PeproTech Inc.
Originally published online as doi:10.1189/jlb.0106011 on September 25, 2006

Published online before print September 25, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0106011v1
80/6/1328    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hoene, V.
Right arrow Articles by Wanner, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hoene, V.
Right arrow Articles by Wanner, R.
(Journal of Leukocyte Biology. 2006;80:1328-1336.)
© 2006 by Society for Leukocyte Biology

Human monocyte-derived dendritic cells express TLR9 and react directly to the CpG-A oligonucleotide D19

Victoria Hoene1, Matthias Peiser1 and Reinhard Wanner2

Institute of Molecular Biology and Bioinformatics, Charité-CBF, Berlin, Germany

2 Correspondence: Institute of Molecular Biology and Bioinformatics, Charité-CBF, Arnimallee 22, 14195 Berlin, Germany. E-mail: reinhard.wanner@charite.de


arrow
ABSTRACT
 
Oligodeoxynucleotides (ODNs) containing unmethylated CpG exhibit their immunostimulatory activities by binding to TLR. Here, we show that human monocyte-derived dendritic cells (moDC) contain TLR9 protein, surprisingly, in amounts comparable with plasmacytoid DC (pDC). Immature moDC but not mature moDC nor monocytes captured CpG-ODNs. moDC stimulation with the CpG-A ODN D19 up-regulated CD83, CD86, and HLA-DR. Without CD40 ligand costimulation, full maturation was not achieved. D19-stimulated moDC primed allogeneic CD4+-T cells for proliferation and differentiation into IFN-{gamma}-secreting Th1 cells. Neither IL-12 nor IL-6 or TNF-{alpha} was involved. Microarray analysis pointed to a participation of Type I IFNs. In fact, D19-stimulated moDC secreted considerable amounts of IFN-{alpha}. This indicates that moDC themselves sense viral and bacterial DNA and do not need help from pDC.

Key Words: cell surface molecules • cell activation • vaccination


arrow
INTRODUCTION
 
Myeloid dendritic cells (mDC), like Langerhans cells and interstitial DC, are central for the initiation of adaptive immune responses. They patrol as immature DC in blood, lymph, and tissues. At this stage of differentiation, they capture soluble and particulate antigens and process and present them on their surface. Danger signals sensed by TLRs induce their migration to secondary lymphoid organs and a maturation process, including up-regulation of cytokines, MHC, and costimulatory molecules [1 ]. After additional costimulation provided by T cells through CD40 ligand (CD40L), mature mDC can secrete inflammatory cytokines such as IL-12, which triggers the differentiation of naïve T lymphocytes to Th1 cells [2 3 4 5 6 ].

mDC can induce B lymphocyte proliferation and antibody production, and they affect the activity of regulatory T lymphocytes [7 , 8 ]. In addition, mDC can induce tumor cell apoptosis directly and can activate NK cells [9 10 11 ].

As a result of the limited availability of human mDC, most studies about DC function relied on cells generated in vitro from DC precursors. The widest use in experimental and clinical studies was made of monocyte-derived DC (moDC) generated by culturing monocytes in the presence of IL-4 and GM-CSF [12 13 14 15 ].

DC can develop along a second pathway leading to precursors of plasmacytoid DC (pDC). These cells are also known as Type I IFN-producing cells, as they secrete 100–1000 times more of Type I IFNs after viral infection than other blood cells [16 , 17 ]. pDC are unrelated to monocytes and lack phagocytic activity [17 , 18 ]. Unlike mDC, the localization of pDC is normally restricted to lymphoid tissues and to peripheral blood [17 ]. Only during pathological conditions, as in psoriasis and systemic lupus erythematosus, pDC infiltrate the skin [19 ].

TLRs are transmembrane proteins mainly expressed in cells of the innate and adaptive immune system. They sense conserved molecular patterns of pathogenic microorganisms and initiate antimicrobial responses. Eleven TLR subtypes are described, which recognize different microbial components [20 , 21 ]. TLR9 evolved as the receptor for unmethylated CpGs, which are more prevalent in bacterial and viral than in vertebrate genomes [22 , 23 ]. Natural CpG sequences can be mimicked by CpG-containing oligonucleotides (ODNs). There are three main CpG ODN types, which are called CpG-A (formerly also called D-type), CpG-B (formerly also called K-type), and CpG-C, which are known to act differentially on TLR9-expressing cell types [24 25 26 27 ]. In humans, TLR9 was found to be expressed in B lymphocytes, NK cells, activated monocytes, and pDC [28 29 30 ]. TLR9 is located intracellularly in vesicles. Based on negative RT-PCR results and on failing of activation after treatment with CpG-B and untypical CpG-A ODNs, human mDC and moDC were believed to miss TLR9 expression [29 30 31 32 33 ].

Separate DC lineages with subset-specific TLR expression would argue for a specialized recognition of different microbial antigens. If, however, only pDC expressed TLR9, only CpG sequences of viruses could be sensed after pDC infection. Bacterial CpG sequences, which are accessible only after phagocytic uptake and fragmentation, would remain undetectable. This and the fact that murine mDC express TLR9 [34 ] led us to analyze TLR9 expression in human moDC using newly available antibodies. In conclusion, we show that human moDC express TLR9 and that their maturation can be triggered directly by CpG-A ODN D19.


arrow
MATERIALS AND METHODS
 
Cells
Normal human buffy coats prepared from anonymous donors were obtained from DRK-Blutspendedienst (Berlin, Germany). PBMC were extracted from buffy coats by density gradient centrifugation over Ficoll (Biochrom, Berlin, Germany) [35 ] and were washed with PBS (Cambrex, Verviers, Belgium) until supernatants were clear. Monocytes were enriched by adherence on tissue-culture dishes (Ø 6 cm; Greiner Bio-one, Frickenhausen, Germany) for 1 h at 37°C in RPMI-1640 medium (Cambrex) containing 10% heat-inactivated FCS (Biochrom) and by subsequently washing the plates with 70 ml of this medium. moDC were generated by culturing monocytes in RPMI 1640/10% FCS for 6 days. On alternate days, recombinant human (rh)IL-4 and rhGM-CSF (Immunotools, Friesoythe, Germany) were added each at final concentrations of 100 ng/ml [12 , 13 ]. For detection of TLR9 by RT-PCR and FACS, moDC were magnetically CD1c-sorted [6 ] using the CD1c [blood DC antigen-1 (BDCA-1)] isolation kit and a large cell column (Miltenyi Biotec, Bergisch-Gladbach, Germany). To receive mature moDC, cells were cultured additionally with 1000 IU/ml IL-6, 10 ng/ml TNF-{alpha}, 10 ng/ml IL-1β (all from Immunotools), and 1 µg/ml PGE2 (Calbiochem, San Diego, CA) for 48 h. Human CD4+CD25-T cells were isolated from the nonplastic-adhering PBMC fraction using the human CD4+-T cell isolation kit (Miltenyi Biotec) followed by magnetic sorting with human CD25 microbeads using Midi-MACS LS columns (Miltenyi Biotec). Human pDC were enriched from PBMC by magnetic sorting with antihuman BDCA-4 microbeads (Miltenyi Biotec). The murine fibroblast cell line TNF-related activation protein (TRAP) expressing rhCD40L was a gift from R. A. Kroczek (Robert Koch Institut, Berlin, Germany) and was cultured in RPMI 1640/10% FCS. 293-hTLR9 cells, stably transfected with human TLR9 and 293 null cells (Invivogen, San Diego, CA), were cultured in DMEM/10% FCS supplemented with blasticidine (Invivogen).

Stimulation of DC
ODNs were synthesized by Tib MolBiol (Berlin, Germany) and had <0.1 endotoxin units/mg x ml using the Limulus amoebocyte lysate test (BioWhittaker, Walkersville, MD). Sequences were 5'–3', D19: ggTGCATCGATGCAGggggg; control D: ggTGCATTGATGCAGggggg; K3: atcgactctcgagcgttctc; control K: tgcaggcttctc (bases in lowercase represent thioates). Cy5-D19 and Cy5-K3 were 5'-labeled. ODNs were applied to cell culture media at a final concentration of 3 µM. LPS from Escherichia coli serotype 0128:B12 (Sigma Chemical Co., Steinheim, Germany) was added at a final concentration of 1 µg/ml. rhCD40L trimer was from Bender (Vienna, Austria), IFN-{gamma} was from PharMingen (Heidelberg, Germany). These stimuli were used at concentrations of 1 µg/ml and 100 IU/ml, respectively. Stimulated cells were cultured in RPMI 1640/10% FCS at 37°C in a humidified atmosphere containing 5% CO2.

FACS analyses
At the indicated time-points, cells were harvested, and antibody staining of 105 cells was measured in a FACSCalibur (BD Biosciences, Heidelberg, Germany). Antibodies used were FITC-conjugated mAb against CD14, CD86, and HLA-DR (all BD Biosciences), PE-conjugated mAb against BDCA-2 and BDCA-4 (Miltenyi Biotec), and FITC-conjugated CD123 (Miltenyi Biotec), CD83 (BD Biosciences), HLA-DR (Immunotech, Marseille, France), and TLR9 (Clone eB72-1665, eBiosciences, San Diego, CA). Mouse antihuman FITC-CD11c was from Serotec (Düsseldorf, Germany). Isotype controls were FITC-conjugated mouse IgG1 (BD Biosciences) and mouse IgG2a (Cymbus Biotechnology, Eastleigh, UK) and PE-conjugated mouse IgG1, mouse IgG2b, and rat IgG2a (all BD Biosciences). Intracellular staining of TLR9 required fixation and permeabilization with Cytofix/Cytoperm and washing with Perm/Wash (both BD Biosciences) before staining. Spectral overlap was corrected by appropriate compensation. Dead cells and debris were excluded by propidium iodide staining (200 ng/ml, Sigma Chemical Co., Deisenhofen, Germany) and scatter gates. Data of 10,000 events each were acquired using CellQuest software (BD Biosciences) and analyzed by WinMDI (Scripps Institute, La Jolla, CA).

RT-PCR
RNA of PBMC, of cells of a fresh monocyte preparation (to adhere, cells have been cultured for 1 h), of moDC at Day 6 of generation, as well as of 293 null and 293-hTLR9 cells was prepared using an Rneasy kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. DNA was digested using the On-column RNase-free DNase set (Qiagen). cDNA was prepared by adding 9 µl RNA to 8.25 µl of a solution of 12.12 µM pd(N)6 random hexamers (Invitrogen, Carlsbad, CA), 1.5 mM deoxy-unspecified nucleoside 5'-triphosphates (dNTPs; Gibco, Grand Island, NY), first-strand buffer (in 1/2 dilution), and 24 mM DTT (Invitrogen, Carlsbad, CA). After incubation at 90°C for 5 min, probes were cooled on ice, and 0.5 µl RNase inhibitor (Promega, Madison, WI) and 0.5 µl SuperScript RT (modified from Moloney murine leukemia virus, Gibco) were added. After 10 min at room temperature, probes were incubated at 42°C for 40 min, thereafter at 90°C for 10 min, and then stored at –20°C. RT-PCR was performed with Taq buffer with KCl (Fermentas, St. Leon-Rot, Germany), 1.4 mM MgCl2, 0.1 mM dNTPs (Invitrogen, Carlsbad, CA), 0.01 U Taq DNA-Polymerase LC (Fermentas), primers (Tib MolBiol), each at a concentration of 0.5 µM, and cDNA probes, which were titrated to equal β-actin contents. Primers for β-actin were 5'-CGGGAAATCGTGCGTGACAT-3' and 5'-TGGAAGGTGGACAGCGAGGC-3', and PCR was run for 24 cycles consisting of 1 min at 94°C, 30 s at 55°C, and 1 min at 72°C. Primers for BDCA-2 were 5'-TGCGTCATGGAAGGAAAGG-3' and 5'-CACCTGAGTGCCAGAATGTGA-3', and PCR was run for 35 cycles consisting of 1 min at 94°C, 30 s at 60°C, and 1 min at 72°C. Primers for TLR9A were 5'-AGCATGGGTTTCTGCCGCAGC-3' and 5'-CGGTTGGAGGACAAGGAAAGGC-3' (product length, 224 bp), and PCR was run for 35 cycles consisting of 1 min at 94°C, 30 s at 64°C, and 1 min at 72°C. Reactions (10 µl of 25 µl) were electrophoresed on 1% agarose gels and stained with ethidium bromide. Documentation was done with a gel doc 2000 station (BioRad, München, Germany).

Western blotting
Cells were lysed in 50 mM MOPS, pH 7.4, 5 mM MgCl2, 1x protease inhibitor cocktail (Roche, Penzberg, Germany), and 400 U/ml DNase I (Roche). For complete lysis, the cell suspensions were frozen and thawed repeatedly. After addition of 400 U/ml DNase I and incubation overnight at 6°C, sample buffer was added to final concentrations of 62.5 mM Tris HCl, pH 6.8, 2% SDS, 5% β-ME, 10% glycerol, and 0.001% bromphenol blue. The samples were boiled for denaturation, separated by SDS-PAGE on 8% gels, and then transferred to nitrocellulose membranes (0.45 µm, Schleicher and Schuell, Dassel, Germany) by semidry blotting. The membranes were blocked with 5% skim milk (Merck, Darmstadt, Germany) in TBS, incubated with goat antihuman TLR9 (sc-16247, 1:100) or rat antihuman TLR9 (eB72-1665, 1:100, eBioscience, Kranenburg, Germany) overnight, washed three times, and incubated with peroxidase-conjugated rabbit antigoat IgG (1:20 000) or with goat antirat IgG (1.5000) for 3 h. The antibodies (except eB72-1665) were purchased from Santa Cruz Biotechnology (CA). After further washing, the blots were incubated with Super Signal West Femto chemiluminescent substrate (Pierce, Rockford, IL) and analyzed in a gel doc 2000 station (BioRad).

For Western blotting of deglycosylated proteins, lysed cell suspensions were adjusted to 0.25% SDS, heated to 95°C for 5 min, cooled on ice, and then incubated with 0.2 U/µl N-glycosidase F (Roche) in 50 mM MOPS, pH 7.4/0.67% CHAPS (Sigma Chemical Co.) for 2 h at 37°C before SDS-PAGE using SC-16247.

Microscopy
Microscopy was performed using a Leica DMRBE fluorescence microscope (Bensheim, Germany) equipped with a Hg-lamp, a Leica 40x water-immersion objective, filter sets from Omega Optical (Seefeld, Germany), and a Hamamatsu digital camera C4742-95 (Herrsching, Germany). Images were taken using Openlab software (Improvision, Heidelberg, Germany). Before microscopy, stimulating/staining solutions were removed, and cells were washed twice.

ELISA
For the detection of IL-4, IL-6, IL-12p70, TNF-{alpha}, and IFN-{gamma}, DuoSet ELISA kits from R&D Systems (Wiesbaden, Germany) were used. IFN-{alpha} was determined with the BioSource kit (Camarillo, CA), extended for pDC and high-sensitivity range for moDC.

MLR
CD4+CD25-T cells were washed twice with PBS and adjusted to a density of 107 cells/ml in PBS. CFSE (Molecular Probes, Leiden, The Netherlands) was added at a final concentration of 50 nM. After 10 min at room temperature, 4 vol RPMI 1640/10% FCS was added, and cells were washed twice using this medium. T cells (105) and moDC at a ratio of 20:1 were cocultured for 6 days in 96-well U-bottom clusters (Corning, Wiesbaden, Germany). Oligos and LPS were not applied to the MLR media. The harvested cells were stained with a PE-Cy5-labeled anti-CD4 antibody (BD Biosciences). The CFSE fluorescence intensity of PE-Cy5-gated cells was determined by FACS analysis.

Microarray
RNA was isolated using the RNeasy kit (Qiagen). According to Affymetrix’s target preparation and hybridization protocols, cDNA was synthesized using a HPLC-purified T7-dT24 primer (MWG, Ebersberg, Germany) and Superscript II RT (Invitrogen, Karlsruhe, Germany). Second-strand synthesis was performed with E. coli DNA ligase, DNA polymerase I, and RNase H (all from Invitrogen, Karlsruhe, Germany). Cleanup of double-stranded cDNA was done by phenol/chloroform extraction. Biotinylated cRNA was prepared using the BioArray High Yield RNA transcription kit (Enzo Diagnosics, Farmingdale, NY). The amplified cRNA was purified with an affinity resin column (Qiagen), heat-fragmented, quantified by UV spectroscopy, and analyzed on a LabChip bioanalyzer (Agilent, Santa Clara, CA). HG-U 133 A 2.0 chips were hybridized and analyzed according to standard Affymetrix protocols. Data are deposited in the National Center for Biotechnology Information-Gene Expression Omnibus (NCBI-GEO) depository under Accession Number GSE2859.


arrow
RESULTS
 
Removal of pDC from monocyte preparations
Typically, 0.2–1% PBMC were BDCA-2+/CD123+pDC (Fig. 1a ). These cells were removed quantitatively during the enrichment of the monocyte fraction used for the following in vitro generation of moDC (Fig. 1a) . It is known that cell culturing results in a loss of BDCA-2 expression. The monocytes have been in cell culture for 1 h only and should not have lost TLR9 protein during this time. In moDC preparations at Day 6 of generation, any residual or newly generated pDC would not be identifiable using BDCA-2 expression. However, any pDC newly generated during cell culturing might be identifiable by increased CD123 levels. However, moDC generation was associated with a decrease in CD123 expression (Fig. 1a) . RT-PCR of BDCA-2 showed that BDCA-2 was expressed in PBMC but not in the cells of the monocyte preparation (Fig. 1b) . During the 6-day generation time, the cell culture media were not supplied with IL-3 necessary for pDC survival [36 ]. In conclusion, the moDC cultures used in this study can be regarded as virtually devoid of pDC.


Figure 1
View larger version (43K):
[in this window]
[in a new window]

 
Figure 1. The monocyte preparation used for moDC generation was free of contaminating pDC. (A) FACS analyses of BDCA-2 and CD123 expression in PBMC, in fresh monocyte, and in moDC preparations. Shown is staining without gating. One representative experiment of four with various blood donors is shown. (B) RT-PCR analysis of BDCA-2 expression in PBMC (lane A), fresh monocytes (lane B), and moDC at Day 6 of generation (lane C).

The generation of moDC from monocytes was monitored routinely by analysis of CD14 expression (not shown). For comparison of moDC with pDC, pDC populations were enriched magnetically from fresh PBMC to at least 80% BDCA-4+ cells (not shown).

MoDC express TLR9
For analysis of TLR9 expression, we purified the moDC further via CD1c sorting to a homogenous CD1c+CD11c+ cell population (Fig. 2a , dot blot).


Figure 2
View larger version (31K):
[in this window]
[in a new window]

 
Figure 2. moDC express TLR9. Expression of TLR9 in permeabilized monocytes, CD1c-sorted moDC, pDC preparations, and in 293-hTLR9 and 293 null cells was determined by RT-PCR (a) and by FACS analyses using antibody eB72-1665 (filled, gray areas: isotype controls). The dot blot shows CD1c-sorted moDC without using gates (b) and in pDC and moDC preparations by Western blotting using antibody sc-16247 (c). Shown are representative experiments. MW Std., Molecular weight standards.

We chose to examine the transcription of the TLR9 variant A, which contains an intron. This allowed us to place the upstream primer over the exon/intron border to exclude amplification from any residual genomic DNA. By RT-PCR, TLR9A transcripts could be detected in CD1c+ moDC (Fig. 2a) . For comparision, 293-hTLR9 cells stably expressing TLR9A under the control of the strong hEF1/human T cell lymphotropic virus composite promoter generated a strong band, and 293 null cells were negative (Fig. 2a) . However, a reduction of the annealing temperature of 6°C resulted in the amplification of a fragment with correct length in 293 null cells also (not shown).

In FACS analysis, permeabilized monocytes and 293 null cells stained faintly positive for TLR9 as compared with the irrelevant antibody control (Fig. 2b) . 293-hTLR9 cells revealed high staining levels (Fig. 2b) . Intermediate TLR9 expression was detected in pDC and in CD1c+ moDC (Fig. 2b) .

Western blotting using antihuman TLR9 sc-16247 antibody revealed an apparent molecular weight of 200 kDa of the glycoprotein (Fig. 2c) . The TLR9 protein levels of moDC and pDC were comparable. However, bands became detectable only when applying the enormous protein amount of 7.5 x 106 cells/lane. After deglycosylation of proteins in moDC and pDC lysates using recombinant N-glycosidase F, TLR9 was not further detectable in Western blot analysis (not shown).

In moDC and pDC, Western blotting using antihuman TLR9 eB72-1665 did not result in TLR9 protein detection, and in 293-hTLR9 cells, neither the use of antibody sc-16247 nor eB72-1665 could provide evidence for TLR9 protein expression (not shown).

In addition, TLR9 expression in the human melanocyte cell line MeWo, in the human keratinocyte cell line HaCaT, and in primary human mast cells was analyzed. Although MeWo and mast cells were comparable with 293 null cells, HaCaT cells stained faintly positive in FACS analysis (not shown).

MoDC are activated by the CpG-A ODN D19
Unlike monocytes, unstimulated moDC quickly incorporated Cy5-labeled D19- and K3-CpG oligonucleotides into vesicular structures (Fig. 3 ). Prestimulation of moDC with unlabeled D19 or K3 for 24 h and 48 h did not alter the uptake of the labeled oligonucleotides (not shown). After treatment with IL-6, TNF-{alpha}, IL-1β, and PGE2 and coculture with murine fibroblasts expressing rCD40L (TRAP cells) for 2 days, the thereby matured moDC had lost the ability to capture labeled oligonucleotides (Fig. 3) .


Figure 3
View larger version (91K):
[in this window]
[in a new window]

 
Figure 3. Immature moDC incorporate CpG oligonucleotides. Transmission light and fluorescence microscopy 30 min after addition of Cy5-labeled D19 CpG oligonucleotides to monocytes, to unstimulated moDC, and to moDC matured by 2 days culture on CD40L-expressing TRAP cells in IL-6-, TNF-{alpha}-, IL-1β-, and PGE2-supplemented media. Original bars equal 10 µm. Shown are representative pictures.

Twenty-four hours and 48 h after addition of CpGs to moDC cultures, the expression levels of the costimulatory molecule CD86, of the maturation marker CD83, and of HLA-DR were determined. Stimulation with D19 induced increased expression levels of all of these activation markers as compared with stimulation with non-CpG control D and with untreated cell cultures (24 h stimulations in Fig. 4a ; 48 h stimulations not shown). The minor lymphocyte fraction present in moDC cultures was not shifted to increased CD86 expression in response to D19 application (Fig. 4b) . Treatment of moDC with K3 did not result in increased CD86, CD83, and HLA-DR expression (Fig. 4a) . Stimulation with LPS clearly resulted in more elevated levels (Fig. 4a) . There were minor donor-dependent variations. In two exceptional experiments of 12, however, moDC increased their activation marker expression solely after D19 or solely after LPS treatment (not shown).


Figure 4
View larger version (27K):
[in this window]
[in a new window]

 
Figure 4. D19 induced moDC to increase CD83, CD86, and HLA-DR expression. (a) FACS analyses of moDC preparations 24 h after addition of D19, control D, K3, or LPS and of untreated controls. Shown is one representative experiment of 10. The numbers indicate mean fluorescence intensity (MFI) values. Donor-dependent variations are shown below (P values of D19 vs. nonstimulation and control D-treated samples. *, P<0.05; **, P<0.01). Rare exceptional probes were not included into statistics. (b) The dot-plots represent side-scatter (SSC) and CD86 analyses of moDC preparations. The minor lymphocyte fraction was not shifted to increased CD86 expression after D19 treatment.

Secretion of IL-12p70, IL-6, and TNF-{alpha} by moDC was determined after addition of 3 µM D19, 3 µM control D, or 1 µg/ml LPS and without treatment. In addition, the moDC cultures were provided with soluble CD40L trimer at a concentration of 1 µg/ml, with 1 µg/ml CD40L trimer plus 1000 IU/ml IFN-{gamma}, or moDC were seeded onto confluent layers of TRAP cells. If measured 24 h after addition, D19 treatment resulted in increased TNF-{alpha} secretion as compared with control D and untreated controls (Fig. 5 ). Stimulation with LPS, however, induced a more pronounced TNF-{alpha} release (Fig. 5) . Secretion of IL-12p70 and IL-6 was not influenced by D19. Concerning these cytokines, LPS was also the more potent inducer. Additional treatment with CD40L trimer had no effect, whereas the strong induction of cytokine secretion provoked by TRAP cells was independent from prestimulation with danger signals (Fig. 5) .


Figure 5
View larger version (29K):
[in this window]
[in a new window]

 
Figure 5. Stimulation of moDC with D19 did not result in increased IL-12p70, IL-6, or TNF-{alpha} secretion. Shown are ELISA assessments of treatment groups as indicated. Values correspond to 106 cells/ml. Five independent experiments in triplicates were performed. When indicated, CD40L trimer was added at 1 µg/ml and IFN-{gamma} at 1000 IU/ml. TRAP cells express rhCD40L.

In MLR, allogeneic CD4+T cell proliferation was induced by moDC (Fig. 6 ). Compared with untreated moDC, T cell proliferation induced by D19-treated moDC was 1.4-fold, by control D 1.1-fold, and by LPS 1.9-fold (Fig. 6) . IL-4 was not detectable in the MLR culture media, but IFN-{gamma} was secreted at levels corresponding to the particular proliferation rates (Fig. 6) .


Figure 6
View larger version (13K):
[in this window]
[in a new window]

 
Figure 6. D19-treated moDC induced increased T cell proliferation in MLR and elevated IFN-{gamma} secretion. Allogeneic CFSE-stained CD4+CD25-T cells and moDC pretreated as indicated were mixed in a 20:1 ratio and cocultured for 6 days. Intensity of CFSE fluorescence of CD4+-T cells was analyzed by FACS. IFN-{gamma} concentrations in MLR media after culturing 106 cells/ml were measured by ELISA. Shown are triplicates of one representative out of three experiments (P values of D19 vs. nonstimulation and control D-treated samples. *, P<0.05.

D19 induced differential expression of IFN-related genes
moDC of the same donor were left untreated or were treated with 3 µM D19 or 3 µM control D for 6 h, and gene expression was analyzed using Affymetrix U133A 2.0 chips. Fifty-five percent of the genes represented on the chip were active. The gene expression profiles of untreated and control D-treated moDC were virtually identical. The myeloid markers CD11c, CD13, and CD33 were present, whereas CD123, which is highly expressed in pDC, was absent. Only seven genes were down-regulated in response to D19. Among them was the gene aquaporin AQP3, which is known to be expressed in immature DC and down-regulated during DC maturation [37 ]. The expression of 70 genes was up-regulated at least twofold in response to D19. Thereof, 24 genes were related to IFN, chemotaxis, and apoptosis (Table 1 ). For that reason, it was promising to measure IFN-{alpha} in untreated and in control D- and D19-treated moDC cultures. In fact, D19 clearly up-regulated IFN-{alpha} secretion in moDC (Fig. 7 ). As compared with D19-treated pDC, the levels of IFN-{alpha} produced by D19-treated moDC of different donors were 20- to 100-fold lower (Fig. 7) .


View this table:
[in this window]
[in a new window]

 
Table 1. Differential Gene-Expression Analysis Revealed an Up-Regulation of IFN-Chemotaxis-, and Apoptosis Related Genes in D19-Treated moDCsa


Figure 7
View larger version (15K):
[in this window]
[in a new window]

 
Figure 7. D19 induced IFN-{alpha} secretion in moDC. (a) IFN-{alpha} in the supernatants of media containing 106 cells/ml Donor I–IV was determined by ELISA after stimulation times as indicated. (b) For comparison, IFN-{alpha} secretion by pDC after D19 and control D treatment for 24 h are shown. One representative out of three experiments.


arrow
DISCUSSION
 
Although in the mouse system, it is generally accepted that other DC than pDC can express protein of TLR9, there are no investigations in human myeloid cells. We have shown here that human moDC express TLR9 protein and mature in response to the CpG-A ODN D19. The thereby matured moDC induce increased T cell proliferation and Th1 differentiation. These results cannot be interpreted as artifacts brought about by other TLR9-expressing cell types contaminating the moDC cultures. As analyzed by flow cytometry and RT-PCR, CD123+ cells with the pDC marker BDCA-2 were quantitatively removed during the preparation of fresh monocytes (Fig. 1) . Any residual, undetected pDC would not have survived a 6-day culture period without IL-3 supplementation [36 ]. In addition, the gene of CD123, which is highly expressed in pDC, was found inactive in microarray analysis. The moDC cultures obviously contained lymphocytes. Among these, B cells share some DC features but did not react to D19 stimulation (Fig. 4b) , a finding recently also described [26 ]. In addition, it was shown that B cells are more sensitive to CpG-B ODN [38 ].

Monocytes, mDC, moDC, and pDC differ in their expression of TLR9. Human monocytes were found to transcribe some TLR9 but did not react to stimulation with the CpG-B ODN 2006 and with the nonclassified CpG ODN AAC-30 [28 , 30 ]. Flow cytometrical analysis indicated that TLR9 protein is present on the cell surface of human monocytes. Moreover, infection with Yersinia pestis and stimulation with the CpG-B ODN 10103 induced increased cell-surface and cytoplasmic TLR9 expression [39 ]. Published RT-PCR data indicate that human mDC and moDC transcribe no or low amounts of TLR9, whereas pDC clearly show expression [28 29 30 , 40 ]. In the published RT-PCR studies, the primers shared sequences identical in all of the TLR9 isoforms [41 , 42 ]. The same primers were described to detect TLR9 in pDC [28 , 29 , 40 ]. To exclude amplification from any residual genomic DNA, RT-PCR primers should be placed over exon/intron borders or should span over an intron. There are two TLR9 transcript variants, A and B, and only Variant A contains an intron. We therefore constricted our analysis to TLR9A transcription. We found that human CD1c-sorted moDC transcribe the TLR9 Variant A. 293 null cells were found to transcribe TLR9A, if the PCR was performed at lowered annealing temperatures. These cells are known to express some TLR3. Our RT-PCR and FACS data (see below) might indicate that 293 null cells also express TLR9 at a low level.

To the best of our knowledge, data about TLR9 protein expression in human mDC and moDC were as-yet unpublished. The results presented here suggest that freshly isolated, nonactivated human monocytes do not contain TLR9 protein and show that differentiation to moDC induces intracellular TLR9 expression (Fig. 2a) . Although the TLR9 antibodies used were said to be applicable in Western blotting, we have doubts about their quality for this purpose. Our results of Western blotting concerning TLR9 expression were not conclusive. Immunoblotting revealed a molecular weight of ~200 kDa of the glycoprotein (Fig. 2b) . As glycosylation patterns are cell type-specific, this result would argue for an increased carbohydrate fraction in DC as compared with human embryonic kidney cells [43 , 44 ]. However, our attempts to stain deglycosylated TLR9 using the available antibodies were not successful. The need for high amounts of total cellular protein together with a sensitive detection method indicates that TLR9 is expressed at low numbers. It is surprising that moDC and pDC showed bands of comparable intensity (Fig. 2b) . This result proposes that the cell type-specific and different effects of CpG ODN stimulation depend on further, as-yet unknown factors. These may also be responsible for the cell type-specific preference for CpG ODN sequences.

At Day 6 of in vitro generation, moDC captured fluorochrome-labeled D19 and K3 into vesicular structures (Fig. 3) . CpG ODN prestimulation did not down-regulate the endocytotic potential and thus, did not result in the mature phenotype observed in moDC treated with the cytokine cocktail plus CD40L.

During in vitro generation, moDC spontaneously access a maturation program [1 , 12 ]. However, compared with untreated and control D-treated cells, D19 stimulation resulted in a further increased expression of the costimulatory molecule CD86, the maturation marker CD83, and of HLA-DR (Fig. 4a) . The level of HLA-DR in D19-stimulated moDC was even higher than the expression reported for ODN 2216-stimulated, IFN-{alpha} secreting pDC [45 ]. In previous studies about stimulation of moDC and mDC, K-type CpG ODN did not result in moDC stimulation [29 , 31 , 32 ], nor did K3, used in this study (Fig. 4a) . The as-yet used CpG-A ODNs did not activate moDC either. However, ODN 1585 and 1668 contain a murine CpG motif [46 , 47 ], and ODN 2216 contains two CpG motifs [29 ], whereas CpG-A ODNs typically contain only one CpG motif.

After LPS treatment, more cells showed surface expression for CD86, CD83, and HLA-DR as compared with D19 (Fig. 4a) . Nonetheless, D19 and LPS applications resulted in elevated levels of CD4+-T cell proliferation together with Th1 differentiation (Fig. 6a and 6b) . Without further CD40L costimulation, D19 did not lead to secretion of typical moDC inflammatory cytokines, including the Th1-inducing IL-12 (Fig. 6) . The microarray analysis using the Affymetrix platform pointed to an involvement of Type I IFN (Table 1) , and in fact, D19 induced moDC to secrete IFN-{alpha} (Fig. 7) . The absolute amounts of produced IFN-{alpha} showed a donor-dependent variability. The reason could not be analyzed further as a result of the donor’s anonymity. However, two of the four D19-stimulated moDC preparations produced IFN-{alpha} at 1/20 and 1/50 of the amounts of pDC and thus topped the IFN-{alpha} production of any other virus-infected blood cells (Fig. 7) [17 ]. Further support for the regulation of transcription of IFN-{alpha} is provided by detection of IRFs using microarray analysis. In addition to IRF1 (Table 1) , dim up-regulation (1.7-fold) of IRF7 was observed in D19-stimulated moDC, suggesting a feedback mechanism for IFN-{alpha} as postulated recently [48 ]. IFN-{alpha} participates in the induction of adaptive immune responses [48 49 50 ]. Besides augmentation of costimulatory molecules, IFN-{alpha} is also supposed to polarize T cells into the Th1 subset [51 ]. CpG ODN-stimulated pDC can activate mDC, possibly via IFN-{alpha} [17 , 33 ]. MoDC stimulated directly by D19 produce IFN-{alpha} by themselves and thus need no help from pDC. Moreover, it could be speculated that in the periphery, DC different from pDC have the capacity to react immediately on pathogenic invaders by activating cytotoxic NK cells via IFN-{alpha}.

moDC are considered promising therapeutic vaccines in cancer [52 ]. The strength of their activation by D19 is less intense as compared with LPS, probably the most potent inflammatory, naturally occurring stimulus. However, TLR agonist combinations synergistically trigger a Th1-polarizing program in mDC and moDC [53 ]. Therefore, inclusion of D19 in combined moDC stimulation could be relevant for immunotherapy.


arrow
ACKNOWLEDGEMENTS
 
We thank U. Ungethüm (Charité, LFGC) for performing the microarray, A. Klein (our institute) for help with microarray analysis, and A. Becht (our institute) for help with the MLR.


arrow
FOOTNOTES
 
1 These authors contributed equally to this work. Back

Received January 6, 2006; revised July 21, 2006; accepted August 19, 2006.


arrow
REFERENCES
 
    1
  1. Banchereau, J., Steinman, R. M. (1998) Dendritic cells and the control of immunity Nature 392,245-252[CrossRef][Medline]
  2. 2
  3. Banchereau, J., Briere, F., Caux, C., Davoust, J., Lebecque, S., Liu, Y. J., Pulendran, B., Palucka, K. (2000) Immunobiology of dendritic cells Annu. Rev. Immunol. 18,767-811[CrossRef][Medline]
  4. 3
  5. Schulz, O., Edwards, A. D., Schito, M., Aliberti, J., Manickasingham, S., Sher, A., Reis e Sousa, C. (2000) CD40 triggering of heterodimeric IL-12 p70 production by dendritic cells in vivo requires a microbial priming signal Immunity 13,453-462[CrossRef][Medline]
  6. 4
  7. Snijders, A., Kalinski, P., Hilkens, C. M., Kapsenberg, M. L. (1998) High-level IL-12 production by human dendritic cells requires two signals Int. Immunol. 10,1593-1598[Abstract/Free Full Text]
  8. 5
  9. Edwards, A. D., Manickasingham, S. P., Sporri, R., Diebold, S. S., Schulz, O., Sher, A., Kaisho, T., Akira, S., Reis e Sousa, C. (2002) Microbial recognition via Toll-like receptor-dependent and -independent pathways determines the cytokine response of murine dendritic cell subsets to CD40 triggering J. Immunol. 169,3652-3660[Abstract/Free Full Text]
  10. 6
  11. Peiser, M., Wanner, R., Kolde, G. (2004) Human epidermal Langerhans cells differ from monocyte-derived Langerhans cells in CD80 expression and in secretion of IL-12 after CD40 cross-linking J. Leukoc. Biol. 76,616-622[Abstract/Free Full Text]
  12. 7
  13. Dhodapkar, M. V., Steinman, R. M. (2002) Antigen-bearing immature dendritic cells induce peptide-specific CD8(+) regulatory T cells in vivo in humans Blood 100,174-177[Abstract/Free Full Text]
  14. 8
  15. Thompson, A. G., Thomas, R. (2002) Induction of immune tolerance by dendritic cells: implications for preventive and therapeutic immunotherapy of autoimmune diseases Immunol. Cell Biol. 80,509-519[CrossRef][Medline]
  16. 9
  17. Lu, G., Janjic, B. M., Janjic, J., Whiteside, T. L., Storkus, W. J., Vujanivic, N. L. (2002) Innate direct anticancer effector function of human immature dendritic cells. II. Role of TNF, lymphotoxin-{alpha}(1)β(2), Fas ligand, and TNF-related apoptosis-inducing ligand J. Immunol. 168,1831-1839[Abstract/Free Full Text]
  18. 10
  19. Zitvogel, L. (2002) Dendritic and natural killer cells cooperate in the control/switch of innate immunity J. Exp. Med. 195,F9-F14[Free Full Text]
  20. 11
  21. Andrews, D. M., Scalzo, A. A., Yokoyama, W. M., Smyth, M. J., Degli-Esposti, M. A. (2003) Functional interactions between dendritic cells and NK cells during viral infection Nat. Immunol. 4,175-181[CrossRef][Medline]
  22. 12
  23. Sallusto, F., Lanzavecchia, A. (1994) Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor {alpha} J. Exp. Med. 179,1109-1118[Abstract/Free Full Text]
  24. 13
  25. Romani, N., Gruner, S., Brang, D., Kampgen, E., Lenz, A., Trockenbacher, B., Konvalinka, G., Fritsch, P. O., Steinman, R. M., Schuler, G. (1994) Proliferating dendritic cell progenitors in human blood J. Exp. Med. 180,83-93[Abstract/Free Full Text]
  26. 14
  27. Höltl, L., Zelle-Rieser, C., Gander, H., Papesh, C., Ramoner, R., Bartsch, G., Rogatsch, H., Barsoum, A. L., Coggin, J. H., Jr, Thurnher, M. (2002) Immunotherapy of metastatic renal cell carcinoma with tumor lysate-pulsed autologous dendritic cells Clin. Cancer Res. 8,3369-3376[Abstract/Free Full Text]
  28. 15
  29. Schuler-Thurner, B., Schultz, E. S., Berger, T. G., Weinlich, G., Ebner, S., Woerl, P., Bender, A., Feuerstein, B., Fritsch, P. O., Romani, N., Schuler, G. (2002) Rapid induction of tumor-specific type 1 T helper cells in metastatic melanoma patients by vaccination with mature, cryopreserved, peptide-loaded monocyte-derived dendritic cells J. Exp. Med. 195,1279-1288[Abstract/Free Full Text]
  30. 16
  31. Siegal, F. P., Kadowacki, N., Shodell, M., Fitzgerald-Bocarsly, P. A., Shah, K., Ho, S., Antonenko, S., Liu, Y. L. (1999) The nature of the principal type 1 interferon-producing cells in human blood Science 284,1835-1837[Abstract/Free Full Text]
  32. 17
  33. Liu, Y. J. (2005) IPC: professional type 1 interferon-producing cells and plasmacytoid cell precursors Annu. Rev. Immunol. 23,275-306[CrossRef][Medline]
  34. 18
  35. Steinman, R. M. (2003) Some interfaces of dendritic cell biology APMIS 111,675-697[CrossRef][Medline]
  36. 19
  37. Nestle, F. O., Conrad, C., Tun-Kyi, A., Homey, B., Gombert, M., Boyman, O., Burg, G., Liu, Y. J., Gilliet, M. (2005) Plasmacytoid predendritic cells initiate psoriasis through interferon-{alpha} production J. Exp. Med. 202,135-143[Abstract/Free Full Text]
  38. 20
  39. Takeda, K., Akira, S. (2005) Toll-like receptors in innate immunity Int. Immunol. 17,1-14[Abstract/Free Full Text]
  40. 21
  41. Yarovinsky, F. D., Zhang, D., Andersen, J. F., Bannenberg, G. L., Serhan, C. N., Hayden, M. S., Hieny, S., Sutterwala, F. S., Flavell, R. A., Ghosh, S., Sher, A. (2005) TLR11 activation of dendritic cells by a protozoan profilin-like protein Science 308,1626-1629[Abstract/Free Full Text]
  42. 22
  43. Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M., Hoshino, K., Wagner, H., Takeda, K., Akira, S. (2000) A Toll-like receptor recognizes bacterial DNA Nature 408,740-745[CrossRef][Medline]
  44. 23
  45. Bird, A. P., Taggart, M. H., Nicholls, R. D., Higgs, D. R. (1987) Non-methylated CpG-rich islands at the human {alpha}-globin locus: implications for evolution of the {alpha}-globin pseudogene EMBO J. 6,999-1004[Medline]
  46. 24
  47. Verthelyi, D., Ishii, K. J., Gursel, M., Takeshita, F., Klinman, D. M. (2001) Human peripheral blood cells differentially recognize and respond to two distinct CPG motifs J. Immunol. 166,2372-2377[Abstract/Free Full Text]
  48. 25
  49. Hartmann, G., Battiany, J., Poeck, H., Wagner, M., Kerkmann, M., Lubenow, N., Rothenfusser, S., Endres, S. (2003) Rational design of new CpG oligonucleotides that combine B cell activation with high IFN-{alpha} induction in plasmacytoid dendritic cells Eur. J. Immunol. 33,1633-1641[CrossRef][Medline]
  50. 26
  51. Marshall, J. D., Fearon, K., Abbate, C., Subramanian, S., Yee, P., Gregorio, J., Coffman, R. L., van Nest, G. (2003) Identification of a novel CpG DNA class and motif that optimally stimulate B cell and plasmacytoid dendritic cell functions J. Leukoc. Biol. 73,781-792[Abstract/Free Full Text]
  52. 27
  53. Vollmer, J., Weeratna, R., Payette, P., Jurk, M., Schetter, C., Laucht, M., Wader, T., Tluk, S., Liu, M., Davis, H. L., Krieg, A. M. (2004) Characterization of three CpG oligodeoxynucleotide classes with distinct immunostimulatory activities Eur. J. Immunol. 34,251-262[CrossRef][Medline]
  54. 28
  55. Hornung, V., Rothenfusser, S., Britsch, S., Krug, A., Jahrsdorfer, B., Giese, T., Endres, S., Hartmann, G. (2002) Quantitative expression of Toll-like receptor 1-10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides J. Immunol. 168,4531-4537[Abstract/Free Full Text]
  56. 29
  57. Jarrossay, D., Napolitani, G., Colonna, M., Sallusto, F., Lanzavecchia, A. (2001) Specialization and complementarity in microbial molecule recognition by human myeloid and plasmacytoid dendritic cells Eur. J. Immunol. 31,3388-3393[CrossRef][Medline]
  58. 30
  59. Kadowaki, N., Ho, S., Antonenko, S., Malefyt, R. W., Kastelein, R. A., Bazan, F., Liu, Y. L. (2001) Subsets of human dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens J. Exp. Med. 194,863-869[Abstract/Free Full Text]
  60. 31
  61. Hartmann, G., Weiner, G. J., Krieg, A. M. (1999) CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells Proc. Natl. Acad. Sci. USA 96,9305-9310[Abstract/Free Full Text]
  62. 32
  63. Bauer, M., Redecke, V., Ellwart, J. W., Scherer, B., Kremer, J. P., Wagner, H., Lipford, G. B. (2001) Bacterial CpG-DNA triggers activation and maturation of human CD11c–, CD123+ dendritic cells J. Immunol. 166,5000-5007[Abstract/Free Full Text]
  64. 33
  65. Krug, A., Towarowski, A., Britsch, S., Rothenfusser, S., Hornung, V., Bals, R., Giese, T., Engelmann, H., Endres, S., Krieg, A. M., Hartmann, G. (2001) Toll-like receptor expression reveals CpG DNA as a unique microbial stimulus for plasmacytoid dendritic cells which synergizes with CD40 ligand to induce high amounts of IL-12 Eur. J. Immunol. 31,3026-3037[CrossRef][Medline]
  66. 34
  67. Boonstra, A., Asselin-Paturell, C., Gilliet, M., Crain, C., Trinchieri, G., Liu, Y. J., O’Garra, A. (2003) Flexibility of mouse classical and plasmacytoid-derived dendritic cells in directing T helper type 1 and 2 cell development: dependency on antigen dose and differential Toll-like receptor ligation J. Exp. Med. 197,101-109[Abstract/Free Full Text]
  68. 35
  69. Bøyum, A. (1968) Isolation of mononuclear cells and granulocytes from human blood. Isolation of mononuclear cells by one centrifugation, and of granulocytes by combining centrifugation and sedimentation at 1 g Scand. J. Clin. Lab. Invest. Suppl. 97,77-89[Medline]
  70. 36
  71. Grouard, G., Rissoan, M. C., Filgueira, L., Durand, I., Banchereau, J., Liu, Y. J. (1997) The enigmatic plasmacytoid T cells develop into dendritic cells with interleukin (IL)-3 and CD40-ligand J. Exp. Med. 185,1101-1111[Abstract/Free Full Text]
  72. 37
  73. De Baey, A., Lanzavecchia, A. (2000) The role of aquaporins in dendritic cell macropinocytosis J. Exp. Med. 191,743-748[Abstract/Free Full Text]
  74. 38
  75. Krieg, A. M. (2002) CpG motifs in bacterial DNA and their immune effects Annu. Rev. Immunol. 20,709-760[CrossRef][Medline]
  76. 39
  77. Saikh, K. U., Kissner, T. L., Sultana, A., Ruthel, G., Ulrich, R. G. (2004) Human monocytes infected with Yersinia pestis express cell surface TLR9 and differentiate into dendritic cells J. Immunol. 173,7426-7434[Abstract/Free Full Text]
  78. 40
  79. Bauer, S., Kirschning, C. J., Hacker, H., Redecke, V., Hausmann, S., Akira, S., Wagner, H., Lipford, G. B. (2001) Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition Proc. Natl. Acad. Sci. USA 98,9237-9242[Abstract/Free Full Text]
  80. 41
  81. Du, X., Poltorak, A., Wei, Y., Beutler, B. (2000) Three novel mammalian Toll-like receptors: gene structure, expression, and evolution Eur. Cytokine Netw. 11,362-371[Medline]
  82. 42
  83. Chuang, T. H., Ulevitch, R. J. (2000) Cloning and characterization of a sub-family of human Toll-like receptors: hTLR7, hTLR8 and hTLR9 Eur. Cytokine Netw. 11,372-378[Medline]
  84. 43
  85. Latz, E., Schoenemeyer, A., Visintin, A., Fitzgerald, K. A., Monks, B. G., Knetter, C. F., Lien, E., Nilsen, N. J., Espevik, T., Golenbock, D. T. (2004) TLR9 signals after translocating from the ER to CpG DNA in the lysosome Nat. Immunol. 5,190-198[CrossRef][Medline]
  86. 44
  87. Leifer, C. A., Kennedy, M. N., Mazzoni, A., Lee, C., Kruhlak, M. J., Segal, D. M. (2004) TLR9 is localized in the endoplasmic reticulum prior to stimulation J. Immunol. 173,1179-1183[Abstract/Free Full Text]
  88. 45
  89. Krug, A., Rothenfusser, S., Hornung, V., Jahrsdorfer, B., Blackwell, S., Ballas, Z. K., Endres, S., Krieg, A. M., Hartmann, G. (2001) Identification of CpG oligonucleotide sequences with high induction of IFN-{alpha}/β in plasmacytoid dendritic cells Eur. J. Immunol. 31,2154-2163[CrossRef][Medline]
  90. 46
  91. Schattenberg, D., Schott, M., Reindl, G., Krueger, T., Tschoepe, D., Feldkamp, J., Scherbaum, W. A., Sessler, J. (2000) Response of human monocyte-derived dendritic cells to immunostimulatory DNA Eur. J. Immunol. 30,2824-2831[CrossRef][Medline]
  92. 47
  93. Hartmann, G., Krieg, A. M. (2000) Mechanism and function of a newly identified CpG DNA motif in human primary B cells J. Immunol. 164,944-953[Abstract/Free Full Text]
  94. 48
  95. Lohoff, M., Mak, T. W. (2005) Roles of interferon-regulatory factors in T-helper-cell differentiation Nat. Rev. Immunol. 5,125-135[CrossRef][Medline]
  96. 49
  97. Haeryfar, S. M. (2005) The importance of being a pDC in antiviral immunity: the IFN mission versus Ag presentation? Trends Immunol. 26,311-317[CrossRef][Medline]
  98. 50
  99. Colonna, M., Trinchieri, G., Liu, Y. J. (2004) Plasmacytoid dendritic cells in immunity Nat. Immunol. 5,1219-1226[CrossRef][Medline]
  100. 51
  101. Brassard, D. L., Grace, M. J., Bordens, R. W. (2002) Interferon-{alpha} as an immunotherapeutic protein J. Leukoc. Biol. 71,565-581[Abstract/Free Full Text]
  102. 52
  103. Berger, T. G., Haendle, I., Schrama, D., Luftl, M., Bauer, N., Pedersen, L. O., Schuler-Thurner, B., Hohenberger, W., Straten, P. P., Schuler, G., Becker, J. C. (2004) Circulation and homing of melanoma-reactive T cells to both cutaneous and visceral metastases after vaccination with monocyte-derived dendritic cells Int. J. Cancer 111,229-237[CrossRef][Medline]
  104. 53
  105. Napolitani, G., Rinaldi, A., Bertoni, F., Sallusto, F., Lanzavecchia, A. (2005) Selected Toll-like receptor agonist combinations synergistically trigger a T helper type 1-polarizing program in dendritic cells Nat. Immunol. 6,769-776[CrossRef][Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
Q. Zhu, C. Egelston, A. Vivekanandhan, S. Uematsu, S. Akira, D. M. Klinman, I. M. Belyakov, and J. A. Berzofsky
Toll-like receptor ligands synergize through distinct dendritic cell pathways to induce T cell responses: Implications for vaccines
PNAS, October 21, 2008; 105(42): 16260 - 16265.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Nierkens, M. H. den Brok, R. P.M. Sutmuller, O. M. Grauer, E. Bennink, M. E. Morgan, C. G. Figdor, T. J.M. Ruers, and G. J. Adema
In vivo Colocalization of Antigen and CpG within Dendritic Cells Is Associated with the Efficacy of Cancer Immunotherapy
Cancer Res., July 1, 2008; 68(13): 5390 - 5396.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Wang, G. Roderiquez, T. Jones, P. McPhie, and M. A. Norcross
Control of In Vitro Immune Responses by Regulatory Oligodeoxynucleotides through Inhibition of pIII Promoter Directed Expression of MHC Class II Transactivator in Human Primary Monocytes
J. Immunol., July 1, 2007; 179(1): 45 - 52.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0106011v1
80/6/1328    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hoene, V.
Right arrow Articles by Wanner, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hoene, V.
Right arrow Articles by Wanner, R.