Journal of Leukocyte Biology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.0506357 on August 29, 2006

Published online before print August 29, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0506357v1
80/6/1542    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lorenowicz, M. J.
Right arrow Articles by Fernandez-Borja, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lorenowicz, M. J.
Right arrow Articles by Fernandez-Borja, M.
(Journal of Leukocyte Biology. 2006;80:1542-1552.)
© 2006 by Society for Leukocyte Biology

Epac1-Rap1 signaling regulates monocyte adhesion and chemotaxis

Magdalena J. Lorenowicz*, Janine van Gils*, Martin de Boer{dagger}, Peter L. Hordijk*,1 and Mar Fernandez-Borja*

Departments of
* Molecular Cell Biology and
{dagger} Blood Cell Research, Sanquin Research and Landsteiner Laboratory, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands

1 Correspondence: Sanquin Research and Landsteiner Laboratory, Academic Medical Center, University of Amsterdam, Plesmanlaan 125, 1066 CX Amsterdam, The Netherlands. E-mail: p.hordijk{at}sanquin.nl


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Extravasation of leukocytes is a crucial process in the immunological defense. In response to a local concentration of chemokines, circulating leukocytes adhere to and migrate across the vascular endothelium toward the inflamed tissue. The small guanosinetriphosphatase Rap1 plays an important role in the regulation of leukocyte adhesion, polarization, and chemotaxis. We investigated the role of a guanine nucleotide exchange protein for Rap1 directly activated by cAMP (Epac1) in adhesion and chemotaxis in a promonocytic cell line and in primary monocytes. We found that Epac1 is expressed in primary leukocytes, platelets, CD34-positive hematopoietic cells, and the leukemic cell lines U937 and HL60. Epac activation with an Epac-specific cAMP analog induced Rap1 activation, β1-integrin-dependent cell adhesion, and cell polarization. In addition, activated Epac1 enhanced chemotaxis of U937 cells and primary monocytes. Similar to activation of Epac1, stimulation of cells with serotonin to induce cAMP production resulted in Rap1 activation, increased cell adhesion and polarization, and enhanced chemotaxis. The effects of serotonin on U937 cell adhesion were dependent on cAMP production but could not be blocked by a protein kinase A inhibitor, implicating Epac in the regulation of serotonin-induced adhesion. In summary, our work reveals the existence of previously unrecognized cAMP-dependent signaling in leukocytes regulating cell adhesion and chemotaxis through the activation of Epac1.

Key Words: cAMP • serotonin • polarization


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Leukocyte extravasation from the bloodstream is of key importance in physiological processes, such as immunosurveillance and acute inflammation. This process is tightly regulated by cytokines that activate the adhesive and migratory capacities of leukocytes. In pathological conditions, an excess of proinflammatory cytokines leads to excessive leukocyte extravasation. This is the main determinant in the pathogenesis of chronic inflammatory diseases such as rheumatoid arthritis, asthma, and atherosclerosis. Chemokine-induced leukocyte migration involves integrin-mediated adhesion of circulating leukocytes to the endothelium, polarization of leukocytes toward the source of chemokine, and leukocyte migration across the endothelium (diapedesis) [1 ].

In lymphocytes, the small guanosinetriphosphatase (GTPase) Rap1 plays a crucial role in the stimulation of integrin-mediated adhesion, cell polarization, and cell motility [2 ]. Rap1 is activated upon GTP binding, which is induced by specific guanine nucleotide exchange factors (GEFs). Several GEFs for Rap1 have been identified, including the recently found exchange protein directly activated by cAMP (Epac) [3 ]. Two Epac isoforms, Epac1 and -2, have been described. Epac1 was found to be expressed in most tissues, and Epac2 is expressed in the adrenal gland and in the brain [4 ]. Attempts to detect Epac expression in leukocytes showed the presence of Epac1 mRNA only in B cells and U937 cells, and Epac1 protein was detected in macrophages. Epac2 was undetectable in all hematopoietic cell types [5 ].

The second messenger cAMP is crucially involved in multiple cellular processes. Until Epac was identified, cAMP-dependent signaling was thought to be carried out by protein kinase A (PKA). Currently, a growing number of studies implicate Epac1 in the regulation of several cAMP-dependent effects including substrate adhesion and cell-cell adhesion in adherent cells [6 7 8 9 10 ], Ca++-induced exocytosis [11 , 12 ], neurite extension [13 ], and Fc{gamma} receptor (Fc{gamma}R)-mediated phagocytosis in macrophages [14 ]. However, the role of Epac in leukocyte adhesion and chemotaxis has not been established.

Epac becomes activated by stimuli that bind to receptors signaling via the heterotrimeric Gs proteins, which induce a rise in cAMP levels through the activation of adenylate cyclase. These stimuli include serotonin, PGs, and β2adrenergic agonists [6 , 15 16 17 ]. In neurons, the Epac-Rap pathway regulates serotonin-induced secretion of amyloid precursor protein as well as ERK activation [15 , 16 ]. It is interesting that in addition to being a neurotransmitter, serotonin plays an important role in inflammation. It is secreted by mast cells and platelets and induces chemotaxis of eosinophils, lymphocytes, and macrophages [18 19 20 ].

In this study, we demonstrate that Epac1 is expressed in leukocytes, platelets, and hematopoietic cells, and we investigate its functionality in monocytic U937 cells and in primary monocytes. Our results show that activation of Epac1 promotes cell adhesion and polarization and enhances chemokine-induced migration.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Reagents
8CPT-2Me-cAMP and Rp-8-CPT-cAMPS were purchased from Biolog LSI (Germany). SQ22536 and 2',5'-dideoxyadenosine were from Calbiochem (Darmstad, Germany). Serotonin [5-hydroxytryptamine (5-HT)], PMA, and H89 were from Sigma Chemical Co. (St. Louis, MO). Stromal cell-derived factor 1 (SDF-1; CXCL12) and MCP-1 (CCL2) were from Strathman Biotech (Hannover, Germany). Recombinant TNF-{alpha} was purchased from Boehringer Mannheim (Germany).

Cell culture
All cell lines were purchased from American Type Culture Collection (ATCC; Manassas, VA) and were cultured at 37°C and 5% CO2. U937 cells (monocytic cell line) were maintained in RPMI-1640 medium (Gibco, Grand Island, NY) containing 10% heat-inactivated FCS (Gibco), 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. HL-60 cells (leukemic cell line) and Chinese hamster ovary (CHO) cells were cultured in IMDM (BioWhittaker, Brussels, Belgium) containing 10% heat-inactivated FCS (Gibco), 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. HUVEC were isolated from umbilical cord veins as described previously [21 ].Cells were cultured to confluency in M199 medium (Gibco) containing 20% heat-inactivated FCS (Gibco), 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, 100 µg/ml heparin, and 50 µg/ml endothelial mitogen (Sanbio BV, The Netherlands). Endothelial cells of second or third passage were used. HUVEC monolayers were stimulated for 16 h with 100 U/ml TNF-{alpha} prior to the perfusion experiments.

Cell isolation
Blood was obtained from healthy volunteers. Granulocytes and PBMC were isolated from buffy coats of 500 ml blood by density gradient centrifugation over isotonic Percoll (Pharmacia Biotech, Uppsala, Sweden) with a specific gravity of 1.076 g/ml [22 ]. For further purification of monocytes and lymphocytes, the PBMC fraction was incubated with magnetic beads coated with anti-CD14 antibodies, and monocytes were purified with a MACS separation system according to the manufacturer’s instructions (Miltenyi Biotec GmgH, Bergisch Gladbach, Germany). Previous experiments performed in our lab have shown that this isolation protocol does not induce monocyte activation [23 ]. The remaining monocyte-depleted fraction of PBMC was labeled with anti-CD3 and anti-CD19 antibodies, and B and T cells were subsequently sorted with a Mo Flo sorter (Dako Cytomation, Denver, CO).

After lysis of the erythrocytes with ice-cold lysis buffer containing 155 mM NH4Cl, 10 mM KHCO3, and 0.1 mM EDTA (pH 7.4), the granulocyte fraction was incubated with an anti-CD16 antibody. Subsequently, neutrophils were sorted with a Mo Flo sorter. Eosinophils were isolated by means of the fMLP method [24 ]. In brief, granulocytes were incubated for 30 min at 37°C to restore initial cell density. Cells were then washed and resuspended in PBS containing 0.5% human serum albumin (CLB, Amsterdam, The Netherlands) and 13 mM trisodium citrate and incubated for 10 min at 37°C after the addition of 10 nM fMLP to the cell suspension. Eosinophil and neutrophil fractions were separated by centrifugation (20 min., 1000 g) over isotonic Percoll (1.082 g/ml, pH 7.4). Platelets were isolated as described previously [23 ]. CD34+ hematopoietic progenitor cells were isolated from cord blood by density gradient centrifugation over Ficoll-paque (1.077 g/ml; Pharmacia Biotech) as described previously [25 ].

The purity of all the isolated cell populations was greater than 95%.

RT-PCR
RNA was isolated from purified leukocyte fractions, platelets, and CD34+ cells and the cell lines U937 and HL-60 by lysis of the cells in a solution containing guanidine isothiocyanate followed by centrifugation over a layer of CsCl (5.7 M) in a Beckman OptimaTM L-100 XP ultracentrifuge (Beckman Instruments Inc., Palo Alto, CA) with an SW41 rotor. cDNA was synthesized using 2.5 µM oligo-dT primers and 10 U/ml Superscript III RT (Invitrogen, Carlsbad, CA; 5 min, 65°C). Quantitative PCR was done with the FastStart DNA Master Plus SYBR Green I kit in the LightCycler instrument (Hoffman-La Roche, Basel, Switzerland). Epac1 RNA was amplified by PCR with the following protocol: 10 min at 95°C, followed by 50 cycles of 5 s at 95°C, 30 s at 65°C, and 15 s at 72°C. The following Epac1-specific primers were used: forward primer, 5'TTGGAGAATGGCTGTGGGAATGCATC3' (exon 14); reverse primer, 5'CCGAGTTGCTGAGGCCAAACATGAC3' (exon 19). The mRNA of the housekeeping gene β-glucuronidase was amplified as internal control using specific primers [26 ]. Amplified Epac1-specific cDNA was compared with the standard β-glucuronidase. The specificity of the PCR products was checked by DNA sequencing with the Big-dye Terminator sequencing kit v1.1 and analyzed on a Genetic Analyzer 3100 platform (both from Applied Biosystems, Foster City, CA).

Western blot analysis
Isolated, primary leukocytes, platelets, and cell lines were lysed in Laemmli sample buffer containing a protease inhibitor cocktail (Roche, Indianapolis, IN) and incubated for 15 min at 95°C. Cell lysates were separated on 10% SDS-PAGE gels and transferred onto polyvinylidene difluoride membranes (BioRad Laboratories, Hercules, CA). Epac1 was detected with a rabbit polyclonal anti-Epac1 antibody (Upstate, Lake Placid, NY). Actin was detected with a mouse mAb against actin (Ab1, Oncogene, Darmstadt, Germany).

Integrin activation
U937 cells were resuspended in IMDM containing 0.25% BSA and stimulated with 8CPT-2Me-cAMP for various time periods at 37°C. Stimulation was stopped by the addition of ice-cold PBS containing 0.5% BSA, and cells were pelleted by centrifugation (490 g, 5 min, 4°C). Cells were then resuspended in ice-cold PBS containing 0.5% BSA and incubated with a mouse mAb against the activated conformation of β1-integrins (12G10, Imgen, The Netherlands; ref. [27 ]) or β2-integrins (CBRM1/5, a kind gift from Dr. Kevin L. Moore, University of Oklahoma, Norman; ref. [28 ]) for 30 min at 4°C. Total surface expression of β1- and β2-integrins was detected with mouse mAb specific for β1- or β2-integrins (CLB). After washing with ice-cold PBS-0.5% BSA, bound mAb were detected with PE-labeled goat anti-mouse-Ig (Dako Cytomation, Denmark) for 30 min at 4°C. The fluorescence intensity of labeled cells was measured with a FACScan flow cytometer (Becton Dickinson, San Jose, CA). Integrin activation was calculated by correcting for the amount of total integrins in every sample and was expressed as fold increase over control-unstimulated cells.

Adhesion assay
Flat-bottom 96-well plates (Maxi Sorp Nunc, Denmark) were coated with 20 µg/ml human fibronectin (Sigma Chemical Co.) for 16 h at 4°C and blocked with 0.5% BSA (Sigma Chemical Co.) for at least 1 h at 37°C. U937 cells were washed in IMDM containing 0.25% BSA, labeled with Calcein-AM, according to the manufacturer’s instructions (Molecular Probes, Leiden, The Netherlands), for 30 min at 37°C, and washed twice with IMDM-BSA. Labeled U937 cells were preincubated or not with 8CPT-2Me-cAMP for 15 min and subsequently added to the fibronectin-coated 96-well plates (2x105 cells per well). Plates were centrifuged at 40 g for 1 min, and stimuli were immediately added. After a further incubation for 30 min at 37°C, nonadhered cells were removed by washing three times with warm PBS. Adhered cells were lysed with 0.5% Triton X-100, and fluorescence was measured on a GENios Plus plate reader (Tecan, Salzburg, Austria). The percentage of adhesion was calculated by dividing the measured fluorescence intensity by the fluorescence intensity of the input cells (set to 100%).

VLA-5 and CD11b-blocking experiments were performed by preincubating cells for 30 min with the mAb SAM-1 (CLB) and 44a (ATCC), respectively. To block undesirable FcR activation by the blocking VLA-4 antibody HP 2/1, cells were incubated for 10 min with the anti-FcR antibodies anti-CD32 (Medarex, Annandale, NJ) and anti-CD16b (CLB), prior to the incubation with a mixture of HP 2/1 and anti-FcR antibodies for an additional 30 min.

Perfusion assay
Perfusion experiments were performed as described previously [23 ]. In brief, the monocyte suspension (2x106 cell/ml in incubation buffer) was aspirated from a reservoir through plastic tubing and perfused through a chamber (containing the HUVEC monolayer) with a Harvard syringe pump (Harvard Apparatus, Holliston, MA) at flow rate of at 0.8 dyn/cm2. During perfusions, the flow chamber was mounted on a microscope stage (Axiovert 25, Zeiss, Germany), equipped with a black and white charged-coupled device video camera (Sanyo, Osaka, Japan) and coupled to a VHS video recorder [29 ]. Video images were evaluated for the number of adherent monocytes and the rolling velocity per cell, and dedicated routines were made in the image analysis software Optimas 6.1 (Media Cybernetics Systems, Silver Spring, MD). The number of surface-adherent monocytes was measured after 5 min of perfusion at a minimum of 25 randomized high-power fields. To automatically determine the velocity of rolling cells, custom-made software was developed in Optimas 6.1. A sequence of 50 frames representing an adjustable time interval ({delta}t, with a minimal interval of 80 ms) was digitally captured. The position of every cell was detected in each frame, and for all subsequent frames, the distance traveled by each cell and the number of images in which a cell appears in focus were measured. The cut-off value to distinguish between rolling and static adherent cells was set at 1 µm/s. With this method, static adherent cells and rolling and free-flowing cells could be distinguished and quantified clearly.

Transmigration assay
Migration assays were performed as described previously [25 ]. In brief, Transwells of 6.5 mm diameter, with 5-µm pore size filters (Costar, Cambridge, MA) were coated with 20 µg/ml fibronectin (Sigma Chemical Co.). Before use, cells were washed once with migration medium (IMDM containing 0.25% BSA). At the start of the assay, 105 cells were placed in the upper compartment of the Transwells and allowed to migrate for 1 h at 37°C to chemokine-containing medium added to the lower compartment. Migrated cells were collected from the lower compartment and quantified by flow cytometric analysis in the presence of a fixed amount of control cells labeled with Calcein-AM (Molecular Probes). The percentage of migrated cells was calculated as a fraction of the total cell input as follows: percent of migrated cells = [(number of transmigrated cells/number of input-labeled cells)/(number of not-labeled input cells/number of labeled input cells)] x100%.

For primary monocyte migration, transmigrated cells were collected from the lower compartment of the Transwell as well as from the bottom of the Transwell filter (as a fraction of transmigrated monocytes remains adhered to the bottom of the filter). Monocytes in the lower compartment were quantified by flow cytometric analysis as indicated above. Cells adhering to the bottom side of the filters were counted under a fluorescent microscope (three random fields) after removing cells on the top side of the filters with a cotton swab, followed by fixation and staining with Hoechst (Molecular Probes). The percentage of transmigrated monocytes that adhered to the filter was calculated as follows: percent of migrated cells adhered to the filter = [(number of transmigrated cells counted per field/surface of the field)/(number of input cells/surface of the filter)] x 100%. The calculated percentages of the two fractions were added to give the total percentage of transmigrated monocytes.

Rap1 activation assays
Rap1 pull-down experiments were performed as described previously [30 ]. In brief, following stimulation, U937 cells were lysed in ice-cold lysis buffer containing 10 mM Tris-HCl, 150 mM NaCl, 1% Nonidet-P40, 0.5% deoxycholic acid, 0.1% SDS, 1 mM NaF, 2 mM NaVO3, and protease inhibitor cocktail (Roche) for 10 min on ice. Lysates were clarified by centrifugation at 10,000 g for 10 min at 4°C. GST-Ral guanine nucleotide dissociation stimulator (RalGDS)-raf-1 ras-binding domain (RBD) coupled to glutathione-Sepharose beads (Amersham Biosciences, UK) was added to the supernatants and incubated for 1 h at 4°C. Beads were washed three times in lysis buffer, and bound proteins were eluted with Laemmli sample buffer. Rap1 in total cell lysates and precipitates was detected by Western blotting with a mouse anti-Rap1 mAb (Santa Cruz Biotechnology, CA). Densitometric analysis was performed with a CanoScan LiDE20 scanner (Canon) and Gene Tools Analysis software, Version 3.03.03 (SynGene, Cambridge, UK).

Electroporation and immunofluorescence
A plasmid containing hemagglutinin (HA)-Epac1 (pMT2SM-HA-Epac1, 30 µg) [3 ] was added to U937 cells (12x106 cells) resuspended in RPMI medium. Cells were subsequently electroporated with a BioRad Gene Pulser II electroporator (950 µF, 250 V) and cultured in RPMI medium containing 20% FCS for 48 h. Subsequently, cells were collected by centrifugation, washed, and resuspended in IMDM containing 0.25% BSA. Transfected cells were allowed to adhere to fibronectin-coated coverslips for 10 min at 37°C, followed by a 20-min incubation in the presence of stimuli. Cells were then washed with PBS containing 0.5% BSA, fixed with 3.7% formaldehyde for 10 min at room temperature, and permeabilized with 0.1% Triton X-100 for 5 min. For immunofluorescence staining of HA-Epac-1, cells were incubated with a mouse mAb to HA (12CA5, Boehringer Mannheim Corp., Indianapolis, IN), followed by a goat anti-mouse-Ig antibody labeled with Alexa 488 (Molecular Probes). F-actin was visualized with Texas Red-labeled phalloidin (Molecular Probes). Images were recorded with a Zeiss LSM 510 confocal laser-scanning microscope. Fluorescence distribution profiles were created with Zeiss LSM 510 confocal laser-scanning microscope software.

Statistical analysis
All results were expressed as a mean ± SEM of at least three independent experiments. Where applicable, values were compared with paired two-tailed Student’s t-test. Multiple comparisons were analyzed with a two-way ANOVA test. A P value lower than 0.05 was considered significant. All statistical analyses were performed with GraphPad Prism, Version 3.0, software.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Expression of Epac1 in human primary leukocytes and leukocytic cell lines
We examined Epac1 mRNA and protein expression in peripheral blood leukocytes, platelets, cord blood-derived CD34-positive hematopoietic cells and two human myelocytic cell lines (HL60 and U937) by RT-PCR and Western blot analysis. RT-PCR was performed in optimized conditions for maximal sensitivity to enable the analysis of low copy number transcripts. In contrast to previous reports [5 ], we were able to detect Epac1 mRNA in all cell populations examined, with comparative threshold cycle (CT) values in the range between 30 and 34 (Fig. 1A and Table 1 ). The analysis of the expression of Epac2 transcript resulted in high CT values (CT higher than 38; ref. [31 ]), indicating that Epac2 is not expressed in leukocytes (data not shown). Western blotting experiments showed expression of Epac1 protein in all leukocyte populations examined with the exception of neutrophils, despite the presence of Epac1 mRNA in these cells (Fig. 1B) . Similarly, eosinophils and platelets showed low Epac1 protein expression levels, and CT values for the Epac1 transcript in these cells were comparable with CT values of the other cell populations analyzed. These data suggest that Epac1 expression is differentially regulated among leukocytes at the post-translational level.


Figure 1
View larger version (35K):
[in this window]
[in a new window]

  		Figure 1. Expression of Epac1 in primary leukocytes and leukocytic cell lines. (A) RT-PCR for Epac1 of cDNA derived from purified human primary neutrophils, monocytes, lymphocytes, CD34+ cells, eosinophils, platelets, and the leukemic cell lines U937 and HL60. The size of the amplified PCR fragment was 735 bp. As a control, cDNA for β-glucuronidase was amplified. Representative results of three independent experiments are shown. (B) Western blot detection of Epac1 in cell lysates from purified human primary neutrophils, monocytes, B cells, T cells, CD34+ cells, eosinophils, platelets, and the leukocytic cell lines U937 and HL60. CHO cells were used as a positive control for Epac1 protein expression. Bands corresponding to Epac1 are ~110 kDa. β-actin was used as a control for equal protein loading. Representative results of four independent experiments are shown.

 

View this table:
[in this window]
[in a new window]

  		Table 1. CT Values of Epac1 and β-Glucuronidase

 
Epac1 enhances monocyte adhesion through integrin activation
To study Epac signaling in leukocytes, we made use of the Epac-specific cAMP analog 8CPT-2Me-cAMP, which does not activate PKA [32 , 33 ]. This analog has been used extensively as a tool to study the role of Epac as a regulator of a variety of cellular processes [5 6 7 8 9 10 11 12 13 14 ]. We verified the functionality of Epac1 in the monocytic cell line U937 by assaying Rap1 activation upon cell incubation with 8CPT-2Me-cAMP. U937 cells stimulated with 8CPT-2Me-cAMP for 0.5, 1, and 5 min were lysed, and GTP-bound Rap1 was precipitated in a GST-RalGDS-RBD pull-down assay. Thirty seconds stimulation of U937 cells with 8CPT-2Me-cAMP increased Rap1 activation. This induction was transient and declined to basal levels after 5 min of stimulation (Fig. 2 2A ). It is notable that the activation kinetics of Rap1 by Epac in U937 cells is similar to the kinetics described previously in adherent cells [6 ]. These data show that U937 cells express functional Epac1.


Figure 2
View larger version (17K):
[in this window]
[in a new window]

  		Figure 2. Epac1 activates Rap1 in U937 cells and promotes cell adhesion to fibronectin and endothelial cells. (A) U937 cells were treated with 100 µM 8CPT-2Me-cAMP for the indicated time periods, and GTP-bound Rap1 was precipitated with GST-Ral-GDS-RBD, followed by Western blotting and Rap1 detection by immunoblotting (upper panel). Total levels of Rap1 in whole cell lysates are shown (lower panel). Representative results of three independent experiments are shown. Bar graph represents densitometric analysis of Rap1 activation. Data are mean of three independent experiments (±SEM). (B) U937 cells were pretreated or not with 100 µM 8CPT-2Me-cAMP for 15 min and placed in a fibronectin-coated plate for 30 min. As a positive control, PMA (100 ng/ml) was added at the time of plating. The percentage of adhesion was determined as described in Materials and Methods. Data are mean (±SEM) of five independent experiments performed in triplicate. *, P < 0.05; **, P < 0.005. (C) Primary monocytes were pretreated or not with 100 µM 8CPT-2Me-cAMP for 30 min and perfused over TNF-{alpha}-stimulated monolayers of HUVEC for 5 min at 0.8 dyn/cm2. Video images were evaluated for the number of adherent monocytes and cell rolling as described in Materials and Methods. Data are mean (±SEM) of five independent experiments performed in duplicate. *, P < 0.05. ctrl, Control.

 
Epac was recently shown to regulate integrin-mediated adhesion in ovarian carcinoma cells [6 , 7 ]. To investigate whether Epac1 has a similar function in U937 cells, we analyzed cell adhesion to fibronectin after 30 min incubation with 8CPT-2Me-cAMP. In addition, stimulation with PMA was included as a positive control. Epac1 activation induced a 60% increase in adhesion when compared with control-untreated cells (Fig. 2B) . This indicates that Epac1 activation promotes adhesion of U937 cells to fibronectin. To further substantiate the role of Epac1-Rap1 signaling in monocyte adhesion, we studied the effect of 8CPT-2Me-cAMP in the adhesion of freshly isolated monocytes to cultured HUVEC under flow. Epac1 activation resulted in a clear induction of monocyte firm adhesion to endothelial cells, without affecting rolling, which is mainly mediated by selectins (Fig. 2C) [34 35 36 ]. This provides evidence for a role of Epac1-Rap1 signaling in the regulation of primary monocyte adhesion to endothelial cells under flow and thus suggests that this pathway may also function in vivo.

To gain insight into the mechanism by which Epac1 enhances U937 cell adhesion to fibronectin, we analyzed the surface expression of total and activated β1- and β2-integrins upon treatment with 8CPT-2Me-cAMP. Epac1 activation resulted in a rapid and significant increase of activated β1-integrins on the cell surface followed by their down-modulation (Fig. 3A ). In contrast, no changes were observed for β2-integrin activation (data not shown). Our results show a rapid but transient activation of integrins by Epac, and the effects on cell adhesion are prolonged for at least 30 min. This may be explained by the fact that integrin activation was measured in cells in suspension, where no integrin engagement takes place. Upon seeding, stable engagement of the activated integrins by fibronectin may induce a prolonged effect on adhesion.


Figure 3
View larger version (28K):
[in this window]
[in a new window]

  		Figure 3. Epac1 induces β1-integrin activation and β1-integrin-mediated adhesion. (A) U937 cells were treated with 100 µM 8CPT-2Me-cAMP for the indicated time periods. Surface expression of activated β1-integrins was determined by flow cytometry using a mouse mAb that recognizes the activated state of β1-integrins (12G10). The activation of β1-integrins is expressed as fold increase over control-untreated cells and is corrected for total β1-integrin surface expression. Data are mean (±SEM) of three independent experiments. *, P < 0.05. (B–D) U937 cells were preincubated with integrin-blocking mAb to VLA-5 (B), VLA-4 (C), or membrane-activated complex-1 (Mac-1; D) for 30 min before addition of the cells to fibronectin-coated plates. Data are mean (±SEM) of three independent experiments performed in triplicate. *, P < 0.05.

 
To confirm the role of β1-integrins in Epac1-mediated U937 cell adhesion to fibronectin, cells were incubated with blocking anti-integrin antibodies before their addition to fibronectin-coated wells. A blocking anti-VLA-5 ({alpha}5β1) antibody completely abrogated adhesion of control and 8CPT-2Me-cAMP-treated cells (Fig. 3B) , indicating that VLA-5 is the main integrin involved in U937 cell attachment to fibronectin. However, an anti-VLA-4 ({alpha}4β1) antibody specifically reduced an 8CPT-2Me-cAMP-induced increase of adhesion, which returned to control levels (Fig. 3C) , whereas an anti-Mac1 ({alpha}mβ2) antibody showed no inhibitory effect (Fig. 3D) . From these experiments, we conclude that Epac1 activation triggers inside-out signaling, resulting in the activation of β1-integrins, leading to VLA-4- and likely, VLA-5-mediated adhesion of U937 cells to fibronectin.

Epac1 induces cell polarization and localizes to the uropod
Cell polarization plays a crucial role in directional cell movement. Polarized cells develop a leading edge, where membrane extension and lamellipodia formation occur, and a retracting rear (uropod). As Rap1 is proposed to play a central role in lymphocyte polarization [37 ], we analyzed whether Epac1 activation triggers polarization of U937 cells. Fibronectin-adherent U937 cells were treated with 8CPT-2Me-cAMP, fixed, and stained for F-actin. The percentage of polarized cells was quantified by microscopy, according to morphological criteria: nonpolarized cells are round in shape, whereas polarized cells have a morphologically defined leading edge and a uropod (cell images in Fig. 4A ). Quantitative analysis indicated that 8CPT-2Me-cAMP induced a twofold increase in the number of polarized cells (Fig. 4A) . We next investigated the intracellular distribution of Epac1 in polarized versus nonpolarized cells. U937 cells were transfected with HA-tagged Epac1, seeded on fibronectin, and stained with HA antibodies for microscopy analysis. Epac1 localized at the cell periphery in nonpolarized cells, whereas it concentrated at the uropod of polarized cells (Fig. 4B) . These observations suggest that Epac1 activates Rap1 at a perinuclear location.


Figure 4
View larger version (21K):
[in this window]
[in a new window]

  		Figure 4. Epac1 induces cell polarization and redistributes to the uropod of polarized cells. (A) U937 cells were allowed to adhere to fibronectin-coated coverslips and were stimulated or not with 100 µM 8CPT-2Me-cAMP for 20 min, fixed, stained for F-actin, and analyzed by confocal microscopy. Data represent the percentage of polarized cells, scored on the basis of morphology, of a total of 100–120 cells per condition (left panel). Representative images of a polarized and a nonpolarized cell stained for F-actin are shown (right panel, arrow indicates direction of migration). Data are mean (±SEM) of three independent experiments. (B) U937 cells were transiently transfected with HA-tagged Epac1 and allowed to adhere to fibronectin-coated coverslips. Thereafter, U937 cells were stimulated or not with 100 µM 8CPT-2Me-cAMP for 20 min, fixed, and stained for Epac1. Fluorescence intensity profiles along the indicated dashed line between the points a and b are shown. White arrows on images indicate direction of cell polarization. Images are representative of three independent experiments. Original bars, 5 µm. *, P < 0.05.

 
Epac1 promotes U937 cell and primary monocyte chemotaxis
Rap1 plays a role in the regulation of chemokine-induced lymphocyte migration [38 , 39 ]. To assess the role of Epac1 in monocyte chemotaxis, we analyzed the effect of 8CPT-2Me-cAMP on chemokine-induced migration of monocytic U937 cells and of freshly isolated monocytes. 8CPT-2Me-cAMP was not chemotactic by itself (data not shown). However, treatment with 8CPT-2Me-cAMP resulted in an 80% increase in migration of U937 cells to CXCL12 (SDF-1; Fig. 5A ). To exclude the possibility that the Epac1-induced migration was a result of the up-regulation of chemokine receptors, we analyzed whether 8CPT-2Me-cAMP modulated the cell surface levels of CXCR4 in U937 cells. No differences in CXCR4 surface levels were detected in untreated or 8CPT-2Me-cAMP-treated cells (not shown). We next examined the effect of 8CPT-2Me-cAMP on the chemotaxis of freshly isolated human monocytes toward CCL2 (MCP-1). Similar to the findings in U937 cells, Epac activation resulted in an 80% increase in CCL2-induced chemotaxis. These data show that although Epac1 activation does induce cell migration by itself, it significantly promotes chemokine-induced monocyte migration.


Figure 5
View larger version (17K):
[in this window]
[in a new window]

  		Figure 5. Epac1 promotes chemotaxis of U937 cells and primary monocytes. U937 cells (left panel) or primary monocytes (right panel) were allowed to migrate for 1 h to 100 ng/ml CXCL12 (SDF-1) or 10 ng/ml CCL2 (MCP-1), respectively, in the presence or absence of 100 µM 8CPT-2Me-cAMP added to the cell suspension in the upper compartment of a Transwell system. When no chemoattractant was present, 1–2% U937 cells or primary monocytes migrated, regardless the presence of 8CPT-2Me-cAMP. In the presence of chemoattractant, 30–40% of untreated U937 cells and 6–7% of untreated monocytes migrated. Data represent the percentage of cell migration compared with the untreated cells (set at 100%). Data are mean (±SEM) of three to five independent experiments. *, P < 0.05; **, P <0.005.

 
Serotonin activates Rap1 and promotes CXCL12-induced adhesion and chemotaxis of U937 cells
We next investigated whether stimulation of leukocytes with cAMP-raising receptor agonists would induce similar effects as direct Epac1 activation. To test this, we used serotonin (5-HT), a neurotransmitter that has been shown to be an inflammatory mediator [18 , 40 , 41 ]. Serotonin is released by activated platelets and can be found at micromolar concentrations within the inflammatory site. It is notable that Epac1 has been implicated in signaling from serotonin receptors in neurons [15 , 16 ]. We hypothesized that serotonin could enhance leukocyte chemotaxis through the Epac1-Rap1 pathway. To test this hypothesis, we analyzed the effect of serotonin on U937 cell chemotaxis toward CXCL12. Serotonin was not chemotactic by itself but significantly enhanced CXCL12-induced migration of U937 cells (Fig. 6A ). Furthermore, serotonin induced a small but significant increase in cell adhesion to fibronectin and cooperated with CXCL12 to enhance cell adhesion (Fig. 6B) .


Figure 6
View larger version (28K):
[in this window]
[in a new window]

  		Figure 6. Serotonin activates Rap1, induces U937 cell adhesion, and increases CXCL12-induced chemotaxis. (A) U937 cells were allowed to migrate across fibronectin-coated filters toward CXCL12 (10 ng/ml), serotonin (5-HT; 1 µM), or a combination of both for the indicated time periods. The percentage of migration was determined as described in Material and Methods. Data are mean (±SEM) of three independent experiments. The percentage of migration toward CXCL12 was compared with the percentage of migration toward the combination of 5-HT and CXCL12 by a two-way ANOVA test (P<0.05). (B) U937 cells were assayed for adhesion to fibronectin in the presence of CXCL12 (100 ng/ml), 5-HT (10 µM), or a combination of both. The percentage of adhesion was determined as described in Materials and Methods. Data are mean (±SEM) of five independent experiments performed in triplicate. *, P < 0.05; **, P < 0.005. (C) U937 cells were allowed to adhere to fibronectin-coated coverslips and were stimulated or not with 10 µM serotonin for 30 min, fixed, stained for F-actin, and analyzed by confocal microscopy. Data represent the percentage of polarized cells, scored on the basis of morphology, of a total of 100–120 cells per condition. (D) U937 cells were stimulated with 5-HT (10 µM), CXCL12 (100 ng/ml), or a combination of both stimuli for the indicated time periods, and Rap1 GTP-loading was assayed (upper panel). Total levels of Rap1 in whole cell lysates are shown (lower panel). Representative results of three independent experiments are shown. Bar graph represents densitometric analysis of Rap1 activation. Data are mean of three independent experiments (±SEM).

 
We next investigated whether serotonin was able to trigger cell polarization, similar to Epac activation. U937 cells seeded on fibronectin-coated coverslips were stimulated with serotonin for 30 min. Cells were fixed and stained for F-actin for confocal microscopy analysis. The number of polarized versus nonpolarized cells was determined as described above. The results showed that serotonin induced a significant increase in the number of polarized cells (Fig. 6C) . Thus, serotonin is able to induce a similar phenotype as activation of Epac. This suggested that serotonin signals through Epac to promote cell adhesion, polarization, and chemotaxis. To test this hypothesis, we first investigated whether serotonin is able to induce Rap1 activation. Treatment of U937 cells with serotonin resulted in the rapid activation of Rap1, observed already after 30 s of stimulation. This activation was sustained for at least 5 min, decreasing to basal levels after 10 min stimulation (Fig. 6D) . It is interesting that the kinetics of Rap1 activation by serotonin is similar to the kinetics observed upon Epac activation with 8CPT-2Me-cAMP (Fig. 2A) . In contrast, stimulation of cells with CXCL12 resulted in a strong but short activation of Rap1. The kinetics of Rap1 activation upon stimulation with serotonin and CXCL12 together resembled that induced by serotonin alone (Fig. 6D) . Thus, the enhancing effects of serotonin on CXCL12-induced adhesion and migration might be a result of the ability of serotonin to induce a more sustained Rap1 activation than CXCL12 and therefore, improved integrin-mediated adhesion.

To unequivocally implicate Epac in the mediation of serotonin effects on adhesion and chemotaxis, we transfected U937 cells with a dominant-negative Epac mutant. However, no quantitative data could be obtained as a result of low transfection efficiencies. We then followed an indirect approach by demonstrating that serotonin-induced adhesion requires cAMP production but is PKA-independent. U937 cells were treated with two different adenylate cyclase inhibitors, SQ22536 and 2'-5'-deoxyadenosine, to block cAMP generation upon stimulation with serotonin. Treatment with either inhibitor abrogated the differences in adhesion between serotonin-stimulated and unstimulated cells and between CXCL12-stimulated and CXCL12/serotonin-stimulated cells (Fig. 7A ). These data suggest that cAMP production is required for the enhancing effects that serotonin has on adhesion. As cAMP can activate Epac1 and PKA, we excluded the possibility that serotonin-induced Rap1 activation and cell adhesion were mediated by PKA by using the specific PKA inhibitor H89. Pretreatment of cells with H89 did not inhibit serotonin-induced Rap1 activation (Fig. 7B) or prevent the effects of serotonin on cell adhesion (Fig. 7C) . Similar results were obtained with the competitive PKA inhibitor Rp-cAMPS (data not shown). These data indicate that PKA is not involved in serotonin-induced Rap1 activation and adhesion of U937 cells to fibronectin.


Figure 7
View larger version (19K):
[in this window]
[in a new window]

  		Figure 7. Serotonin increases adhesion in a cAMP-dependent, PKA-independent manner. (A) U937 cells were preincubated with the adenylate cyclase inhibitors SQ22536 or 2'5'-deoxyadenosime (2'-5'-dd-Ado) for 1 h before addition of the cells to fibronectin-coated plates. The percentage of adhesion was determined as described in Materials and Methods. Data are mean (±SEM) of three independent experiments performed in triplicate. (B) U937 cells were pretreated or not with 10 µM H89 for 30 min and stimulated with 5-HT (10 µM), and Rap1 GTP-loading was assayed (upper panel). Total levels of Rap1 in whole cell lysates are shown (lower panel). Representative results of three independent experiments are shown. Bar graph represents densitometric analysis of Rap1 activation. Data are mean of three independent experiments (±SEM). (C) U937 cells, pretreated or not with H89 (10 µM) for 30 min, were assayed for adhesion to fibronectin in the presence of CXCL12 (100 ng/ml) and 5-HT (10 µM). The percentage of adhesion was determined as described in Materials and Methods. Data are mean (±SEM) of five independent experiments performed in triplicate. *, P < 0.05; ***, P < 0.0005.

 
Together, these results suggest that serotonin enhances U937 cell adhesion and chemotaxis through the activation of the Epac1-Rap1 pathway.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Our report provides the first comprehensive analysis of Epac expression in leukocytes and hematopoietic cells. We show that Epac1 is functional in primary monocytes and in monocytic U937 cells, where it regulates β1-integrin-dependent cell adhesion, cell polarization, and chemotaxis.

The small GTPase Rap1 is activated by almost all receptor types and regulates adhesion-related functions such as cell-cell contact and integrin-mediated adhesion [42 , 43 ]. In lymphocytes, Rap1 plays a crucial role in integrin-mediated adhesion, polarization, and transendothelial migration downstream of chemokine receptors [38 , 39 ]. Recently, Epac1 was identified as a Rap1 exchange factor directly activated by cAMP and shown to be involved in integrin-mediated adhesion in ovarian carcinoma cells through Rap1 activation [6 ]. Although Epac1 is expressed in most tissues, previous studies failed to show Epac1 expression in primary leukocytes with the exception of B cells and macrophages [5 ]. Here, we have used optimized RT-PCR conditions to detect low copy number transcripts and found Epac1 mRNA in circulating leukocytes (monocytes, eosinophils, neutrophils, and B and T cells), platelets, CD34-positive hematopoietic cells, and the myelocytic cell lines U937 and HL60. It is important that we found Epac1 protein expression in all leukocytes with the exception of neutrophils. Epac1 protein levels did not always correlate directly with Epac1 mRNA levels, e.g., in eosinophils and platelets. This might be a result of differential, post-translational regulation of Epac1 expression in different types of leukocytes and may have functional consequences during the response of different leukocyte types to cAMP-elevating agents.

In this study, we have investigated the function of the Epac1-Rap1 pathway in the promonocytic cell line U937 and in primary monocytes. We found that a cAMP analog (8CPT-2Me-cAMP), which specifically activates Epac1 and not PKA, was able to induce cell adhesion, polarization, and chemotaxis. In U937 cells, Epac1 activation induced β1-integrin activation and VLA-4-mediated adhesion to fibronectin. Thus, Epac1 appears to have a similar role in leukocytes as in adherent cells, namely, the activation of Rap1 and the consequent "inside-out" signaling toward β1-integrins [6 , 7 ].

In line with previous studies showing that Rap1 activation induces T cell polarization [37 ], we show that activation of the Epac1-Rap1 pathway induces polarization of U937 cells. In addition, ectopically expressed Epac1 redistributes from the cell periphery to the perinuclear area upon cell polarization. This suggests that Epac1 activates Rap1 at a perinuclear location and that activated Rap1 subsequently translocates to the plasma membrane. Accordingly, wild-type (active and inactive) Rap1 was shown to localize to a perinuclear vesicular compartment and to the plasma membrane in T cells, and activated GTP-bound Rap1 was found exclusively at the plasma membrane [44 ].

We have used monocytic U937 cells for most of our studies; however, we have demonstrated that the Epac pathway is functional in primary human monocytes. We show that Epac1 activation up-regulates adhesion of freshly isolated monocytes to endothelial cells under flow as well as monocyte migration toward CCL2 (MCP-1). This chemokine is a potent monocyte chemoattractant, which has a key role in the recruitment of monocytes to atherosclerotic lesions. Based on these data, we postulate that Epac1 activation by cAMP-raising agonists plays a role in the pathophysiology of atherosclerosis. Supporting this, we have shown that Epac1 activation induced β1-integrin-mediated adhesion to fibronectin. β1-integrins mediate the arrest and initial adhesion of monocytes to the endothelium [35 ]. In addition, β1-integrins can bind to the alternatively spliced connecting segment-1 (CS-1) domain of fibronectin, which contributes to monocyte-endothelium interactions [45 , 46 ]. Endothelial β1-integrins and CS-1-containing fibronectin are suggested to play a crucial role in atherogenesis through the recruitment of circulating monocytes [46 47 48 ]. In addition, minimally modified low-density lipoprotein (MM-LDL) induces the deposition of CS-1 on the endothelial surface and the induction of β1-integrin-mediated monocyte binding to this integrin fragment [46 ]. It is interesting that treatment of endothelial cells with MM-LDL was demonstrated to cause a rapid increase in cAMP, which was necessary for the induction of monocyte binding by MM-LDL [49 ]. The same study showed that other cAMP-elevating agents were also inducing monocyte but not neutrophil binding to endothelium. This is interesting, as we show here that neutrophils do not contain Epac1 protein. Together, these data suggest a model in which local concentrations of cAMP-elevating agonists in atherosclerotic lesions induce endothelial activation and monocyte recruitment, which is mediated by Epac1-induced activation of monocyte β1-integrin-mediated adhesion to fibronectin.

Serotonin is a cAMP-elevating agonist secreted by activated platelets and mast cells, and increased plasma levels of serotonin are associated with the pathophysiology of atherosclerosis and asthma [19 , 50 ]. It is interesting that serotonin was recently shown to be a chemotactic factor for eosinophils [18 ] and to modulate cytokine and chemokine release by monocytes [51 ]. We show here that serotonin is able to induce adhesion, polarization, and chemokinesis of U937 cells similarly to Epac activation. Although we could not directly implicate Epac1 in these effects, we show that serotonin-induced adhesion requires cAMP but is PKA-independent, which suggests that Epac1 activation by cAMP mediates serotonin-induced adhesion of monocytes to fibronectin. Accordingly, Epac1 has been previously shown to be activated by serotonin receptors in neuronal cells [15 , 16 , 52 ]. In the concentrations used in our study, serotonin did not show chemotactic properties for U937 cells, similar to the Epac activator 8CPT-2Me-cAMP. However, both agents increased CXCL12-induced chemotaxis, indicating that other signaling pathways engaged by chemokines are likely to be required for cell movement [53 54 55 ]. The enhancing effects of serotonin on migration could be a result of its ability to induce a more sustained Rap1 activation than CXCL12. This may result in the improvement of Rap1-mediated functions such as polarization and adhesion, which are prerequisites for directional migration. In conclusion, our data support a proinflammatory role for serotonin as an enhancer of monocyte adhesion and chemotaxis.

Previous reports have shown that agents that increase cAMP such as forskolin, 3-isobutyl-1-methylxanthine, or PGE2 inhibit chemokine-induced monocyte adhesion and migration [56 , 57 ]. However, other studies demonstrated that urokinase-type plasminogen activator and relaxin stimulate monocyte adhesion and migration through cAMP-dependent pathways [58 , 59 ]. An explanation for these contradictory observations may be the compartmentalization of cAMP signaling in cells [60 ]. Different signaling receptors activate differentially located members of the adenylate cyclase family, and specific phosphodiesterases degrade cAMP to prevent its diffusion. This results in the formation of cAMP "clouds" at discrete sites within the cell, which activate only nearby located effectors. Thus, it may be that cAMP activates PKA or Epac1 more potently, depending on the stimulus, resulting in different outcomes for adhesion and migration. It is interesting that cAMP is known to consistently inhibit neutrophil migration, which may be explained by the fact that they do not express Epac1 protein as shown here.

In conclusion, our work reveals a previously unrecognized cAMP-dependent signaling pathway in monocytes regulating cell adhesion, polarization, and chemotaxis through the activation of Epac1. Finally, our data suggest that cAMP-elevating receptor agonists may regulate inflammatory processes through the activation of Epac1-Rap1 signaling in monocytes.


   ACKNOWLEDGEMENTS
 
This work was supported by grants from the Netherlands Asthma Foundation (3.2.00.28, M. J. L.), from the Zon MW (40-40600-98-06728, J. v. G.), and from the Landsteiner Foundation for Blood Research (LSBR 0112, M. F-B. and P. L. H.). We thank Dr. J. L. Bos for providing the HA-Epac1 expression plasmid. We are grateful to Aicha Ait Soussan, Erik Mul, Sander Basten, and Anton Tool for their technical support. We thank Prof. Dirk Roos for critically reading the manuscript.

Received May 23, 2006; revised July 13, 2006; accepted July 14, 2006.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Springer, T. A. (1994) Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm Cell 76,301-314[CrossRef][Medline]
  2. De Bruyn, K. M., Rangarajan, S., Reedquist, K. A., Figdor, C. G., Bos, J. L. (2002) The small GTPase Rap1 is required for Mn(2+)- and antibody-induced LFA-1- and VLA-4-mediated cell adhesion J. Biol. Chem. 277,29468-29476[Abstract/Free Full Text]
  3. De Rooij, J., Zwartkruis, F. J., Verheijen, M. H., Cool, R. H., Nijman, S. M., Wittinghofer, A., Bos, J. L. (1998) Epac is a Rap1 guanine-nucleotide-exchange factor directly activated by cyclic AMP Nature 396,474-477[CrossRef][Medline]
  4. Bos, J. L. (2003) Epac: a new cAMP target and new avenues in cAMP research Nat. Rev. Mol. Cell Biol. 4,733-738[CrossRef][Medline]
  5. Tiwari, S., Felekkis, K., Moon, E. Y., Flies, A., Sherr, D. H., Lerner, A. (2004) Among circulating hematopoietic cells, B-CLL uniquely expresses functional EPAC1, but EPAC1-mediated Rap1 activation does not account for PDE4 inhibitor-induced apoptosis Blood 103,2661-2667[Abstract/Free Full Text]
  6. Rangarajan, S., Enserink, J. M., Kuiperij, H. B., de Rooij, J., Price, L. S., Schwede, F., Bos, J. L. (2003) Cyclic AMP induces integrin-mediated cell adhesion through Epac and Rap1 upon stimulation of the β 2-adrenergic receptor J. Cell Biol. 160,487-493[Abstract/Free Full Text]
  7. Enserink, J. M., Price, L. S., Methi, T., Mahic, M., Sonnenberg, A., Bos, J. L., Tasken, K. (2004) The cAMP-Epac-Rap1 pathway regulates cell spreading and cell adhesion to laminin-5 through the {alpha}3β1 integrin but not the {alpha}6β4 integrin J. Biol. Chem. 279,44889-44896[Abstract/Free Full Text]
  8. Cullere, X., Shaw, S. K., Andersson, L., Hirahashi, J., Luscinskas, F. W., Mayadas, T. N. (2005) Regulation of vascular endothelial barrier function by Epac, a cAMP-activated exchange factor for Rap GTPase Blood 105,1950-1955[Abstract/Free Full Text]
  9. Wittchen, E. S., Worthylake, R. A., Kelly, P., Casey, P. J., Quilliam, L. A., Burridge, K. (2005) Rap1 GTPase inhibits leukocyte transmigration by promoting endothelial barrier function J. Biol. Chem. 280,11675-11682[Abstract/Free Full Text]
  10. Fukuhara, S., Sakurai, A., Sano, H., Yamagishi, A., Somekawa, S., Takakura, N., Saito, Y., Kangawa, K., Mochizuki, N. (2005) Cyclic AMP potentiates vascular endothelial cadherin-mediated cell-cell contact to enhance endothelial barrier function through an Epac-Rap1 signaling pathway Mol. Cell. Biol. 25,136-146[Abstract/Free Full Text]
  11. Kang, G., Joseph, J. W., Chepurny, O. G., Monaco, M., Wheeler, M. B., Bos, J. L., Schwede, F., Genieser, H. G., Holz, G. G. (2003) Epac-selective cAMP analog 8-pCPT-2'-O-Me-cAMP as a stimulus for Ca2+-induced Ca2+ release and exocytosis in pancreatic β-cells J. Biol. Chem. 278,8279-8285[Abstract/Free Full Text]
  12. Eliasson, L., Ma, X., Renstrom, E., Barg, S., Berggren, P. O., Galvanovskis, J., Gromada, J., Jing, X., Lundquist, I., Salehi, A., Sewing, S., Rorsman, P. (2003) SUR1 regulates PKA-independent cAMP-induced granule priming in mouse pancreatic B-cells J. Gen. Physiol. 121,181-197[Abstract/Free Full Text]
  13. Christensen, A. E., Selheim, F., de Rooij, J., Dremier, S., Schwede, F., Dao, K. K., Martinez, A., Maenhaut, C., Bos, J. L., Genieser, H. G., Doskeland, S. O. (2003) cAMP analog mapping of Epac1 and cAMP kinase. Discriminating analogs demonstrate that Epac and cAMP kinase act synergistically to promote PC-12 cell neurite extension J. Biol. Chem. 278,35394-35402[Abstract/Free Full Text]
  14. Aronoff, D. M., Canetti, C., Serezani, C. H., Luo, M., Peters-Golden, M. (2005) Cutting edge: macrophage inhibition by cyclic AMP (cAMP): differential roles of protein kinase A and exchange protein directly activated by cAMP-1 J. Immunol. 174,595-599[Abstract/Free Full Text]
  15. Lin, S. L., Johnson-Farley, N. N., Lubinsky, D. R., Cowen, D. S. (2003) Coupling of neuronal 5-HT7 receptors to activation of extracellular-regulated kinase through a protein kinase A-independent pathway that can utilize Epac J. Neurochem. 87,1076-1085[CrossRef][Medline]
  16. Maillet, M., Robert, S. J., Cacquevel, M., Gastineau, M., Vivien, D., Bertoglio, J., Zugaza, J. L., Fischmeister, R., Lezoualc’h, F. (2003) Crosstalk between Rap1 and Rac regulates secretion of sAPP{alpha} Nat. Cell Biol. 5,633-639[CrossRef][Medline]
  17. Jing, H., Yen, J. H., Ganea, D. (2004) A novel signaling pathway mediates the inhibition of CCL3/4 expression by prostaglandin E2 J. Biol. Chem. 279,55176-55186[Abstract/Free Full Text]
  18. Boehme, S. A., Lio, F. M., Sikora, L., Pandit, T. S., Lavrador, K., Rao, S. P., Sriramarao, P. (2004) Cutting edge: serotonin is a chemotactic factor for eosinophils and functions additively with eotaxin J. Immunol. 173,3599-3603[Abstract/Free Full Text]
  19. Nomura, H., Sato, E., Koyama, S., Haniuda, M., Kubo, K., Nagai, S., Izumi, T. (2001) Histamine stimulates alveolar macrophages to release neutrophil and monocyte chemotactic activity J. Lab. Clin. Med. 138,226-235[CrossRef][Medline]
  20. Paegelow, I., Lange, P. (1984) Pharmacological studies on lymphocytes: 2. Effects of indole derivatives and their antagonists on the lymphocyte migration Agents Actions 15,361-366[CrossRef][Medline]
  21. Jaffe, E. A., Nachman, R. L., Becker, C. G., Minick, C. R. (1973) Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria J. Clin. Invest. 52,2745-2756[Medline]
  22. Roos, D., de Boer, M. (1986) Purification and cryopreservation of phagocytes from human blood Methods Enzymol. 132,225-243[Medline]
  23. da Costa, M. P., van den, B. N., Ulfman, L. H., Koenderman, L., Hordijk, P. L., Zwaginga, J. J. (2004) Platelet-monocyte complexes support monocyte adhesion to endothelium by enhancing secondary tethering and cluster formation Arterioscler. Thromb. Vasc. Biol. 24,193-199[Abstract/Free Full Text]
  24. Koenderman, L., Kok, P. T., Hamelink, M. L., Verhoeven, A. J., Bruijnzeel, P. L. (1988) An improved method for the isolation of eosinophilic granulocytes from peripheral blood of normal individuals J. Leukoc. Biol. 44,79-86[Abstract]
  25. Voermans, C., Kooi, M. L., Rodenhuis, S., van der, L. H., van der Schoot, C. E., Gerritsen, W. R. (2001) In vitro migratory capacity of CD34+ cells is related to hematopoietic recovery after autologous stem cell transplantation Blood 97,799-804[Abstract/Free Full Text]
  26. Beillard, E., Pallisgaard, N., van der Velden, V. H., Bi, W., Dee, R., van der Schoot, E., Delabesse, E., Macintyre, E., Gottardi, E., Saglio, G., Watzinger, F., Lion, T., van Dongen, J. J., Hokland, P., Gabert, J. (2003) Evaluation of candidate control genes for diagnosis and residual disease detection in leukemic patients using "real-time" quantitative reverse-transcriptase polymerase chain reaction (RQ-PCR)—a Europe against cancer program Leukemia 17,2474-2486[CrossRef][Medline]
  27. Mould, A. P., Garratt, A. N., Askari, J. A., Akiyama, S. K., Humphries, M. J. (1995) Identification of a novel anti-integrin monoclonal antibody that recognizes a ligand-induced binding site epitope on the β 1 subunit FEBS Lett. 363,118-122[CrossRef][Medline]
  28. Diamond, M. S., Springer, T. A. (1993) A subpopulation of Mac-1 (CD11b/CD18) molecules mediates neutrophil adhesion to ICAM-1 and fibrinogen J. Cell Biol. 120,545-556[Abstract/Free Full Text]
  29. Sakariassen, K. S., Aarts, P. A., de Groot, P. G., Houdijk, W. P., Sixma, J. J. (1983) A perfusion chamber developed to investigate platelet interaction in flowing blood with human vessel wall cells, their extracellular matrix, and purified components J. Lab. Clin. Med. 102,522-535[Medline]
  30. Franke, B., Akkerman, J. W., Bos, J. L. (1997) Rapid Ca2+-mediated activation of Rap1 in human platelets EMBO J. 16,252-259[CrossRef][Medline]
  31. Gabert, J., Beillard, E., van der Velden, V. H., Bi, W., Grimwade, D., Pallisgaard, N., Barbany, G., Cazzaniga, G., Cayuela, J. M., Cave, H., Pane, F., Aerts, J. L., De Micheli, D., Thirion, X., Pradel, V., Gonzalez, M., Viehmann, S., Malec, M., Saglio, G., van Dongen, J. J. (2003) Standardization and quality control studies of "real-time" quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia—a Europe Against Cancer program Leukemia 17,2318-2357[CrossRef][Medline]
  32. Enserink, J. M., Christensen, A. E., de Rooij, J., van Triest, M., Schwede, F., Genieser, H. G., Doskeland, S. O., Blank, J. L., Bos, J. L. (2002) A novel Epac-specific cAMP analogue demonstrates independent regulation of Rap1 and ERK Nat. Cell Biol. 4,901-906[CrossRef][Medline]
  33. Ponsioen, B., Zhao, J., Riedl, J., Zwartkruis, F., van der Krogt, G., Zaccolo, M., Moolenaar, W. H., Bos, J. L., Jalink, K. (2004) Detecting cAMP-induced Epac activation by fluorescence resonance energy transfer: Epac as a novel cAMP indicator EMBO Rep. 5,1176-1180[CrossRef][Medline]
  34. McEver, R. P., Moore, K. L., Cummings, R. D. (1995) Leukocyte trafficking mediated by selectin-carbohydrate interactions J. Biol. Chem. 270,11025-11028[Abstract/Free Full Text]
  35. Luscinskas, F. W., Kansas, G. S., Ding, H., Pizcueta, P., Schleiffenbaum, B. E., Tedder, T. F., Gimbrone, M. A., Jr (1994) Monocyte rolling, arrest and spreading on IL-4-activated vascular endothelium under flow is mediated via sequential action of L-selectin, β1-integrins, and β2-integrins J. Cell Biol. 125,1417-1427[Abstract/Free Full Text]
  36. Tedder, T. F., Steeber, D. A., Chen, A., Engel, P. (1995) The selectins: vascular adhesion molecules FASEB J. 9,866-873[Abstract]
  37. Shimonaka, M., Katagiri, K., Nakayama, T., Fujita, N., Tsuruo, T., Yoshie, O., Kinashi, T. (2003) Rap1 translates chemokine signals to integrin activation, cell polarization, and motility across vascular endothelium under flow J. Cell Biol. 161,417-427[Abstract/Free Full Text]
  38. McLeod, S. J., Li, A. H., Lee, R. L., Burgess, A. E., Gold, M. R. (2002) The Rap GTPases regulate B cell migration toward the chemokine stromal cell-derived factor-1 (CXCL12): potential role for Rap2 in promoting B cell migration J. Immunol. 169,1365-1371[Abstract/Free Full Text]
  39. Tohyama, Y., Katagiri, K., Pardi, R., Lu, C., Springer, T. A., Kinashi, T. (2003) The critical cytoplasmic regions of the {alpha}/β2 integrin in Rap1-induced adhesion and migration Mol. Biol. Cell 14,2570-2582[Abstract/Free Full Text]
  40. Mossner, R., Lesch, K. P. (1998) Role of serotonin in the immune system and in neuroimmune interactions Brain Behav. Immun. 12,249-271[CrossRef][Medline]
  41. Matsuda, H., Ushio, H., Geba, G. P., Askenase, P. W. (1997) Human platelets can initiate T cell-dependent contact sensitivity through local serotonin release mediated by IgE antibodies J. Immunol. 158,2891-2897[Abstract]
  42. Bos, J. L., de Rooij, J., Reedquist, K. A. (2001) Rap1 signaling: adhering to new models Nat. Rev. Mol. Cell Biol. 2,369-377[CrossRef][Medline]
  43. Caron, E. (2003) Cellular functions of the Rap1 GTP-binding protein: a pattern emerges J. Cell Sci. 116,435-440[Abstract/Free Full Text]
  44. Bivona, T. G., Wiener, H. H., Ahearn, I. M., Silletti, J., Chiu, V. K., Philips, M. R. (2004) Rap1 up-regulation and activation on plasma membrane regulates T cell adhesion J. Cell Biol. 164,461-470[Abstract/Free Full Text]
  45. Ashida, N., Arai, H., Yamasaki, M., Kita, T. (2001) Distinct signaling pathways for MCP-1-dependent integrin activation and chemotaxis J. Biol. Chem. 276,16555-16560[Abstract/Free Full Text]
  46. Shih, P. T., Elices, M. J., Fang, Z. T., Ugarova, T. P., Strahl, D., Territo, M. C., Frank, J. S., Kovach, N. L., Cabanas, C., Berliner, J. A., Vora, D. K. (1999) Minimally modified low-density lipoprotein induces monocyte adhesion to endothelial connecting segment-1 by activating β1 integrin J. Clin. Invest. 103,613-625[Medline]
  47. Cybulsky, M. I., Gimbrone, M. A., Jr (1991) Endothelial expression of a mononuclear leukocyte adhesion molecule during atherogenesis Science 251,788-791[Abstract/Free Full Text]
  48. Gerszten, R. E., Lim, Y. C., Ding, H. T., Snapp, K., Kansas, G., Dichek, D. A., Cabanas, C., Sanchez-Madrid, F., Gimbrone, M. A., Jr, Rosenzweig, A., Luscinskas, F. W. (1998) Adhesion of monocytes to vascular cell adhesion molecule-1-transduced human endothelial cells: implications for atherogenesis Circ. Res. 82,871-878[Abstract/Free Full Text]
  49. Parhami, F., Fang, Z. T., Fogelman, A. M., Andalibi, A., Territo, M. C., Berliner, J. A. (1993) Minimally modified low density lipoprotein-induced inflammatory responses in endothelial cells are mediated by cyclic adenosine monophosphate J. Clin. Invest. 92,471-478[Medline]
  50. Vikenes, K., Farstad, M., Nordrehaug, J. E. (1999) Serotonin is associated with coronary artery disease and cardiac events Circulation 100,483-489[Abstract/Free Full Text]
  51. Durk, T., Panther, E., Muller, T., Sorichter, S., Ferrari, D., Pizzirani, C., Di Virgilio, F., Myrtek, D., Norgauer, J., Idzko, M. (2005) 5-Hydroxytryptamine modulates cytokine and chemokine production in LPS-primed human monocytes via stimulation of different 5-HTR subtypes Int. Immunol. 17,599-606[Abstract/Free Full Text]
  52. Robert, S., Maillet, M., Morel, E., Launay, J. M., Fischmeister, R., Mercken, L., Lezoualc’h, F. (2005) Regulation of the amyloid precursor protein ectodomain shedding by the 5-HT4 receptor and Epac FEBS Lett. 579,1136-1142[CrossRef][Medline]
  53. Ridley, A. J., Schwartz, M. A., Burridge, K., Firtel, R. A., Ginsberg, M. H., Borisy, G., Parsons, J. T., Horwitz, A. R. (2003) Cell migration: integrating signals from front to back Science 302,1704-1709[Abstract/Free Full Text]
  54. Ridley, A. J. (2001) Rho GTPases and cell migration J. Cell Sci. 114,2713-2722[Abstract/Free Full Text]
  55. Ridley, A. J. (2001) Rho proteins, PI 3-kinases, and monocyte/macrophage motility FEBS Lett. 498,168-171[CrossRef][Medline]
  56. Zeidler, R., Csanady, M., Gires, O., Lang, S., Schmitt, B., Wollenberg, B. (2000) Tumor cell-derived prostaglandin E2 inhibits monocyte function by interfering with CCR5 and Mac-1 FASEB J. 14,661-668[Abstract/Free Full Text]
  57. Fine, J. S., Byrnes, H. D., Zavodny, P. J., Hipkin, R. W. (2001) Evaluation of signal transduction pathways in chemoattractant-induced human monocyte chemotaxis Inflammation 25,61-67[CrossRef][Medline]
  58. Li, C., Liu, J. N., Gurewich, V. (1995) Urokinase-type plasminogen activator-induced monocyte adhesion requires a carboxyl-terminal lysine and cAMP-dependent signal transduction J. Biol. Chem. 270,30282-30285[Abstract/Free Full Text]
  59. Figueiredo, K. A., Mui, A. L., Nelson, C. C., Cox, M. E. (2006) Relaxin stimulates leukocyte adhesion and migration through a relaxin receptor LGR7-dependent mechanism J. Biol. Chem. 281,3030-3039[Abstract/Free Full Text]
  60. Baillie, G. S., Houslay, M. D. (2005) Arrestin times for compartmentalized cAMP signaling and phosphodiesterase-4 enzymes Curr. Opin. Cell Biol. 17,129-134[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Leukoc. Biol.Home page
N. El Zein, B. Badran, and E. Sariban
VIP differentially activates {beta}2 integrins, CR1, and matrix metalloproteinase-9 in human monocytes through cAMP/PKA, EPAC, and PI-3K signaling pathways via VIP receptor type 1 and FPRL1
J. Leukoc. Biol., April 1, 2008; 83(4): 972 - 981.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
G. Carmona, E. Chavakis, U. Koehl, A. M. Zeiher, and S. Dimmeler
Activation of Epac stimulates integrin-dependent homing of progenitor cells
Blood, March 1, 2008; 111(5): 2640 - 2646.
[Abstract]