Journal of Leukocyte Biology eBioscience full spectrum cell analysis
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.0306198 on October 5, 2006

Published online before print October 5, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0306198v1
81/1/108    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bianchi, R.
Right arrow Articles by Donato, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bianchi, R.
Right arrow Articles by Donato, R.
(Journal of Leukocyte Biology. 2007;81:108-118.)
© 2007 by Society for Leukocyte Biology

S100B binding to RAGE in microglia stimulates COX-2 expression

Roberta Bianchi, Cecilia Adami, Ileana Giambanco and Rosario Donato1

Department of Experimental Medicine and Biochemical Sciences, University of Perugia, Perugia, Italy

1Correspondence: Department of Experimental Medicine and Biochemical Sciences, Sect. Anatomy, University of Perugia, Via del Giochetto C.P. 81 Succ. 3, 06122 Perugia, Italy. E-mail: donato{at}unipg.it

ABSTRACT

Besides exerting regulatory roles within astrocytes, the Ca2+-modulated protein of the EF-hand type S100B is released into the brain extracellular space, thereby affecting astrocytes, neurons, and microglia. However, extracellular effects of S100B vary, depending on the concentration attained and the protein being trophic to neurons up to nanomolar concentrations and causing neuronal apoptosis at micromolar concentrations. Effects of S100B on neurons are transduced by receptor for advanced glycation end products (RAGE). At high concentrations, S100B also up-regulates inducible NO synthase in and stimulates NO release by microglia by synergizing with bacterial endotoxin and IFN-{gamma}, thereby participating in microglia activation. We show here that S100B up-regulates cyclo-oxygenase-2 expression in microglia in a RAGE-dependent manner in the absence of cofactors through independent stimulation of a Cdc42-Rac1-JNK pathway and a Ras-Rac1-NF-{kappa}B pathway. Thus, S100B can be viewed as an astrocytic endokine, which might participate in the inflammatory response in the course of brain insults, once liberated into the brain extracellular space.

Key Words: JNK • NF-{kappa}B • Ras • Cdc42 • Rac1

INTRODUCTION

Traumas, cerebrovascular accidents, infections, and degenerative and autoimmune processes in the CNS share a common inflammatory response in which microglia (i.e., the resident and dormant macrophage component of brain cells) and astrocytes become activated. Activated astrocytes and microglia release cytokines and other factors by which astrocytes and microglia can be activated further, a mechanism that is intended to protect neurons during early phases of brain insults but leads to amplification of the inflammatory response in latter phases [1 2 3 4 ]. The Ca2+-modulated protein of the EF-hand type S100B is considered to be one factor playing such a dual role [5 , 6 ].

Besides being implicated in the regulation of intracellular activities, S100B is also secreted into extracellular fluids and found in serum, thereby affecting cellular activities in a paracrine, autocrine, and endocrine manner [5 ]. For example, astrocytes, which probably represent the cell type with the highest expression of the protein [5 ], release S100B constitutively [7 ], and increases in S100B release occur upon astrocyte stimulation with a number of agents [8 9 10 ]. At the concentration found in the brain extracellular space under normal conditions (i.e., at subnanomolar-nanomolar concentrations), S100B mostly acts as neurotrophic factor, promoting neuronal survival under stress conditions and neurite outgrowth [11 12 13 ] and countering the stimulatory effect of neurotoxins on TNF-{alpha} release by microglia [14 ]. Thus, secreted S100B, which can be viewed as one factor involved in astrocyte-neuron communication, might be important during development and during the initial phases of brain insults as a protective agent toward neurons.

However, a growing body of evidence suggests that on accumulation in the brain extracellular space, S100B may be detrimental to astrocytes and neurons causing their death via apoptosis. Increases in the brain S100B amount have been reported in Alzheimer’s disease, temporal epilepsy, Down’s syndrome, and other brain pathological conditions [5 , 6 , 15 , 16 ]. It is notable that the human S100B gene maps to chromosome 21q22.23 [15 ], with consequent overexpression of the protein in Down’s syndrome [5 , 6 , 16 ]. Trophic effects of the protein on neurons depend on interaction with the receptor for advanced glycation end products (RAGE) [13 ], a multiligand receptor belonging to the Ig superfamily, which has been implicated in neuroprotection and neurodegeneration as well as in the inflammatory response [17 ]. However, acute stimulation of RAGE with relatively high doses of S100B causes neuronal apoptosis via excessive activation of ERK1/2 and overproduction of reactive oxygen species (ROS) [13 ]. In addition, at relatively high doses, S100B stimulates inducible NO synthase (iNOS) in astrocytes and microglia by synergizing with bacterial endotoxin and IFN-{gamma} in the case of microglia [18 19 20 ], an event that might contribute to astrocyte and neuronal apoptosis via increased NO production [21 ] and that suggests that S100B might participate in brain inflammatory response. However, although S100B binds to and activates RAGE in microglia [22 ], the ability of the protein to induce and stimulate iNOS in these cells was shown to be independent of RAGE-transducing activity, although dependent on the density of the RAGE extracellular domain on the microglial surface [23 ], suggesting the possibility that RAGE might concentrate S100B on the microglial cell surface, thereby favoring a RAGE signaling-independent stimulation of NO release by the protein via an unknown mechanism.

Yet, RAGE engagement by S100B in microglia in the absence of cofactors causes activation of the transcription factor NF-{kappa}B, suggesting that binding of S100B might stimulate RAGE-transducing activity [22 , 23 ]. Thus, we sought to analyze effects of S100B in microglia, which were dependent on RAGE-transducing activity. Cyclo-oxygenase 2 (COX-2) is an inducible enzyme that plays a key proinflammatory role in monocytes and microglia [24 ]. RAGE engagement up-regulated the expression of the proinflammatory COX-2 in monocytes [25 ], and up-regulation of COX-2 occurs in activated microglia [24 ]. Thus, we asked whether S100B might regulate COX-2 expression in microglia, the brain resident macrophages, the role of which in brain inflammatory processes, is well documented [26 , 27 ], and whether RAGE engagement by S100B results in regulation of COX-2 expression. We show here that the interaction of S100B with RAGE in microglia results in the up-regulation of expression of COX-2 by parallel activation of JNK via Cdc42/Rac1 signaling and stimulation of NF-{kappa}B transcriptional activity via Ras-Rac1 signaling.

MATERIALS AND METHODS

Protein purification
Recombinant bovine S100B was expressed and purified as reported [13 , 28 ]. Bovine S100B is 97% identical to mouse S100B, and S100B was passed through an END-X B15 endotoxin affinity resin column (Associates of Cape Cod, East Falmouth, MA) to remove contaminating bacterial endotoxin. Residual bacterial endotoxin was evaluated using the chromogenic Limulus amoebocyte lysates assay (Associates of Cape Cod). These tests indicated that bacterial endotoxin in the S100B preparation after passage through the END-X B15 endotoxin affinity resin amounted to <0.2 pg/µg. As a further test aimed at verifying whether contaminating bacterial endotoxin could be responsible for effects of S100B on microglia, a sample of the S100B preparation was heated at 100°C for 5 min before use. No effects of the protein on microglia were registered following this procedure. The S100B concentration was calculated using the molecular weight of the S100B dimer, i.e., 21 kDa.

Cell line
The murine BV-2 microglial cell line was obtained and characterized as described [20 , 29 , 30 ]. Cells were cultivated in RPMI containing 10% heat-inactivated FBS (Hyclone Laboratories, Logan, UK) supplemented with L-glutamine (4 mM) and gentamicin (5 µg/ml) in an H2O-saturated 5% CO2 atmosphere at 37°C. BV-2 microglia were tested periodically and resulted negative for mycoplasma contamination.

Transfections
BV-2 microglia stably transfected with human RAGE cDNA (BV-2/RAGE microglia), human RAGE{Delta}cyto cDNA (BV-2/RAGE{Delta}cyto microglia), or empty vector (BV-2/mock microglia) were obtained as described [23 ]. RAGE{Delta}cyto is a RAGE mutant lacking the cytoplasmic and transducing domain [22 , 31 ]. BV-2/wt microglia express RAGE [23 ], BV-2/RAGE microglia express larger amounts of the receptor, and BV-2/RAGE{Delta}cyto microglia express endogenous RAGE plus the signaling-deficient RAGE mutant RAGE{Delta}cyto [23 ]. Transient transfections were carried out using Lipofectamine 2000, as recommended by the manufacturer. Briefly, cells cultured in 10% FBS without antibiotics were transfected with expression plasmid N17Rac1, N17Cdc42, or N17Ras (constitutively inactive forms of Rac1, Cdc42, and Ras, respectively), I{kappa}B{alpha}SR (nonphophorylatable form of the NF-{kappa}B super-repressor inhibitor I{kappa}B{alpha}) [32 ], NF-{kappa}B-luc reporter gene, or empty vector. After 6 h, cells were shifted to 10% FBS for 20 h and then to 10% FBS containing no additions or S100B, as indicated in figure legends. After another 9 h, cells were solubilized for Western blot analyses (see below) or harvested to measure luciferase activity. Transfection efficiency was estimated by transfecting parallel cells with GFP cDNA. The percentage of GFP-positive cells (20–25%) was determined by FACS analysis. Parallel cells were analyzed for viability by trypan-blue exclusion assay and by a tetrazolium-based (MTT) colorimetric assay. No significant changes could be registered in the numbers of cells transfected with expression plasmids or empty vector (data not shown).

S100B treatment of BV-2 cells
BV-2/mock, BV-2/RAGE, and BV-2/RAGE{Delta}cyto microglia (5x105) were seeded in 24-multiwell plates in the presence or absence of S100B. Each sample was tested in triplicate. Where appropriate, the following kinase inhibitors were used: 30 µM PD98059 (an inhibitor of the ERK1/2 upstream kinase MEK; Calbiochem, San Diego, CA), 20 µM SB203580 (an inhibitor of p38 MAPK; Calbiochem), and 20 µM SP600125 (an inhibitor of JNK; Alexis Biochemicals Corp., San Diego, CA). In some experiments, the antioxidant N-acetylcysteine (NAC; 10 mM, Zambon, Italy), the NF-{kappa}B inhibitor pyrrolidine dithiocarbamate (PDTC; 50 µM, Sigma Chemical Co., St. Louis, MO), or Bay 11-7082 (5 µM, Calbiochem) was used. Inhibitors or NAC were added to BV-2 microglia 30 min before S100B. Parallel cells treated with inhibitors or NAC were analyzed for viability by trypan-blue exclusion assay and by a tetrazolium-based (MTT) colorimetric assay. No significant changes could be registered in the numbers of cells treated with any of the above agents or vehicle (data not shown).

Western blot analyses
COX-2 and phosphorylated (activated) JNK were detected in BV-2 cell extracts by Western blotting using a polyclonal anti-COX-2 antibody (1:1000, Santa Cruz Biotechnology, CA) and a polyclonal antiphosphorylated JNK (Thr183/Tyr185) antibody (1:1000, Cell Signaling Technology, Beverly, MA), respectively. A monoclonal anti-{alpha}-tubulin was used to monitor protein loading on SDS gels. Peroxidase-conjugated secondary antibodies were from Sigma Chemical Co. Antibodies were diluted in blocking buffer (10 mM Tris-HCl, pH 7.4, 0.1 M NaCl, 5% nonfat dried milk powder, 0.1% Tween 20). Cells were exposed to S100B for 9 h. To produce cell extracts, BV-2 cells were solubilized with 2.5% SDS, 10 mM Tris-HCl, pH 7.4, 0.1 M DTT, 0.1 mM tosyl phenylalanine chloromethyl ketone protease inhibitor (Roche, Nutley, NJ). The immune reaction was developed by ECL (SuperSignal West Pico, Pierce, Rockford, IL).

RT-PCR
Total cytoplasmic RNA was isolated from BV-2 microglia using the Tri-Zol reagent method. Subsequent steps were done as described [20 ]. The expression of COX-2 was analyzed by RT-PCR using the following COX-2-specific oligonucleotides: (5'–3') CAGCAAATCCTTGCTGTTCC (forward primer; 500 nM) and (5'–3') TGGGCAAAGAATGCAAACATC (reverse primer 1; 500 nM). The following oligonucleotide forward and reverse sequences were used for GAPDH: CCTTCATTGACCTCAACTACATGG and AGTCTTCTGGGTGGCAGTGATGG. The expected PCR products were 512 bp for COX-2 and 654 bp for GAPDH. After amplification, samples (20 µl) of each PCR mixture were electrophoresed on a 1.2% agarose gel, and RT-PCR products were revealed by ethidium bromide staining.

Immunofluorescence
For immunofluorescence analysis, BV-2 cells (3x104), treated with or without S100B, were seeded onto 1.3 cm glass coverslips in 24-well plates, washed in PBS, fixed in ice-cold methanol (7 min at –20°C), treated with 0.1% (v/v) Triton X-100 in PBS for 5 min at room temperature, and rinsed in PBS. Nonspecific binding of antibodies was blocked by preliminary incubation of fixed cells with 3% BSA, 2% normal goat serum, and 1% glycine in PBS. This was followed by an incubation at room temperature for 1 h with a goat polyclonal anti-COX-2 antibody (Santa Cruz Biotechnology) diluted 1:20 or a rabbit polyclonal anti-p65 NF-{kappa}B antibody (Santa Cruz Biotechnology) diluted 1:20, both in 3% (w/v) BSA, 0.1% Tween 20 in PBS, three washings in 0.1% Tween 20 in PBS, and two washings in PBS, incubation with rhodamine-labeled secondary antibody for 1 h, and washings as above. Cells were counterstained with 4'-6, diamidino-2-phenylindole (DAPI; Sigma Chemical Co.) diluted 1:10,000 in 3% (w/v) BSA, 0.1% Tween 20 in PBS. The cells were mounted in 80% glycerol, containing 0.02% NaN3 and p-phenylenediamine (1 mg/ml) in PBS. The antibody incubations were done in a humid chamber. Immunofluorescence microscopy was performed on a Leica DM Rb fluorescence microscope equipped with a digital camera. In control experiments, the primary antibody was omitted, or nonimmune goat IgG (for COX-2 immunofluorescence) or nonimmune rabbit IgG (for NF-{kappa}B) was used. No fluorescence signal was detected under either condition.

Statistical analysis
Each experiment was repeated at least three times. Representative experiments are depicted in the figures unless stated otherwise. The data were subjected to ANOVA with Student-Newman-Keul’s post-hoc analysis using a statistical software package (GraphPad Prism Version 4.00, GraphPad Software, San Diego, CA). Statistical significance was assumed when P < 0.05.

RESULTS

S100B up-regulates COX-2 expression in microglia in a RAGE-dependent manner
BV-2/wt microglia were exposed to increasing concentrations of S100B and processed for Western blotting with an anti-COX-2 antibody (Fig. 1A ). BV-2/wt microglia were observed to express a certain amount of COX-2 in the absence of added S100B, likely as they exhibit characteristics of activated microglia [20 , 30 ], and S100B stimulated COX-2 expression by ~100% at ~4 µM with a half-maximal effect at ~1 µM. Experiments performed in the absence or presence of a fixed S100B concentration (2 µM) for varying times showed that a maximal increment in the expression of COX-2 protein exposed to S100B was registered at 9 h (data not shown). Having ascertained that S100B up-regulates COX-2 expression in BV-2 microglia, we next analyzed the role of RAGE in S100B-induced up-regulation of COX-2 expression using BV-2 microglia clones stably transfected with full-length RAGE (BV-2/RAGE microglia), the signaling-deficient RAGE mutant RAGE{Delta}cyto (BV-2/RAGE{Delta}cyto microglia), or empty vector (BV-2/mock microglia) [23 ].


Figure 1
View larger version (36K):
[in this window]
[in a new window]

  		Figure 1. S100B stimulates COX-2 expression in BV-2 microglia in a dose- and RAGE-dependent manner. (A) Wild-type BV-2 microglia were exposed to increasing concentrations of S100B for 9 h, washed, solubilized, and processed by Western blotting using an anti-COX-2 antibody. S100B causes a dose-dependent increase in COX-2 expression beginning from ~0.25 µM. (B) BV-2/mock, BV-2/RAGE{Delta}cyto, and BV-2/RAGE microglia were cultivated for 2 h in the absence or presence of 2 µM S100B. Shown are PCR products obtained with mouse COX-2 primers. GAPDH PCR product is shown as a control. M, molecular size standards. (C) Conditions were as in B, except that cells were cultivated for 9 h in the absence or presence of 2 µM S100B, and COX-2 was analyzed by Western blotting. (D) Conditions were as in A, except that BV-2/RAGE microglia were used. S100B causes a dose-dependent increase in COX-2 expression. (E) Conditions were as in C, except that cells were fixed and immunostained with an anti-COX-2 antibody and counterstained with DAPI to show nuclei. Semiquantitative analyses of data from three independent experiments ± SD are presented in panels on the right of Western blots. One representative experiment of three with similar results (E). *, Significantly different from control (first column or experimental point from left in each group in A–D; P<0.05). **, Significantly different from the corresponding BV-2/mock and BV-2/RAGE{Delta}cyto column (B and C; P<0.05).

 
BV-2/wt microglia were exposed to S100B (2 µM) for varying times between 0.5 and 24 h. S100B caused a maximal increment in the expression of COX-2 mRNA in BV-2/wt microglia at 2 h (data not shown). Relative to GAPDH, exposure to 2 µM S100B for 2 h resulted in an ~70% increase in COX-2 mRNA in BV-2/mock microglia and an ~220% increase in BV-2/RAGE microglia, and no effect of the protein on BV-2/RAGE{Delta}cyto microglia could be observed (Fig. 1B) . At the protein level, all three BV-2 clones tested exhibited expression of a certain amount of COX-2 (Fig. 1C) . However, after 9 h of incubation, S100B (2 µM) increased the levels of COX-2 protein expression by ~90% in BV-2/mock microglia and by ~200% in BV-2/RAGE microglia, and no effect of the protein on BV-2/RAGE{Delta}cyto microglia could be observed (Fig. 1C) . Also, S100B caused a dose-dependent increase in the levels of COX-2 in BV-2/RAGE microglia (Fig. 1D) , with a larger stimulatory effect at any S100B concentration compared with wild-type BV-2 microglia. Thus, the increased RAGE density on the cell surface in BV-2/RAGE microglia made microglia more sensitive to S100B. Moreover, by immunofluorescence, S100B-treated BV-2/RAGE microglia showed a more intense COX-2 signal than BV-2/mock microglia, and BV-2/RAGE{Delta}cyto microglia showed a less intense signal, irrespective of the absence or presence of S100B, and the intensity of the fluorescence signal was similar to that of BV-2/mock and BV-2/RAGE microglia in the absence of S100B (Fig. 1E) . Collectively, these data suggested that S100B stimulated COX-2 expression in microglia in a RAGE-dependent manner and that lower concentrations of S100B were required to up-regulate COX-2 in microglia overexpressing RAGE.

S100B up-regulates COX-2 expression via parallel activation of JNK and stimulation of NF-{kappa}B transcriptional activity
As previous work has shown that S100B stimulates JNK and p38 MAPK activation in BV-2 microglia [23 ], we analyzed effects of the pharmacological inactivation of these signaling kinases on COX-2 expression in the absence or presence of S100B. Inactivation of p38 MAPK by use of SB203580 was virtually without effect on basal and S100B-induced COX-2 levels (Fig. 2A ), suggesting that S100B/RAGE was not using p38 MAPK to stimulate COX-2 expression in BV-2 microglia. By contrast, inactivation of JNK with SP600125 resulted in a reduction of the levels of COX-2 protein in S100B-stimulated BV-2/mock and BV-2/RAGE microglia to those detected in their respective controls (Fig. 2A) , suggesting that an intact JNK activity was required for S100B/RAGE to up-regulate COX-2 expression in microglia. Inactivation of the MEK-ERK1/2 pathway with PD98059 or the simultaneous inactivation of p38 MAPK and MEK-ERK1/2 also resulted in no effects on the ability of S100B to up-regulate COX-2 expression, and the simultaneous inactivation of JNK and p38 MAPK or MEK-ERK1/2 resulted in negation of the ability of S100B to up-regulate COX-2 expression (Fig. 2B) . Collectively, these data suggested that JNK activation was necessary and sufficient for S100B to up-regulate COX-2 in BV-2 microglia via RAGE engagement and that no cross-talk among the JNK, p38 MAPK, and MEK-ERK1/2 pathways appeared to occur in S100B-treated BV-2 microglia with respect to COX-2 up-regulation.


Figure 2
View larger version (54K):
[in this window]
[in a new window]

  		Figure 2. S100B/RAGE-induced up-regulation of COX-2 expression in BV-2 microglia depends on NF-{kappa}B transcriptional activity and JNK activation. (A, B) BV-2/mock, BV-2/RAGE{Delta}cyto, and BV-2/RAGE microglia were cultivated for 9 h in the absence or presence of 2 µM S100B plus or minus the indicated inhibitors (see Materials and Methods). Inhibitors were added to BV-2 microglia cultures 30 min before adding S100B. Cells were then processed by Western blotting with an anti-COX-2 antibody. (C) Conditions were as in A and B, except that cells were transiently transfected with I{kappa}B{alpha}SR before Western blotting with an anti-COX-2 antibody. Semiquantitative analyses of data from three independent experiments ± SD are presented in panels on top of Western blots. *, Significantly different from control (first column from left in each group in A–C; P<0.05).

 
Previous work has shown that the interaction of S100B with BV-2 microglia results in RAGE signaling-independent ROS production [23 ] and RAGE signaling-dependent stimulation of NF-{kappa}B transcriptional activity [22 , 23 ]. Administration of the antioxidant NAC (Fig. 2A) or {alpha}-tocopherol (data not shown) did not significantly change basal or S100B-stimulated COX-2 expression in BV-2/mock and BV-2/RAGE microglia. However, the NF-{kappa}B inhibitor PDTC, which is also an antioxidant, remarkably reduced S100B-stimulated COX-2 expression (Fig. 2A) , suggesting that ROS production and most importantly, NF-{kappa}B activity might be required for S100B to up-regulate COX-2 expression. To confirm an involvement of NF-{kappa}B in S100B/RAGE-induced stimulation of COX-2 expression, individual BV-2 microglia clones were transiently transfected with the NF-{kappa}B super-repressor I{kappa}B{alpha}SR. Under these conditions, again, S100B-stimulated COX-2 expression was reduced in BV-2/mock and BV-2/RAGE microglia (Fig. 2C) , thus establishing that one effect of S100B/RAGE-dependent stimulation of NF-{kappa}B transcriptional activity [22 , 23 ] was up-regulation of COX-2 expression. These data suggested that analogous to JNK activation (Fig. 2A) , NF-{kappa}B activation was necessary and sufficient for S100B to up-regulate COX-2 in BV-2 microglia.

Collectively, our results suggested that S100B/RAGE ligation might up-regulate COX-2 expression in microglia with equal potency via an independent activation of two distinct factors, i.e., JNK and NF-{kappa}B.

S100B/RAGE-induced stimulation of COX-2 expression in BV-2 microglia depends on Cdc42, Rac1, and/or Ras activation
To have information about the intermediate(s) linking S100B/RAGE to JNK, individual BV-2 microglia clones were transiently transfected with inactive mutants of the small guanosinetriphosphatases (GTPases), Cdc42, Rac1, and Ras. Cdc42, Rac1, and Ras have been reported to be activated by RAGE [31 , 33 , 34 ] and to signal to JNK [35 , 36 ], and RAGE has been shown to activate JNK [33 , 37 ]. Transfection with inactive Cdc42, inactive Rac1, or inactive Ras resulted in a reduction of S100B-stimulated COX-2 expression (Fig. 3 ) and JNK phosphorylation (Fig. 4A ), implying that RAGE, activated by S100B, might signal to these small GTPases to activate JNK, which in turn, up-regulates COX-2 expression.


Figure 3
View larger version (37K):
[in this window]
[in a new window]

  		Figure 3. S100B/RAGE-induced up-regulation of COX-2 expression in BV-2 microglia depends on Cdc42, Rac1, and Ras activity. Conditions were as in Figure 2C , except that cells were transiently transfected with expression plasmid N17Rac1, N17Cdc42, or N17Ras (constitutively inactive forms of Rac1, Cdc42, and Ras, respectively) before cultivation for 9 h in the absence or presence of 2 µM S100B followed by Western blotting with an anti-COX-2 antibody. Semiquantitative analyses of data from three independent experiments ± SD are presented in panels on top of Western blots. *, Significantly different from control (P<0.05).

 

Figure 4
View larger version (15K):
[in this window]
[in a new window]

  		Figure 4. S100B/RAGE activates JNK and NF-{kappa}B transcriptional activity via Cdc42, Rac1, and Ras in BV-2 microglia. (A) Wild-type BV-2 microglia were transiently transfected with expression plasmid N17Rac1, N17Cdc42, or N17Ras, cultivated for 9 h in the absence or presence of 2 µM S100B, and subjected to Western blotting with an antiphosphorylated JNK (pho-JNK) antibody. A semiquantitative analysis of data from three independent experiments ± SD is presented in the panel on top of the Western blot. *, Significantly different from control (P<0.01). (B) BV-2/mock, BV-2/RAGE{Delta}cyto, and BV-2/RAGE microglia were transiently transfected with the NF-{kappa}B-luc reporter gene and with expression plasmid N17Rac1, N17Cdc42, or N17Ras or empty vector and processed as described in Materials and Methods, in the absence or presence of 2 µM S100B. Averages of three independent experiments ± SD (B). *, Significantly different from internal control (first column from left in each group in B; P<0.01).

 
S100B/RAGE up-regulates COX-2 expression in microglia by stimulating NF-{kappa}B transcriptional activity via Ras-Rac1
We confirmed that S100B was able to stimulate NF-{kappa}B transcriptional activity in a RAGE-dependent manner [22 , 23 ] in that the protein caused an approximate fourfold stimulation of NF-{kappa}B transcriptional activity in BV-2/mock microglia but was unable to stimulate NF-{kappa}B transcriptional activity in BV-2/RAGE{Delta}cyto microglia (Fig. 4B) . BV-2/RAGE microglia displayed higher levels of basal NF-{kappa}B transcriptional activity compared with BV-2/mock microglia, which in turn displayed higher levels of basal NF-{kappa}B transcriptional activity compared with BV-2/RAGE{Delta}cyto microglia. S100B caused a likewise approximate fourfold stimulation of NF-{kappa}B transcriptional activity in BV-2/RAGE microglia (Fig. 4B) . Collectively, these data suggested that endogenous RAGE in untreated BV-2 microglia [22 , 23 ] might be activated by factors present in the culture medium, thereby signaling to NF-{kappa}B, and although S100B caused similar percent increments in NF-{kappa}B transcriptional activity in BV-2/mock microglia and BV-2/RAGE microglia compared with their respective controls, the higher levels of S100B-dependent NF-{kappa}B activation BV-2/RAGE microglia might point to increased extents of NF-{kappa}B-dependent responses compared with BV-2/mock microglia in the presence of the protein. The identity of culture medium factors responsible for the larger NF-{kappa}B activation observed in BV-2/mock microglia compared with BV-2/RAGE microglia under basal conditions remains to be elucidated. As commercial FBS contains low but measurable amounts of S100B and high mobility group box protein 1 (HMGB1; amphoterin), another RAGE ligand [34 , 38 ], we cannot exclude that serum S100B and/or HMGB1 might contribute to engage RAGE in BV-2/mock microglia. Other possibilities cannot be excluded, however. It is worth noting that BV-2 microglia show characteristics of activated microglia in that they express RAGE (contrary to microglia in normal brain tissue) and basal amounts of COX-2 and are able to engulf microorganisms and foreign bodies.

We next addressed the question how S100B/RAGE signals to NF-{kappa}B to cause COX-2 up-regulation. To answer this question, we transiently transfected BV-2/mock, BV-2/RAGE{Delta}cyto, and BV-2/RAGE microglia with inactive Cdc42, Rac1, or Ras and analyzed NF-{kappa}B transcriptional activity following exposure to S100B. Under these conditions, S100B was no longer able to stimulate NF-{kappa}B transcriptional activity (Fig. 4B) . As under these same conditions, S100B/RAGE was no longer able to up-regulate COX-2 (Fig. 4A) and as Ras signals to Rac1, which in turn signals to NF-{kappa}B [39 40 41 42 ], we concluded that by engaging RAGE in microglia, S100B might up-regulate COX-2 via a Ras-Rac1-NF-{kappa}B pathway.

The ability of S100B to activate NF-{kappa}B in BV-2 cells was confirmed by analyzing NF-{kappa}B nuclear translocation by immunofluorescence. S100B caused a rapid (within 15–30 min) accumulation of NF-{kappa}B in nuclei in BV-2/mock and BV-2/RAGE microglia (Fig. 5 ), which was abolished in the presence of the NF-{kappa}B inhibitor, Bay 11-7082 (data not shown), and a diffuse cytoplasmic localization of NF-{kappa}B was detected in the absence of S100B treatment as well as in the presence of Bay 11-7082 plus or minus S100B (Fig. 5) . Moreover, no NF-{kappa}B nuclear translocation could be detected in S100B-treated BV-2/RAGE{Delta}cyto microglia (Fig. 5) .


Figure 5
View larger version (26K):
[in this window]
[in a new window]

  		Figure 5. S100B causes nuclear translocation of NF-{kappa}B in BV-2 microglia in a RAGE-dependent manner. Conditions were as described in the legend to Figure 1E , except that cells were incubated in the absence or presence of 2 µM S100B for 30 min plus or minus the NF-{kappa}B inhibitor Bay 11-7082 (5 µM), fixed and immunostained with a rabbit polyclonal anti-p65 NF-{kappa}B antibody, and counterstained with DAPI to show nuclei, as described in Materials and Methods. Where appropriate, Bay 11-7082 was administered to cells 30 min before addition of S100B. In the absence of S100B, p65 immunofluorescence is restricted to the cytoplasm, and in cells treated with S100B, p65 immunofluorescence mostly has a nuclear localization (violet in merge panels), pointing to nuclear translocation of NF-{kappa}B in BV-2/mock and BV-2/RAGE microglia but not BV-2/RAGE{Delta}cyto microglia. Treatment of BV-2/mock microglia with Bay 11-7082 prevents S100B-induced nuclear translocation of NF-{kappa}B. One representative experiment of three is shown.

 
It is important that S100B was still able to increase JNK phosphorylation in the presence of the NF-{kappa}B inhibitor Bay 11-7082 in BV-2 microglia (Fig. 6A ) and showed a slightly increased ability to stimulate NF-{kappa}B transcriptional activity in the presence of the JNK inhibitor SP600125 (Fig. 6B) , substantiating the conclusion that S100B regulates COX-2 expression in BV-2 microglia by independently stimulating JNK and NF-{kappa}B.


Figure 6
View larger version (14K):
[in this window]
[in a new window]

  		Figure 6. S100B causes independent activation of JNK and NF-{kappa}B in BV-2 microglia. (A) Conditions were as described in the legend to Figure 4A , except that cells were cultivated for 9 h in the absence or presence of 2 µM S100B plus or minus the NF-{kappa}B inhibitor Bay 11-7082 (2 µM) and subjected to Western blotting with an antiphosphorylated JNK antibody. Where appropriate, Bay 11-7082 was administered to the cells 30 min in advance with respect to S100B. Inhibition of NF-{kappa}B does not interfere with the ability of S100B to activate JNK. A semiquantitative analysis of data from three independent experiments ± SD is presented in the panel on top of the Western blot. *, Significantly different from control (P<0.01). (B) Conditions were as described in the legend to Figure 4B , except that BV-2 microglia received the JNK inhibitor SP600125 or vehicle (control). Inhibition of JNK does not interfere with the ability of S100B to activate NF-{kappa}B. *, Significantly different from control (n=3, P<0.01).

 
DISCUSSION

The pathogenesis and pathophysiology of neurodegenerative processes are not understood completely, as are the immune and molecular mechanisms of neuroinflammation. There is consensus that brain insults of a different nature (infections, traumas, vascular or metabolic disturbances, genetic factors) may trigger inflammatory responses of a different entity in different parts of the CNS [1 2 3 4 ]. These responses are beneficial if short-lived and detrimental if long-lasting [1 ]. Cellular elements (astrocytes, microglial cells) and molecules (cytokines, chemokines) come into play in the inflammatory response and its perpetuation [1 2 3 4 ]. It is conceivable that besides factors canonically implicated in the inflammatory response (i.e., cytokines and chemokines), other factors, including members of the S100 protein family [5 , 6 , 43 , 44 ], can act to sustain the inflammatory response or to determine direct effects on neurons, astrocytes, and/or microglia, thus switching the inflammatory response to a long-lasting process ending in neuronal death. A detailed knowledge of the pathophysiology underlying neuroinflammation and neurodegenerative processes and of the timing of the coming into play of the individual factors implicated in such processes seems essential, not only for diagnostic and prognostic but also potentially, for therapeutical purposes. Several cytokines exhibit a dual role: At low concentrations, they exert a trophic and protective effect, and at high concentrations, they are detrimental (causing cell death, which is followed by a further activation of astrocytes and microglial cells that respond to cell death by liberating further amounts of cytokines and releasing increasing amounts of NO, responses that are destined to perpetuate a detrimental chain of events).

Microglial cells represent a population of resident brain macrophages, which are able to phagocytose and are involved in immune and inflammatory reactions [3 , 4 , 26 , 27 ]. They have been demonstrated to act as APC and to produce and secrete proinflammatory cytokines such as IL-1, IL-6, and TNF-{alpha}. Microglial cells phagocyte cellular debris and by secreting toxic factors, play a role in the selection of neuronal population during brain development, e.g., through axonal remodeling. However, microglial cells also secrete trophic factors such as IL-1 and basic fibroblast growth factor [45 , 46 ]. These data, together with those on cytotoxic effects of these cells, suggest that microglia play a dual role, beneficial in their quiescent state and neurotoxic following their activation subsequent to a brain insult.

An increasing body of evidence suggests that the Ca2+-modulated protein of the EF-hand type S100B might play a role in brain trophism by acting as an intracellular regulator and an extracellular signal [5 , 6 ]. Also, extracellular S100B might regulate astrocytic, neuronal, and microglial activities, in part, via engagement of RAGE [5 , 6 ], which originally discovered as a receptor for advanced glycation end products [47 ], is a multiligand receptor belonging to the Ig superfamily that can be engaged by HMGB1 (amphoterin) and certain members of the S100 protein family including S100B and ß-amyloid, besides advanced glycation end products [17 , 22 ]. RAGE is expressed in several cell types during development, repressed at completion of development, and re-expressed in the course of pathological conditions such as inflammatory processes, cancer, and neurodegeneration [17 ]. Expression of RAGE in the adult brain in the course of neurodegenerative processes has been documented; RAGE was shown to be expressed in certain neuronal populations and microglia, with enhanced expression in microglia in the brain from Alzheimer’s disease patients [48 ].

In the brain, S100B is expressed mainly in astrocytes, such that it is often taken as an astrocyte marker [5 , 6 ]. As an intracellular factor, S100B has been implicated in the regulation of cell proliferation and survival [49 50 51 ], of cell shape [28 , 52 53 54 ], and of Ca2+ homeostasis [55 ]. However, S100B can be secreted by astrocytes [7 ], thereby affecting neuronal, astrocytic, and microglial functions. In particular, once released by astrocytes into the brain extracellular space, S100B exerts a dual effect on brain cells, acting as a neurotrophic factor at low (i.e., nanomolar) concentrations and as a toxic factor at high (i.e., micromolar) concentrations [5 , 6 , 8 9 10 11 12 13 14 , 16 , 18 19 20 21 22 23 ]. S100B binding to RAGE in microglia causes NF-{kappa}B activation [22 , 23 ], suggesting that the protein is able to stimulate RAGE-transducing activity in these cells. As RAGE-dependent NF-{kappa}B activation in monocytes and microglia results in up-regulation of COX-2 [25 ], a key enzyme in the inflammatory response [24 ], we analyzed effects of S100B on COX-2 levels in BV-2 microglia, a widely used microglial cell line that retains the phenotypic and functional characteristics of microglial cells [20 , 29 , 30 ].

We found that at concentrations that are likely to be attained in the brain extracellular compartment in the course of brain insults and by activating RAGE, S100B up-regulates the expression of the proinflammatory COX-2 in microglia by independently stimulating JNK via a Cdc42/Rac1 pathway and NF-{kappa}B transcriptional activity via a Ras/Rac1 pathway. These two pathways appear to be equally important for the S100B/RAGE-dependent up-regulation of COX-2, given that the blockade of NF-{kappa}B or JNK results in the complete negation of the S100B/RAGE effect. The most likely explanation for this result is that the two pathways are centered on Rac1, which independently activates NF-{kappa}B and JNK (Fig. 7 ). Precedent exists for regulation of protein expression by a single ligand and its receptor via two distinct intracellular pathways [56 ]. Whether S100B also activates TLRs in microglia as reported for HMGB1 (amphoterin) [57 ] remains to be established.


Figure 7
View larger version (30K):
[in this window]
[in a new window]

  		Figure 7. Schematic representation of the proposed mechanism of S100B/RAGE-dependent up-regulation of COX-2 expression in BV-2 microglia. Bay11-7082, PDTC, and I{kappa}B{alpha}SR are inhibitors of NF-{kappa}B, and SP600125 is a specific inhibitor of JNK. The Ras and Cdc42 pathways activated by S100B/RAGE likely converge onto Rac1 with parallel and independent activation of JNK and NF-{kappa}B, which stimulate COX-2 expression. N, nucleus.

 
COX-2 is an inducible enzyme, which is expressed rapidly in several cell types in response to growth factors, cytokines, and proinflammatory molecules, and is a major player in inflammatory reactions in peripheral tissues [24 , 58 ]. COX-2 expression in the brain has been associated with proinflammatory activities considered to be important in the neurodegenerative processes occurring in several acute and chronic diseases. Although in the brain, COX-2 is expressed under normal conditions and contributes to synaptic plasticity, memory consolidation, and functional hyperhemia, its up-regulation in microglia might represent a means whereby microglia respond to activating agents in several pathological conditions [24 , 58 ]. The present data showing that S100B up-regulates COX-2 expression in microglia suggest that S100B might be one factor contributing to activate microglia in the course of brain insults.

High concentrations of S100B in the brain extracellular compartment can be attained following astrocyte death, S100B leakage from damaged astrocytes, and/or defective clearance of extracellular S100B, all of which have conditions expected to occur in the injured brain. Although it is difficult to ascertain the accumulation of S100B experimentally in the brain extracellular space following insults, it is long known that brain S100B levels are elevated in brain traumas, multiple sclerosis, Alzheimer’s disease, chronic epilepsy, Down’s syndrome, HIV infection, and Creutzfeld-Jakob disease [5 , 6 , 15 , 16 , 59 ], conditions in which astrocyte activation and/or damage occur, and increased levels of the protein are measured in the cerebrospinal liquid and/or serum. The presence of increased levels of cerebrospinal fluid and/or serum S100B in those pathological conditions clearly points to liberation of large amounts of astrocytic S100B; thus, the concentration of S100B at the sites of damage is expected to be high. In vitro analyses have documented that at concentrations up to a few hundred nanomolar, S100B is trophic to neurons and counters astrocyte and microglia activation [5 , 6 , 13 , 14 , 60 ], and at submicromolar-micromolar concentrations, the protein is toxic to neurons and activates astrocytes and microglia [13 , 18 , 20 , 21 , 23 , 60 ]. It is notable that S100B transgenic mice show enhanced susceptibility to perinatal hypoxia-ischemia and to intracerebroventricular infusion of human ß-amyloid [61 , 62 ]. Besides, at relatively high doses, S100B up-regulates RAGE expression in neuronal cell lines [60 ], and BV-2 microglia (unpublished data) and the up-regulated RAGE might amplify the proapoptotic effect of S100B on neurons [60 ] and S100B effects on microglia with resulting enhancement of microglia responses. Moreover, the nonreducing conditions found outside the brain cells might favor S100B oxidation and hence, the formation of disulfide cross-linked S100B multimers [63 , 64 ], which might persist in the extracellular space and chronically activate RAGE, thereby amplifying the inflammatory response. We speculate that by this mechanism, S100B might participate in microglia activation in the course of brain insults and that the ability of S100B to up-regulate COX-2 in microglia adds to the reported ability of the protein to stimulate IL-1ß release in microglia [65 ].

In conclusion, the picture emerging from these studies is that by binding to RAGE, S100B up-regulates the expression of the proinflammatory COX-2 in microglia. This effect might contribute to the activation of microglia and the amplification of the inflammatory response in the injured brain, which might have interesting implications for our understanding of the pathophysiology of neurodegenerative processes and brain metabolic, traumatic, autoimmune, and infectious diseases. In this respect, S100B can be viewed as an astrocytic endokine, i.e., a protein that is normally synthesized by astrocytes and intervenes in the regulation of certain intracellular activities [5 ] but that can be released into the extracellular space, thereby participating in the regulation of the activity of target cells.

ACKNOWLEDGEMENTS

This work was supported by Ministero dell’Istruzione, dell’Università e della Ricerca-University of Perugia (FIRB 2001, RBAU014TJ8_001), and Fondazione Cassa di Risparmio di Perugia (Project 2004.0282.020_001) funds to R. D. We thank Heikki Rauvala (Helsinki, Finland) for providing the RAGE, RAGE{Delta}cyto, N17Rac1, N17Cdc42, and N17Ras constructs and Pier Lorenzo Puri (La Jolla, CA) for the NF-{kappa}B-luc and I{kappa}B{alpha}SR constructs. The authors declare no conflict of interest.

Received March 14, 2006; revised July 26, 2006; accepted August 6, 2006.

REFERENCES

  1. Martiney, J. A., Cuff, C., Litwak, M., Berman, J., Brosnan, C. F. (1998) Cytokine-induced inflammation in the central nervous system revisited Neurochem. Res. 23,349-359[CrossRef][Medline]
  2. Cartier, L., Hartley, O., Dubois-Dauphin, M., Krause, K. H. (2005) Chemokine receptors in the central nervous system: role in brain inflammation and neurodegenerative diseases Brain Res. Brain Res. Rev. 48,16-42[CrossRef][Medline]
  3. Hauwel, M., Furon, E., Canova, C., Griffiths, M., Neal, J., Gasque, P. (2005) Innate (inherent) control of brain infection, brain inflammation and brain repair: the role of microglia, astrocytes, "protective" glial stem cells and stromal ependymal cells Brain Res. Brain Res. Rev. 48,220-233[CrossRef][Medline]
  4. Town, T., Nikolic, V., Tan, J. (2005) The microglial "activation" continuum: from innate to adaptive responses J. Neuroinflammation 2,24[CrossRef][Medline]
  5. Donato, R. (2001) S100: a multigenic family of calcium-modulated proteins of the EF-hand type with intracellular and extracellular functional roles Int. J. Biochem. Cell Biol. 33,637-668[CrossRef][Medline]
  6. Van Eldik, L. J., Wainwright, M. S. (2003) The Janus face of glial-derived S100B: beneficial and detrimental functions in the brain Restor. Neurol. Neurosci. 21,97-108[Medline]
  7. Van Eldik, L. J., Zimmer, D. B. (1987) Secretion of S100 from rat C6 glioma cells Brain Res. 436,367-370[CrossRef][Medline]
  8. Whitaker-Azmitia, P. M., Murphy, R., Azmitia, E. C. (1990) S100 protein is released from astroglial cells by stimulation of 5-HT1A receptors Brain Res. 528,155-158[CrossRef][Medline]
  9. Ciccarelli, R., Di Iorio, P., Bruno, V., Battaglia, G., D’Alimonte, I., D’Onofrio, M., Nicoletti, F., Caciagli, F. (1999) Activation of A1 adenosine or mGlu3 metabotropic glutamate receptors enhances the release of nerve growth factor and S100ß protein from cultured astrocytes Glia 27,275-281[CrossRef][Medline]
  10. Pinto, S. S., Gottfried, C., Mendez, A., Goncalves, D., Karl, J., Gonçalves, C. A., Wofchuk, S., Rodnight, R. (2000) Immunocontent and secretion of S100B in astrocyte cultures from different brain regions in relation to morphology FEBS Lett. 486,203-207[CrossRef][Medline]
  11. Kligman, D., Marshak, D. R. (1985) Purification and characterization of a neurite extension factor from bovine brain Proc Natl. Acad. Sci. USA 82,7136-7139[Abstract/Free Full Text]
  12. Winningham-Major, F., Staecker, J. L., Barger, S. W., Coats, S., Van Eldik, L. J. (1989) Neurite extension and neuronal survival activities of recombinant S100ß proteins that differ in the content and position of cysteine residues J. Cell Biol. 109(6 Pt. 1),3063-3071[Abstract/Free Full Text]
  13. Huttunen, H. J., Kuja-Panula, J., Sorci, G., Agneletti, A. L., Donato, R., Rauvala, H. (2000) Coregulation of neurite outgrowth and cell survival by amphoterin and S100 proteins through RAGE activation J. Biol. Chem. 275,40096-40105[Abstract/Free Full Text]
  14. Reali, C., Scintu, F., Pillai, R., Donato, R., Michetti, F., Sogos, V. (2005) S100B counteracts effects of the neurotoxicant trimethyltin on astrocytes and microglia J. Neurosci. Res. 81,677-686[CrossRef][Medline]
  15. Allore, R., O’Hanlon, D., Price, R., Neilson, K., Willard, H. F., Cox, D. R., Marks, A., Dunn, R. J. (1988) Gene encoding the ß subunit of S100 protein is on chromosome 21: implications for Down’s syndrome Science 239,1311-1313[Abstract/Free Full Text]
  16. Griffin, W. S., Sheng, J. G., Royston, M. C., Gentleman, S. M., McKenzie, J. E., Graham, D. I., Roberts, G. W., Mrak, R. E. (1998) Glial-neuronal interactions in Alzheimer’s disease: the potential role of a "cytokine cycle" in disease progression Brain Pathol. 8,65-72[Medline]
  17. Schmidt, A. M., Yan, S. D., Yan, S. F., Stern, D. M. (2001) The multiligand receptor RAGE as a progression factor amplifying immune and inflammatory responses J. Clin. Invest. 108,949-955[CrossRef][Medline]
  18. Hu, J., Castets, F., Guevara, J. L., Van Eldik, L. J. (1996) S100ß stimulates inducible nitric oxide synthase activity and mRNA levels in rat cortical astrocytes J. Biol. Chem. 271,2543-2547[Abstract/Free Full Text]
  19. Petrova, T. V., Hu, J., Van Eldik, L. J. (2000) Modulation of glial activation by astrocyte-derived protein S100B: differential responses of astrocyte and microglial cultures Brain Res. 853,74-80[CrossRef][Medline]
  20. Adami, C., Sorci, G., Blasi, E., Agneletti, A. L., Bistoni, F., Donato, R. (2001) S100B expression in and effects on microglia Glia 33,131-142[CrossRef][Medline]
  21. Hu, J., Ferreira, A., Van Eldik, L. J. (1997) S100ß induces neuronal cell death through nitric oxide release from astrocytes J. Neurochem. 69,2294-2301[Medline]
  22. Hofmann, M. A., Drury, S., Fu, C., Qu, W., Taguchi, A., Lu, Y., Avila, C., Kambham, N., Bierhaus, A., Nawroth, P., Neurath, M. F., Slattery, T., Beach, D., McClary, J., Nagashima, M., Morser, J., Stern, D., Schmidt, A. M. (1999) RAGE mediates a novel proinflammatory axis: a central cell surface receptor for S100/calgranulin polypeptides Cell 97,889-901[CrossRef][Medline]
  23. Adami, C., Bianchi, R., Pula, G., Donato, R. (2004) S100B-stimulated NO production by BV-2 microglia is independent of RAGE transducing activity but dependent on RAGE extracellular domain Biochim. Biophys. Acta 1742,169-177[Medline]
  24. Minghetti, L. (2004) Cyclooxygenase-2 (COX-2) in inflammatory and degenerative brain diseases J. Neuropathol. Exp. Neurol. 63,901-910[Medline]
  25. Shanmugam, N., Kim, Y. S., Lanting, L., Natarajan, R. (2003) Regulation of cyclooxygenase-2 expression in monocytes by ligation of the receptor for advanced glycation end products J. Biol. Chem. 278,34834-34844[Abstract/Free Full Text]
  26. Block, M. L., Hong, J. S. (2005) Microglia and inflammation-mediated neurodegeneration: multiple triggers with a common mechanism Prog. Neurobiol. 76,77-98[CrossRef][Medline]
  27. Kim, S. U., de Vellis, J. (2005) Microglia in health and disease J. Neurosci. Res. 81,302-313[CrossRef][Medline]
  28. Donato, R. (1988) Calcium dependent, pH regulated effects of S-100 proteins on assembly-disassembly of brain microtubule protein in vitro J. Biol. Chem. 263,106-110[Abstract/Free Full Text]
  29. Blasi, E., Barluzzi, R., Bocchini, V., Mazzolla, R., Bistoni, F. (1990) Immortalization of murine microglial cells by a v-raf/v-myc carrying retrovirus J. Neuroimmunol. 27,229-237[CrossRef][Medline]
  30. Bocchini, V., Mazzolla, R., Barluzzi, R., Blasi, E., Sick, P., Kettenmann, H. (1992) An immortalized cell line expresses properties of activated microglial cells J. Neurosci. Res. 31,616-621[CrossRef][Medline]
  31. Huttunen, H. J., Fages, C., Rauvala, H. (1999) Receptor for advanced glycation end products (RAGE)-mediated neurite outgrowth and activation of NF-{kappa}B require the cytoplasmic domain of the receptor but different downstream signaling pathways J. Biol. Chem. 274,19919-19924[Abstract/Free Full Text]
  32. Batra, R. K., Guttridge, D. C., Brenner, D. A., Dubinett, S. M., Baldwin, A. S., Boucher, R. C. (1999) I{kappa}B{alpha} gene transfer is cytotoxic to squamous-cell lung cancer cells and sensitizes them to tumor necrosis factor-{alpha}-mediated cell death Am. J. Respir. Cell Mol. Biol. 21,238-245[Abstract/Free Full Text]
  33. Taguchi, A., Blood, D. C., del Toro, G., Canet, A., Lee, D. C., Qu, W., Tanji, N., Lu, Y., Lalla, E., Fu, C., Hofmann, M. A., Kislinger, T., Ingram, M., Lu, A., Tanaka, H., Hori, O., Ogawwa, S., Stern, D. M., Schmidt, A. M. (2000) Blockade of RAGE-amphoterin signaling suppresses tumor growth and metastases Nature 405,354-360[CrossRef][Medline]
  34. Sorci, G., Riuzzi, F., Arcuri, C., Giambanco, I., Donato, R. (2004) Amphoterin stimulates myogenesis and counteracts the antimyogenic factors basic fibroblast growth factor and S100B via RAGE binding Mol. Cell. Biol. 24,4880-4894[Abstract/Free Full Text]
  35. Coso, O. A., Chiariello, M., Yu, J. C., Teramoto, H., Crespo, P., Xu, N., Miki, T., Gutkind, J. S. (1995) The small GTP-binding proteins Rac1 and Cdc42 regulate the activity of the JNK/SAPK signaling pathway Cell 81,1137-1146[CrossRef][Medline]
  36. Minden, A., Lin, A., Claret, F. X., Abo, A., Karin, M. (1995) Selective activation of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases Rac and Cdc42Hs Cell 81,1147-1157[CrossRef][Medline]
  37. Fiuza, C., Bustin, M., Talwar, S., Troppa, M., Gerstenberger, E., Shelhamer, J. H., Suffredini, A. F. (2003) Inflammation-promoting activity of HMGB1 on human microvascular endothelial cells Blood 101,2652-2660[Abstract/Free Full Text]
  38. Sorci, G., Riuzzi, F., Agneletti, A. L., Marchetti, C., Donato, R. (2003) S100B inhibits myogenic differentiation and myotube formation in a RAGE-independent manner Mol. Cell. Biol. 23,4870-4881[Abstract/Free Full Text]
  39. Zhang, S., Han, J., Sells, M. A., Chernoff, J., Knaus, U. G., Ulevitch, R. J., Bokoch, G. M. (1995) Rho family GTPases regulate p38 mitogen-activated protein kinase through the downstream mediator Pak1 J. Biol. Chem. 270,23934-23936[Abstract/Free Full Text]
  40. Perona, R., Montaner, S., Saniger, L., Sanchez-Perez, I., Bravo, R., Lacal, J. C. (1997) Activation of the nuclear factor-{kappa}B by Rho, CDC42, and Rac-1 proteins Genes Dev. 11,463-475[Abstract/Free Full Text]
  41. Frost, J. A., Swantek, J. L., Stippec, S., Yin, M. J., Gaynor, R., Cobb, M. H. (2000) Stimulation of NF{kappa} B activity by multiple signaling pathways requires PAK1 J. Biol. Chem. 275,19693-19699[Abstract/Free Full Text]
  42. Zampetaki, A., Zhang, Z., Hu, Y., Xu, Q. (2005) Biomechanical stress induces IL-6 expression in smooth muscle cells via Ras/Rac1–p38 MAPK-NF-{kappa}B signaling pathways Am. J. Physiol. Heart Circ. Physiol. 288,H2946-H2954[Abstract/Free Full Text]
  43. Roth, J., Vogl, T., Sorg, C., Sunderkotter, C. (2003) Phagocyte-specific S100 proteins: a novel group of proinflammatory molecules Trends Immunol. 24,155-158[CrossRef][Medline]
  44. Shepherd, C. E., Goyette, J., Utter, V., Rahimi, F., Yang, Z., Geczy, C. L, Halliday, G. M. (2006) Inflammatory S100A9 and S100A12 proteins in Alzheimer’s disease Neurobiol. Aging 27,1554-1563[CrossRef][Medline]
  45. Frei, K., Malipiero, U. V., Leist, T. P., Zinkernagel, R. M., Schwab, M. E., Fontanam, A. (1989) On the cellular source and function of interleukin 6 produced in the central nervous system in viral diseases Eur. J. Immunol. 19,689-694[Medline]
  46. Presta, M., Urbinati, C., Dell’Era, P., Lauro, G. M., Sogos, V., Balaci, L., Ennas, M. G., Gremo, F. (1995) Expression of basic fibroblast growth factor and its receptors in human fetal microglia cells Int. J. Dev. Neurosci. 13,29-39[CrossRef][Medline]
  47. Neeper, M., Schmidt, A. M., Brett, J., Yan, S. D., Wang, F., Pan, Y. C., Elliston, K., Stern, D., Shaw, A. (1992) Cloning and expression of a cell surface receptor for advanced glycosylation end products of proteins J. Biol. Chem. 267,14998-15004[Abstract/Free Full Text]
  48. Lue, L. F., Walker, D. G., Brachova, L., Beach, T. G., Rogers, J., Schmidt, A. M., Stern, D. M., Yan, S. D. (2001) Involvement of microglial receptor for advanced glycation endproducts (RAGE) in Alzheimer’s disease: identification of a cellular activation mechanism Exp. Neurol. 171,29-45[CrossRef][Medline]
  49. Selinfreund, R. H., Barger, S. W., Welsh, M. J., Van Eldik, L. J. (1990) Antisense inhibition of glial S100ß production results in alteration in cell morphology, cytoskeletal organization, and cell proliferation J. Cell Biol. 111,2021-2028[Abstract/Free Full Text]
  50. Lin, J., Yang, Q., Yan, Z., Markowitz, J., Wilder, P. T., Carrier, F., Weber, D. J. (2004) Inhibiting S100B restores p53 levels in primary malignant melanoma cancer cells J. Biol. Chem. 279,34071-34077[Abstract/Free Full Text]
  51. Arcuri, C., Bianchi, R., Brozzi, F., Donato, R. (2005) S100B increases proliferation in PC12 neuronal cells and reduces their responsiveness to NGF via Akt activation J. Biol. Chem. 280,4402-4414[Abstract/Free Full Text]
  52. Bianchi, R., Giambanco, I., Donato, R. (1993) S-100 protein, but not calmodulin, binds to and inhibits the polymerization of the glial fibrillary acidic protein in a Ca2+-dependent manner J. Biol. Chem. 268,12669-12674[Abstract/Free Full Text]
  53. Garbuglia, M., Verzini, M., Giambanco, I., Spreca, A., Donato, R. (1996) Effects of calcium-binding proteins (S100ao, S100a, S100b) on desmin assembly in vitro FASEB J. 10,317-324[Abstract]
  54. Sorci, G., Agneletti, A. L., Donato, R. (2000) Effects of S100A1 and S100B on microtubule stability. An in vitro study using triton-cytoskeletons from astrocyte and myoblast cell lines Neuroscience 99,773-783[CrossRef][Medline]
  55. Xiong, Z., O’Hanlonm, D., Becker, L. E., Roder, J., MacDonald, J. F., Marks, A. (2000) Enhanced calcium transients in glial cells in neonatal cerebellar cultures derived from S100B null mice Exp. Cell Res. 257,281-289[CrossRef][Medline]
  56. Min, W., Pober, J. S. (1997) TNF initiates E-selectin transcription in human endothelial cells through parallel TRAF-NF-{kappa}B and TRAF-RAC/CDC42-JNK-c-Jun/ATF2 pathways J. Immunol. 159,3508-3518[Abstract]
  57. Park, J. S., Svetkauskaite, D., He, Q., Kim, J. Y., Strassheim, D., Ishizaka, A., Abraham, E. (2004) Involvement of Toll-like receptors 2 and 4 in cellular activation by high mobility group box 1 protein J. Biol. Chem. 279,7370-7377[Abstract/Free Full Text]
  58. Tzeng, S. F., Hsiao, H. Y., Mak, O. T. (2005) Prostaglandins and cyclooxygenases in glial cells during brain inflammation Curr. Drug Targets Inflamm. Allergy 4,335-340[CrossRef][Medline]
  59. Mrak, R. E., Griffin, W. S. (2001) The role of activated astrocytes and of the neurotrophic cytokine S100B in the pathogenesis of Alzheimer’s disease Neurobiol. Aging 22,915-922[CrossRef][Medline]
  60. Businaro, R., Leone, S., Sorci, G., Donato, R., Lauro, G. M., Fumagalli, L. (2006) S100B protects neurons against Aß amyloid-induced neurotoxicity via RAGE engagement at low doses and increases Aß amyloid neurotoxicity at high doses J. Neurosci. Res. 83,897-906[CrossRef][Medline]
  61. Wainwright, M. S., Craft, J. M., Griffin, W. S., Marks, A., Pineda, J., Padgett, K. R., Van Eldik, L. J. (2004) Increased susceptibility of S100B transgenic mice to perinatal hypoxia-ischemia Ann. Neurol. 56,61-67[CrossRef][Medline]
  62. Craft, J. M., Watterson, D. M., Marks, A., Van Eldik, L. J. (2005) Enhanced susceptibility of S-100B transgenic mice to neuroinflammation and neuronal dysfunction induced by intracerebroventricular infusion of human ß-amyloid Glia 51,209-216[CrossRef][Medline]
  63. Barger, S. W., Wolchok, S. R., Van Eldik, L. J. (1992) Disulfide-linked S100 ß dimers and signal transduction Biochim. Biophys. Acta 1160,105-112[CrossRef][Medline]
  64. Ostendorp, T., Heizmann, C. W., Kroneck, P. M., Fritz, G. (2005) Purification, crystallization and preliminary X-ray diffraction studies on human Ca2+-binding protein S100B Acta Crystallograph. Sect. F Struct. Biol. Cryst. Commun. 61(Pt. 7),673-675[CrossRef][Medline]
  65. Liu, L., Li, Y., Van Eldik, L. J., Griffin, W. S., Barger, S. W. (2005) S100B-induced microglial and neuronal IL-1 expression is mediated by cell type-specific transcription factors J. Neurochem. 92,546-553[CrossRef]



This article has been cited by other articles:


Home page
 J BiochemHome page
M. R. Khazaei, M. Habibi-Rezaei, F. Karimzadeh, A. A. Moosavi-Movahedi, A. A. Sarrafnejhad, F. Sabouni, and M. Bakhti
Microglial Cell Death Induced by Glycated Bovine Serum Albumin: Nitric Oxide Involvement
J. Biochem., August 1, 2008; 144(2): 197 - 206.
[Abstract] [Full Text] [PDF]

Home page
 J. Exp. Med.Home page
C. Gebhardt, A. Riehl, M. Durchdewald, J. Nemeth, G. Furstenberger, K. Muller-Decker, A. Enk, B. Arnold, A. Bierhaus, P. P. Nawroth, et al.
RAGE signaling sustains inflammation and promotes tumor development
J. Exp. Med., February 18, 2008; 205(2): 275 - 285.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. Pichiule, J. C. Chavez, A. M. Schmidt, and S. J. Vannucci
Hypoxia-inducible Factor-1 Mediates Neuronal Expression of the Receptor for Advanced Glycation End Products following Hypoxia/Ischemia
J. Biol. Chem., December 14, 2007; 282(50): 36330 - 36340.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
K. Herold, B. Moser, Y. Chen, S. Zeng, S. F. Yan, R. Ramasamy, J. Emond, R. Clynes, and A. M. Schmidt
Receptor for advanced glycation end products (RAGE) in a dash to the rescue: inflammatory signals gone awry in the primal response to stress
J. Leukoc. Biol., August 1, 2007; 82(2): 204 - 212.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0306198v1
81/1/108    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted