h at 37°C; cell-free, cultured supernatants were assayed for IL-8 by ELISA. Data represent results from one experiment, and results are similar to and representative of at least three other experiments. Values are mean ± SEM (n=3). *, P < 0.05, compared with conditions with Pc stimulation alone.

To determine the relative contribution of TLR2 and MR to IL-8 release, human AM incubated with Pc organisms pretreated with neutralizing anti-TLR2 antibody and siRNA targeted against MR-reduced IL-8 release up to 88% (Fig. 6B) , similar to anti-TLR2 or siRNA MR strategies alone. Taken together, these experiments demonstrate that Pc organisms promote the direct interaction of TLR2 and MR in human AM and that Pc-mediated IL-8 release is predominantly dependent on coexpression of TLR2 and MR.

Pc-mediated IL-8 release by human AM dependent on ERK1/2, JNK, and NF-{kappa}B
In general, TLR ligation may result in NF-{kappa}B and MAPK signal activation [29 ], and IL-8 release may be modulated by NF-{kappa}B [30 ] or by MAPKs [30 ]. To determine the intracellular signaling pathways involved in Pc-mediated IL-8 release, human AM were incubated with unopsonized Pc organsisms in the presence and absence of pharmacological inhibitors of NF-{kappa}B and MAPKs. Compared with Pc-stimulated human AM, IL-8 was reduced significantly in the presence of inhibitors for ERK1/2 and JNK MAPKs and for NF-{kappa}B (Fig. 7 ). Pharmacological inhibition of p38 MAPK did not influence Pc-mediated IL-8 release by human AM. These data demonstrate that NF-{kappa}B and MAPK signal transduction pathways contribute to IL-8 release by human AM in response to Pc organisms.


Figure 7
View larger version (9K):
[in this window]
[in a new window]

 
Figure 7. Pc-mediated IL-8 release was dependent on NF-{kappa}B and ERK1/2 and JNK MAPKs. Human AM were incubated with unopsonized Pc (MOI 10:1) for 18–24 h in the presence or absence of pharmacological inhibitors of ERK1/2 (UO126), p38 (SB203580), or JNK (SP600125) MAPKs or NF-{kappa}B (Sn50) as detailed in Materials and Methods. IL-8 measurements performed on cell-free, cultured supernatants by ELISA. Data are from a representative experiment of three independent experiments with similar results. Values are mean ± SEM (n=3). *, P < 0.05, compared with conditions with Pc stimulation alone.

DISCUSSION

This study demonstrated that unopsonized Pc organisms induced IL-8 release by human AM, increasing over a range of Pc:AM MOI in vitro. Furthermore, pretreatment of human AM with neutralizing anti-TLR2 antibodies or targeted gene silencing of AM MR reduced Pc-mediated IL-8 release, suggesting contributions of TLR2 and MR in Pc-mediated IL-8 release. However, Pc failed to induce IL-8 release by nonphagocytic HEK293 cells transfected with human TLR2 cDNA alone or human MR cDNA alone. In contrast, HEK293 cells cotransfected with human TLR2 cDNA, and human MR cDNA released IL-8 in response to unopsonized Pc organisms. Taken together, these studies demonstrate that Pc-mediated IL-8 release by human AM requires the coexpression of MR and TLR2.

The current study identifies TLR2 as an innate receptor that mediates macrophage signal transduction in response to unopsonized Pc organisms. TLR2 belongs to the family of mammalian TLRs, including at least nine functional human TLR [31 ]. TLR2 recognizes a variety of microbial components, including fungal cell wall components phospholipomannan [32 ] and ß-glucan [33 ] and fungal particles such as zymosan [34 ], Aspergillus conidia [35 ], and Coccidioides spherules [36 ]. TLR2 plays a significant role in the host defense response to invasive pulmonary infection with the fungus A. fumigatus [22 ]. Prior investigations demonstrated that Pc ß-glucan (the structural cell wall component of the organism) mediated cytokine release by the RAW 264.7 murine macrophage cell line [37 ]. Although the specific receptor was not identified, Pc ß-glucan-mediated cytokine release was independent of TLR4 expression [37 ], suggesting a possible role for other TLR. The current study identifies TLR2 as contributing to Pc-mediated IL-8 release and extends the spectrum of fungal moieties that activate TLR2 to include the unique fungal pathogen Pc. The current study is supported by recent investigations using murine AM, which demonstrated TLR2-mediated release of chemokine MIP-2 in response to murine Pc [38 ].

This is the first study to examine the mechanism of Pc-mediated IL-8 release by human AM in vitro. Our recent investigation demonstrated that Pc organisms promote the release of the chemokine IL-8 [16 ], an important host defense molecule implicated in the pathogenesis of Pc pneumonia [17 18 19 20 ]. However, the macrophage receptor(s) of Pc-mediated IL-8 release have not been identified previously. In the current study, data suggest that macrophage TLR2 and MR contribute to IL-8 release, and IL-8 release requires the coexpression of MR and TLR2. The concept of collaboration of TLR2 with another innate immune receptor is supported by reports of TLR2 and dectin-1 interaction in response to zymosan fungal particles [33 ].

The finding in the current study that Pc promotes IL-8 release by AM may provide a mechanism for the neutrophil recruitment observed in the lungs of immunocompromised patients with Pc pneumonia [39 ], particularly in non-HIV-associated Pc pneumonia [39 ]. IL-8 (or CXCL8) is a potent cellular activator and mediates chemotaxis, including neutrophil chemotaxis [30 ]. Neutrophils are known to phagocytose Pc organisms in vitro [40 ], although the role of neutrophils in host defense against Pc remains to be fully established. Elevated IL-8 levels in the BAL fluid of persons with Pc pneumonia and elevated levels of neutrophils in the alveolar airspace are associated with poor prognosis [20 ], as neutrophilia may contribute to direct lung injury [41 ] and contribute to disease pathogenesis [39 , 42 , 43 ]. In the current study, the finding that Pc induced IL-8 release by AM is consistent with other investigations that describe IL-8 release by human monocyte-derived macrophages in response to Pc antigen [19 ]. Thus, macrophages may represent one source of IL-8 in the host, but other cells such as epithelial cells may also contribute to in vivo IL-8 release in response to Pc.

In the current study, experiments demonstrated the molecular pathway for Pc-mediated IL-8 release was in part dependent on NF-{kappa}B and ERK1/2 and JNK MAPKs. Although neutralizing data in the current study demonstrated dependence of TLR2 and MR coexpression in Pc-mediated IL-8 release, the specific receptor activating NF-{kappa}B or MAPK pathways was not established. Although MR mediate Pc binding and phagocytosis [12 ], the MR cytoplasmic tail does not contain intracellular ITAM signaling motifs [44 ]. In the current study, the evidence for direct interaction of TLR2 and MR supports the concept that these receptors may form a functional complex, whereby MR may capture Pc at the cell membrane, and the Toll/IL-1 receptor signaling motif of the associated TLR2 [31 ] may provide the necessary intracellular signal transduction via NF-{kappa}B and MAPKs to promote IL-8 release, although this was not investigated specifically in the current study. Although data in the current study suggest that TLR2 dimerization with MR may be sufficient to promote IL-8 release, the possibility that other receptors (such as TLR1, TLR6, or ß-glucan) or adaptor molecules may contribute to this cellular response cannot be excluded.

Limitations of the current study include the nature of the MR, and TLR2 interaction was not defined, although receptor dimerization could involve disulfide bonds between cysteine residues [44 , 45 ]. TLR2 may participate in the phagocytosis of fungal particles such as zymosan [34 ], although the specific role of TLR2 in Pc phagocytosis was not investigated specifically in the current study. Although nonsyngeneic factors may influence human AM responses to rat-derived Pc, similar patterns of phagocytosis [12 ], NF-{kappa}B activation [15 ], and cytokine and chemokine release (including IL-8) [16 ] were observed comparing rat and human AM in response to rat-derived Pc. Finally, although in vitro observations may not reflect in vivo mechanisms, the use of primary human AM may allow more direct application to human disease.

In conclusion, these data demonstrated that in AM from healthy individuals, binding and phagocytosis of unopsonized Pc were associated with release of IL-8. Whereas previous data demonstrated that MR were sufficient for Pc phagocytosis, data from the current study suggested that MR alone were not sufficient for promoting IL-8 release by macrophages. Rather, Pc-mediated IL-8 release required the coexpression of MR and TLR2. In the context of protective early lung host defenses and early response to infectious challenge, the combinatorial pattern recognition receptor interaction may provide an effective mechanism for pathogen phagocytosis and promote the recruitment of other innate cells such as neutrophils. The current study provides important insight into the host cell innate immune response to Pc and carbohydrate receptor signaling. These findings further support the concept that combinatorial interactions of macrophage innate receptors provide specificity of host defense cell responses and regulate inflammatory cell homeostasis in response to infectious challenge.

ACKNOWLEDGEMENTS

This study was supported by National Institutes of Health Research Grants RO1 HL63655 (H. K.) and F32 HL71372 (J. Zhang). The authors gratefully acknowledge the participation of all persons who consented to bronchoscopy and the technical assistance of Robert Garland, Lorraine Gryniuk, and Renee Andwood. The authors thank Dr. Douglas Golenbock for his generous gift of TLR2-transfected and wild-type HEK293 cells and Dr. Phil Stahl for his generous gift of human MR cDNA. None of the authors have conflict of interest disclosures regarding the work in this study.

Received October 11, 2005; revised July 27, 2006; accepted August 22, 2006.

REFERENCES

    1
  1. Yale, S. H., Limper, A. H. (1996) Pneumocystis carinii pneumonia in patients without acquired immunodeficiency syndrome: associated illnesses and prior corticosteroid therapy Mayo Clin. Proc. 71,5-13[Abstract]
  2. 2
  3. Mansharamani, N. G., Garland, R., Delaney, D., Koziel, H. (2000) Management and outcome patterns for adult Pneumocystis carinii pneumonia 1985–95: comparison of HIV-associated cases to other immunocompromised states Chest 118,704-711
  4. 3
  5. Barton, E., Campbell, W. (1969) Pneumocystis carinii in lungs of rats treated with cortisone acetate Am. J. Pathol. 54,209-236[Medline]
  6. 4
  7. Von Behren, L. A., Pesanti, E. L. (1978) Uptake and degradation of Pneumocystis carinii by macrophages in vitro Am. Rev. Respir. Dis. 118,1051-1059[Medline]
  8. 5
  9. Masur, H., Jones, T. C. (1978) The interaction in vitro of Pneumocystis carinii with macrophages and L-cells J. Exp. Med. 147,157-170[Abstract/Free Full Text]
  10. 6
  11. Shellito, J. E., Suzara, V. V., Blumenfeld, W., Beck, J. M., Steger, H. J., Ermak, T. H. (1990) A new model of Pneumocystis carinii infection in mice selectively depleted of helper T lymphocytes J. Clin. Invest. 85,1686-1693[Medline]
  12. 7
  13. Harmsen, A., Stankiewicz, M. (1990) Requirement for CD4+ cells in resistance to Pneumocystis carinii pneumonia in mice J. Exp. Med. 172,937-945[Abstract/Free Full Text]
  14. 8
  15. Roths, J. B., Marshall, J. D., Allen, R. D., Carlson, G. A., Sidman, C. L. (1990) Spontaneous Pneumocystis carinii pneumonia in immunodeficient mutant scid mice Am. J. Pathol. 136,1173-1186[Abstract]
  16. 9
  17. Harmsen, A. G., Chen, W. (1992) Resolution of Pneumocystis carinii pneumonia in CD4+ lymphocyte-depleted mice given aerosols of heat-treated Escherichia coli J. Exp. Med. 176,881-886[Abstract/Free Full Text]
  18. 10
  19. Limper, A. H., Hoyte, J. S., Standing, J. E. (1997) The role of alveolar macrophages in Pneumocystis carinii degradation and clearance from the lung J. Clin. Invest. 99,2110-2117[Medline]
  20. 11
  21. Vassallo, R., Thomas, C. F., Jr, Vuk-Paklovic, Z., Limper, A. H. (1999) Alveolar macrophage interactions with Pneumocystis carinii J. Lab. Clin. Med. 133,535-540[CrossRef][Medline]
  22. 12
  23. Ezekowitz, R. A. B., Williams, D. J., Koziel, H., Armstong, M. Y. K., Warner, A., Richards, F. F., Rose, R. M. (1991) Uptake of Pneumocystis carinii mediated by the macrophage MR Nature 351,155-158[CrossRef][Medline]
  24. 13
  25. Koziel, H., Eichbaum, Q., Kruskal, B. A., Pinkston, P., Rogers, R. A., Armstrong, M. Y. K., Richards, F. F., Rose, R. M., Ezekowitz, R. A. B. (1998) Reduced binding and phagocytosis of Pneumocystis carinii by alveolar macrophages from persons infected with HIV-1 correlates with MR downregulation J. Clin. Invest. 102,1332-1344[Medline]
  26. 14
  27. Koziel, H., Li, X., Armstrong, M. Y. K., Richards, F. F., Rose, R. M. (2000) Alveolar macrophages from human immunodeficiency virus-infected persons demonstrate impaired oxidative burst response to Pneumocystis carinii in vitro Am. J. Respir. Cell Mol. Biol. 23,452-459[Abstract/Free Full Text]
  28. 15
  29. Zhang, J. M., Zhu, J., Imrich, A., Cushion, M. T., Kinane, B. T., Koziel, H. (2004) Pneumocystis activates human alveolar macrophage NF-{kappa}B signaling through MRs Infect. Immun. 72,3147-3160[Abstract/Free Full Text]
  30. 16
  31. Zhang, J., Tachado, S. D., Patel, N., Zhu, J., Imrich, A., Manfruelli, P., Cushion, M., Kinane, T. B., Koziel, H. (2005) Negative regulatory role of MRs on human alveolar macrophage proinflammatory cytokine release in vitro J. Leukoc. Biol. 78,665-674[Abstract/Free Full Text]
  32. 17
  33. Lipschik, G., Doerfler, M., Kovacs, J., Travis, W., Andrawis, V., Lawrence, M., Dichter, J., Ognibene, F., Shelhamer, J. (1993) Leukotriene B4 and interleukin-8 in human immunodeficiency virus-related pulmonary disease Chest 104,763-769
  34. 18
  35. Villard, J., Dayer-Pastore, R., Hamacher, J., Aubert, J. D., Schlegel-Haueter, S., Nicod, L. P. (1995) GRO-{alpha} and interleukin-8 in Pneumocystis carinii or bacterial pneumonia and adult respiratory distress syndrome Am. J. Respir. Crit. Care Med. 152,1549-1554[Abstract]
  36. 19
  37. Benfield, T., Van Steenwuk, R., Nielsen, T., Dichter, J., Lipschik, G., Jensen, B., Shelhamer, J., Lundgren, J. (1995) Interleukin-8 and eicosanoid production in the lung during moderate to severe Pneumocystis carinii pneumonia in AIDS: a role of interleukin-8 in the pathogenesis of P. carinii pneumonia Respir. Med. 89,285-290[CrossRef][Medline]
  38. 20
  39. Benfield, T., Vestbo, J., Junge, J., Nielsen, T., Baek Jensen, A., Lundgren, J. (1995) Prognostic value of interleukin-8 in AIDS-associated Pneumocystis carinii pneumonia Am. J. Respir. Crit. Care Med. 151,1058-1062[Abstract]
  40. 21
  41. Medzhitov, R. (2001) Toll-like receptors and innate immunity Nat. Rev. Immunol. 1,135-145[CrossRef][Medline]
  42. 22
  43. Balloy, V., Si-Tahar, M., Takeuchi, O., Philippe, B., Nahori, M. A., Tanguy, M., Huerre, M., Akira, S., Latge, J. P., Chignard, M. (2005) Involvement of Toll-like receptor 2 in experimental invasive pulmonary aspergillosis Infect. Immun. 73,5420-5425[Abstract/Free Full Text]
  44. 23
  45. Tachado, S. D., Zhang, J., Zhu, J., Patel, N., Koziel, H. (2005) HIV impairs TNF-{alpha} release in response to TLR4 stimulation in human alveolar macrophages in vitro Am. J. Respir. Cell Mol. Biol. 33,610-621[Abstract/Free Full Text]
  46. 24
  47. Latz, E., Visintin, A., Lien, E., Fitzgerald, K. A., Monks, B. G., Kurt-Jones, E. A., Golenbock, D. T., Espevik, T. (2002) Lipopolysaccharide rapidly traffics to and from the Golgi apparatus with the Toll-like receptor 4-MD-2-CD14 complex in a process that is distinct from the initiation of signal transduction J. Biol. Chem. 277,47834-47843[Abstract/Free Full Text]
  48. 25
  49. Latz, E., Franko, J., Golenbock, D. T., Schreiber, J. R. (2004) Haemophilus influenzae type b-outer membrane protein complex glycoconjugate vaccine induces cytokine production by engaging human Toll-like receptor 2 (TLR2) and requires the presence of TLR2 for optimal immunogenicity J. Immunol. 172,2431-2438[Abstract/Free Full Text]
  50. 26
  51. Stringer, J. R., Beard, C. B., Miller, R. F., Wakefield, A. E. (2002) A new name (Pneumocystis jiroveci) for Pneumocystis from humans Emerg. Infect. Dis. 8,891-896[Medline]
  52. 27
  53. Chen, F., Cushion, M. (1994) Use of an ATP bioluminescent assay to evaluate viability of Pneumocystis carinii from rats J. Clin. Microbiol. 32,2791-2800[Abstract/Free Full Text]
  54. 28
  55. Zhang, D., Zhang, G., Hayden, M. S., Greenblatt, M. B., Bussey, C., Flavell, R. A., Ghosh, S. (2004) A Toll-like receptor that prevents infection by uropathogenic bacteria Science 303,1522-1526[Abstract/Free Full Text]
  56. 29
  57. Akira, S., Takeda, K. (2004) Toll-like receptor signaling Nat. Rev. Immunol. 4,499-511[CrossRef][Medline]
  58. 30
  59. Mukaida, N. (2003) Pathophysiological roles of interleukin-8/CXCL8 in pulmonary diseases Am. J. Physiol. Lung Cell. Mol. Physiol. 284,L566-L577[Abstract/Free Full Text]
  60. 31
  61. Takeda, K., Akira, S. (2005) Toll-like receptors in innate immunity Int. Immunol. 17,1-14[Abstract/Free Full Text]
  62. 32
  63. Jouault, T., Ibata-Ombetta, S., Takeushi, O., Trinel, P. A., Sacchetti, P., Lefebvre, P., Akira, S., Poulain, D. (2003) Candida albicans phospholipomannan is sensed through Toll-like receptors J. Infect. Dis. 188,165-172[CrossRef][Medline]
  64. 33
  65. Gantner, B. N., Simmons, R. M., Canavera, S. J., Akira, S., Underhill, D. M. (2003) Collaborative induction of inflammatory responses by dectin-1 and Toll-like receptor 2 J. Exp. Med. 197,1107-1117[Abstract/Free Full Text]
  66. 34
  67. Underhill, D. M., Ozinsky, A., Hajjar, A. M., Stevens, A., Wilson, C. B., Bassetti, M., Aderem, A. (1999) The Toll-like receptor 2 is recruited to macropohage phagosomes and discriminates between pathogens Nature 401,811-815[CrossRef][Medline]
  68. 35
  69. Mambula, S. S., Sau, K., Henneke, P., Golenbock, D. T., Levitz, S. M. (2002) Toll-like receptor (TLR) signaling in response to Aspergillus fumigatus J. Biol. Chem. 277,39320-39326[Abstract/Free Full Text]
  70. 36
  71. Viriyakosol, S., Fierer, J., Brown, G. D., Kirland, T. N. (2005) Innate immunity to the pathogenic fungus Coccidioides posadasii is dependent on Toll-like receptor 2 and dectin-1 Infect. Immun. 73,1553-1560[Abstract/Free Full Text]
  72. 37
  73. Lebron, F., Vassallo, R., Puri, V., Llimper, A. H. (2003) Pneumocystis carinii cell wall ß-glucans initiate macrophage inflammatory responses through NF-{kappa}B activation J. Biol. Chem. 278,25001-25008[Abstract/Free Full Text]
  74. 38
  75. Zhang, C., Wang, S-H., Lasbury, M. E., Tschang, D., Liao, C-P., Durant, P. J., Lee, C-H. (2006) Toll-like receptor 2 mediates alveolar macrophage response to Pneumocystis murina Infect. Immun. 74,1857-1864[Abstract/Free Full Text]
  76. 39
  77. Limper, A. H., Offord, K. P., Smith, T. F., Martin, W. J., II (1989) Pneumocystis carinii pneumonia: differences in lung parasite number and inflammation in patients with and without AIDS Am. Rev. Respir. Dis. 140,1204-1209[Medline]
  78. 40
  79. Taylor, M. B., Phillips, M., Easmon, C. S. F. (1992) Opsonophagocytosis of Pneumocystis carinii J. Med. Microbiol. 36,223-228[Abstract/Free Full Text]
  80. 41
  81. Wright, T. W., Gigliotti, F., Finkelstein, J. N., McBride, J. T., An, C. L., Harmsen, A. G. (1999) Immune-mediated inflammation directly impairs pulmonary function, contributing to the pathogenesis of Pneumocystis carinii pneumonia J. Clin. Invest. 104,1307-1317[Medline]
  82. 42
  83. Mason, G., Hasimota, C., Dickman, P., Foutty, L., Cobb, C. (1989) Prognostic implications of bronchoalveolar lavage neutrophilia in patients with Pneumocystis carinii pneumonia and AIDS Am. Rev. Respir. Dis. 139,1336-1342[Medline]
  84. 43
  85. Kaner, R. J., Stover, D. E. (1989) Prognostic implications of bronchoalveolar lavage neutrophilia in patients with Pneumocystis carinii pneumonia and AIDS Am. Rev. Respir. Dis. 139,1322-1324[Medline]
  86. 44
  87. East, L., Isacke, C. M. (2002) The MR family Biochim. Biophys. Acta 1572,364-386[Medline]
  88. 45
  89. Tao, X., Xu, Y., Zheng, Y., Beg, A. A., Tong, L. (2002) An extensively associated dimer in the structure of the C713S mutant of the TIR domain of human TLR2 Biochem. Biophys. Res. Commun. 299,216-221[CrossRef][Medline]



This article has been cited by other articles:


Home page
Infect. Immun.Home page
M. P. Nelson, A. E. Metz, S. Li, C. A. Lowell, and C. Steele
The Absence of Hck, Fgr, and Lyn Tyrosine Kinases Augments Lung Innate Immune Responses to Pneumocystis murina
Infect. Immun., May 1, 2009; 77(5): 1790 - 1797.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
J. Hu, Y. Wang, and L. Xie
Potential Role of Macrophages in Experimental Keratomycosis
Invest. Ophthalmol. Vis. Sci., May 1, 2009; 50(5): 2087 - 2094.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. D. Tachado, X. Li, K. Swan, N. Patel, and H. Koziel
Constitutive Activation of Phosphatidylinositol 3-Kinase Signaling Pathway Down-regulates TLR4-mediated Tumor Necrosis Factor-{alpha} Release in Alveolar Macrophages from Asymptomatic HIV-positive Persons in Vitro
J. Biol. Chem., November 28, 2008; 283(48): 33191 - 33198.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
J. P. Mizgerd
Acute Lower Respiratory Tract Infection
N. Engl. J. Med., February 14, 2008; 358(7): 716 - 727.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Liang, M. Wang, R. I. Tapping, V. Stepensky, H. F. Nawar, M. Triantafilou, K. Triantafilou, T. D. Connell, and G. Hajishengallis
Ganglioside GD1a Is an Essential Coreceptor for Toll-like Receptor 2 Signaling in Response to the B subunit of Type IIb Enterotoxin
J. Biol. Chem., March 9, 2007; 282(10): 7532 - 7542.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.1005580v1
81/1/205    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tachado, S. D.
Right arrow Articles by Koziel, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tachado, S. D.
Right arrow Articles by Koziel, H.