PeproTech Inc.
Originally published online as doi:10.1189/jlb.1105638 on August 2, 2006

Published online before print August 2, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.1105638v1
80/4/953    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gekonge, B. N.
Right arrow Articles by Henderson, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gekonge, B. N.
Right arrow Articles by Henderson, A. J.
(Journal of Leukocyte Biology. 2006;80:953-960.)
© 2006 by Society for Leukocyte Biology

Signal transduction induced by apoptotic cells inhibits HIV transcription in monocytes/macrophages

Bethsebah N. Gekonge*, Gillian Schiralli{dagger},{ddagger}, Robert A. Schlegel*,{dagger} and Andrew J. Henderson{dagger},{ddagger},1

* Department of Biochemistry and Molecular Biology,
{dagger} Integrative Biosciences Graduate Program, and
{ddagger} Department of Veterinary and Biomedical Sciences, Center of Molecular Immunology and Infectious Diseases, Pennsylvania State University, University Park, Pennsylvania

1 Correspondence: Department of Veterinary and Biomedical Science, 115 Henning Building, Penn State University, University Park, PA 16802. E-mail: ajh6{at}psu.edu


arrow
ABSTRACT
 
The primary targets of HIV are CD4+ T cells and macrophages. HIV infection is associated with an increase in apoptosis of infected and uninfected CD4+ T cells, and these infected cells undergo apoptosis and produce HIV virions with phosphatidylserine (PS) on their surface. During phagocytosis of apoptotic cells, macrophages, using an array of receptors, are able to perceive various surface changes on apoptotic cells. The engagement of phagocytic receptors by ligands on the apoptotic cell surface results in the activation of signaling cascades, which facilitate engulfment. In this study, we examined how PS associated with virions and apoptotic cells influences HIV replication. We demonstrate that virus-associated PS is required for HIV infection of macrophages at a step prior to integration but following strong-stop, indicating that PS-initiated signals alter the establishment of HIV provirus. Conversely, apoptotic cells inhibited HIV transcription in infected macrophages, although this ability to suppress transcription was independent of PS. Furthermore, we show that ELMO, a key signaling molecule that participates in the phagocytosis of apoptotic cells, inhibited HIV transcription; however, knocking down endogenous ELMO expression in infected U937 cells rescued HIV transcription when these cells were coincubated with apoptotic targets. Taken together, these data show that apoptotic cells and the signals, which they initiate upon recognition by macrophages, influence the successful establishment of HIV infection and provirus transcription.

Key Words: apoptosis • human immunodeficiency virus


arrow
INTRODUCTION
 
Macrophages are professional phagocytes, which are able to identify and engulf apoptotic cells using specific receptors that recognize modifications on the apoptotic cell surface. The appearance of the aminophospholipid phosphatidylserine (PS) in the external leaflet of the plasma membrane is one of the earliest features used to distinguish apoptotic cells [1 , 2 ]. The plasma membrane of viable, healthy cells is characterized by an unequal distribution of phospholipids across the bilayer, and PS is restricted to the inner leaflet of the plasma membrane [3 ]. The expression of PS in the outer leaflet of apoptotic cells serves as a signal for triggering their recognition and subsequent engulfment by macrophages and other phagocytes [4 , 5 ]. Evidence that PS is a key player in the recognition of apoptotic cells by macrophages has been demonstrated by pretreating apoptotic cells with annexin V, a Ca2+-dependent, PS-binding protein, which blocks the uptake of apoptotic cells [6 ]. Pretreating macrophages, which constitutively express low levels of surface PS, with annexin V, also blocks engulfment, indicating that macrophage PS is required for engulfment [7 ].

Numerous macrophage receptors are known to interact with ligands on the apoptotic cell surface, resulting in the tethering of apoptotic cells to the macrophage, which constitutes the initial stage of phagocytosis [8 , 9 ]. The engagement of phagocytic receptors also triggers essential signaling pathways, which induce cytoskeletal changes in the macrophage, required for the engulfment of apoptotic cells. Studies in the nematode, Caenorhabditis elegans, identified genes in two redundant pathways, which are involved in the recognition and engulfment of cell corpses. In the first pathway, two membrane proteins, ced-1 and ced-7 [mammalian homologs, low-density lipoprotein receptor-related protein, and ABC transporter ABCA1], have been shown to function upstream of intracellular adaptor protein ced-6 (GULP) [10 , 11 ]. In the second pathway, ced-2, -5, and -12 (CrkII, Dock180, and ELMO) function to activate ced-10 (Rac1), thereby regulating the actin cytoskeleton and controlling cell shape changes required for processes such as phagocytosis of apoptotic cells, cell migration, and axon outgrowth [12 13 14 ].

HIV, the etiological agent of AIDS, has the capability of selectively infecting and ultimately incapacitating the immune system. The progressive depletion of CD4+ and CD8+ T cells, one of the hallmarks of HIV infection, is caused in part by a general increase in apoptosis of infected and uninfected T cells [15 ]. HIV also targets macrophages and alters their production of inflammatory cytokines [16 , 17 ], expression of surface receptors [18 ], and phagocytic function [19 20 21 ], thus crippling key innate immune functions. Given the documented increase in the incidence of apoptosis during HIV infection, it is probable that these dying cells and features associated with apoptosis might create a microenvironment that influences HIV infection and replication [22 ]. Consistent with this hypothesis, it has been demonstrated that HIV-infected cells, as well as the HIV virions, have PS exposed on their surface and that PS is a cofactor for establishing HIV infection in monocytic cells [23 , 24 ].

The PS expressed on HIV virions and/or the PS expressed on monocytes/macrophages are functional, as PS inhibitors are able to reduce HIV infection of U937 monocytic cells and monocyte-derived macrophages (MDM) [23 ]. Although PS might influence the early stages in the interaction between viral and target cell membrane, virus binding/attachment is not impaired in the presence of PS inhibitors [23 ]. Therefore, it remains unclear precisely how this membrane phospholipid impacts the establishment of HIV infection. In this report, we explore the role of PS during various stages of HIV-1 infection of monocytic cells, which occur downstream of virus binding. In addition, we address how the signaling events initiated by apoptotic cells influence HIV transcription in macrophages.


arrow
MATERIALS AND METHODS
 
Cells
U937 human monocytic cells and Jurkat human T lymphocytes were cultured in complete RPMI-1640 medium supplemented with 10% FBS, 100 U penicillin/ml, 100 µg streptomycin/ml, and 2 mM glutamine at 37°C in 5% CO2. 293T human embryonic kidney cells were cultured in complete DMEM medium, supplemented with 10% FBS, and incubated at 37°C in 5% CO2. PBMC were isolated from whole blood obtained from healthy donors according to institutional guidelines. Mononuclear cells were obtained by differential centrifugation using a Ficoll/Hypaque gradient (Sigma Chemical Co., St. Louis, MO) as described previously [25 ]. The cells were cultured in complete RPMI-1640 medium, supplemented with 10% FBS, 100 U penicillin/ml, 100 µg streptomycin/ml, and 2 mM glutamine at 37°C in 5% CO2; macrophages were separated from lymphocytes by adherence to plastic flasks overnight. After removal of the nonadherent cells, monocytes were differentiated by culturing in plastic tissue-culture plates for 5–7 days prior to infection.

Preparation of HIV and infections
Virus was generated by transfecting 293T cells with 15 µg pHXBnPLAP Nef+ DNA [26 ] and 3 µg Rev in a Rous sarcoma virus expression construct by CaPO4 transfection [27 ]. Replication-incompetent virus was similarly generated, except 15 µg pNL43-Luc(+)Env(–) [HIV-luciferase (HIV-luc)] DNA [28 ] and 3 µg HXB2 or JRFL envelope DNA were used with 3 µg Rev DNA. 293T transfection efficiency was monitored by luciferase activity. For infections, 1.0 ml undiluted viral stocks were added to 3.0 x 105 U937 cells or primary macrophages in the absence or presence of 0.01 µM recombinant annexin V protein [23 ], 15 nM phosphatidylcholine (PC) vesicles, or PS vesicles prepared from egg PC or brain PS, respectively [29 ], purchased from Avanti Polar Lipids (Alabaster, AL). Cells were harvested 24 h postinfection and used in the indicated assays. Expression of HIV-luc was measured using the Promega (Madison, WI) luciferase assay system kit, whereas HIV release was monitored by p24 ELISA (Perkin Elmer, Wellesley, MA).

Expression plasmids and transfections
Plasmids expressing GFP-tagged ELMO1 were a gift from Dr. Kodi Ravichandran (University of Virginia, Charlottesville). The short interfering RNA (siRNA) for ELMO, designed to target 19 nucleotides in human ELMO2, was a gift from Dr. Hironori Katoh (Kyoto University, Japan). 293T cells were transiently transfected with no DNA, 3 µg HIV-luc DNA, or 3 µg pSV2-luc DNA serving as a control and 3 µg ELMO DNA. Cells were lysed 24 h post-transfection and assayed for luciferase activity. A murine stem cell virus (MSCV)-ELMO1GFP construct was generated by subcloning ELMO1 GFP from the pEBB expression vector Vra ELMO1GFP via blunt-end ligation into the Hpa1 site of the MSCV2.1 vector (MSCV2.1 vector was a gift from Dr. Garry Nolan, Stanford University, CA). Virus for transduction was generated by transfecting 293T cells with 10 µg MSCV-ELMO1GFP, 2 µg Tat DNA, 2 µg pECO, which encodes for ecotropic envelope and 2 µg glycoprotein G from vesicular stomatitis virus, by CaPO4 method. The supernatant collected from these cells 48 h post-transfection was used to transduce 3.0 x 105 U937 monocytic cells or 106 MDM for 4 days. Transduction efficiency was monitored by FACS analysis for GFP-positive cells. For nucleofection, 106 U937 cells were resuspended in 100 µl Nucleofector solution (Amaxa Biosystems, Cologne, Germany) along with 7 µg ELMO-specific or control RNA interference plasmid and transfected using the Nucleofector system (Amaxa Biosystems).

Depletion of ELMO1 and ELMO2 was confirmed by immunoblotting. Whole cell extracts were prepared by suspending cells in lysis buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1.0 mM EDTA, pH 8.0, 2.0 mM sodium vanadate, 10 mM sodium fluoride, 10 mM sodium pyrophosphate, 1% Nonidet P-40, 1.0 mM PMSF, 1.0 mM pepstatin) at 4°C for 30 min. Samples were mixed with 2x SDS loading buffer containing DTT and heated at 100°C for 3 min before resolving by SDS-PAGE with 10% polyacrylamide, unless specified otherwise. Proteins were transferred to polyvinylidene difluoride membrane (Millipore, Billerica, MA), blocked with 5% nonfat dry milk in PBS with 0.02% v/v Tween-20, and detected with primary polyclonal antibodies goat anti-ELMO1 (Abcam, Cambridge, MA), goat anti-ELMO2 (Abcam), mouse ß-actin (Clone AC-15, Sigma-Aldrich), and rabbit anti-p85 subunit of PI3K (Upstate, Charlottesville, VA). Secondary antibodies used were anti-goat-HRP (Sigma Chemical Co.) and anti-rabbit-HRP (Sigma Chemical Co.). Blots were developed using an ECL-plus kit (Amersham Biosciences, Piscataway, NJ). For reprobing, blots were stripped with 100 mM 2-ME, 62.5 mM Tris-HCl (pH 6.7), 2% w/v SDS for 45 min at 65°C with intermittent shaking, and reblocked for 1 h prior to reprobing.

PCR detection of RT intermediates and integrated provirus
For the detection of RT products, extrachromosomal DNA was isolated from Hirt supernatant extractions as described originally [30 ]. The primer sets for newly synthesized strong-stop DNA were (5'GGCTAACTAGGGAACCCACTG3') and (5'CTGCTAGAGATTTTCCACACTGAC3') [31 ]. PCR was performed in a 50-µl reaction mixture and cycled as follows: denaturation step at 94°C for 3 min, followed by 29 cycles of 94°C for 1 min, 46.8°C for 2 min, 72°C for 3 min, and a final extension of 72°C for 10 min. Integrated viral DNA was detected by nested Alu-PCR amplification [32 ]. Briefly, a 22-cycle first-round used primers corresponding to a consensus sequence found in the Alu repetitive elements (5'TCCCAGCTACTCGGGAGGCTGAGG3') and the U3 region of the 3' long terminal repeat (LTR; 5'AGGCAAGCTTTATTGAGGCTTAAGC3'). PCR products from the first amplification were then subjected to a 29-cycle second-round using primer sets (5'CACACACAAGGCTACTTCCCT3' and (5'GCCACTCCCCIGTCCCGCCC3') located within the Nef gene. For normalization, ß-actin primer sets (5'CCTAAGGCCAACCGTGAAAAG3' and 5'TCTTCATGGTGCTAGGAGCCA3') were used. PCR was performed in a 50-µl reaction mixture and cycled following standard PCR conditions. Products were resolved on a 1% agarose ethidium bromide gel. The identity of the PCR products was confirmed by Southern blot using an internal probe (data not shown).

Cell death induction and analysis
Apoptosis was induced by treatment of 5 x 105 target cells/ml with 4 µg/ml of the topoisomerase inhibitor camptothecin for 15 h at 37°C [33 ]. Apoptotic cells were determined by preincubating 106 cells in 2 µg/ml annexin V-FITC in 100 µl staining buffer (10 mM HEPES, pH 7.4, 140 mM NaCl, 2 mM CaCl2) containing 1% FBS (+FBS) for 15 min on ice. Cells were resuspended to 500 µl in binding buffer and analyzed immediately by flow cytometry. This treatment produced apoptosis in 60% of the cells. Apoptotic cells were washed three times with PBS before being added to U937 cells at the indicated cell concentrations. In some experiments, apoptotic cells were cocultured in transwell chambers (Costar, Corning, NY). Upon coculturing, there was no evidence of cell death in the U937 cells as determined by trypan blue staining (data not shown).


arrow
RESULTS
 
HIV proviral integration in macrophages requires PS
As reported, PS is a cofactor for HIV infection of monocytic cells, although binding or attachment is unaffected by PS inhibitors [23 ]. We were interested in determining where PS acts in the retroviral lifecycle. As PS mediates homotypic recognition between muscle cells in the process of myotube formation through fusion [34 ], PS could enhance fusion between viral envelope and the target cell membrane. Using a virus-free fusion assay to test this possibility, fusion was found to be virtually unaffected by blocking surface PS using the PS-binding protein annexin V (data not shown), consistent with the observations of Ma and colleagues [24 ]. This observation implies that PS effects are exerted at stages of the viral lifecycle beyond binding and fusion.

PS interacts with specific receptors on the phagocytic cell surface, and downstream signals initiated by these interactions could affect the establishment of HIV infection. Therefore, the ability of PS to influence the generation of early RT products, specifically strong-stop DNA, which occurs after viral entry and uncoating of the RNA in the cytoplasm, was tested. U937 monocytes were infected with HIV in the absence or presence of annexin V protein, which has been shown to inhibit infection [23 ], and RT products were monitored using PCR. In the presence of annexin V, the production of strong-stop DNA remained unaffected (Fig. 1A ). A nested PCR assay, which used primers to genomic Alu sequences and HIV LTR sequences [32 ], was used to amplify integrated HIV provirus sequences from genomic DNA. As shown in Figure 1A , there was less HIV provirus in monocytic cells infected with HIV in the presence of annexin V compared with controls infected in the absence of annexin V, indicating that PS influences provirus integration in these cells.


Figure 1
View larger version (43K):
[in this window]
[in a new window]
  		Figure 1. PS is required for the establishment of HIV provirus in monocytic cells. (A) U937 cells (1x106) or (B) MDM cells (1x105) were infected with HXB.2 and HIVBal, respectively, at a multiplicity of infection of 0.5–1.0 in the presence or absence of 0.1 µM annexin V (AV). After 24 h, Hirt DNA and genomic DNA were harvested, and the generation of strong-stop DNA and integrated provirus was determined by PCR. ß-Actin was used as a DNA-loading control. These data are representative of three independent experiments.

To validate that PS had similar effects on the ability of HIV-1 to establish infection in primary cells, MDM were infected with HIV-BaL in the absence or presence of annexin V. Similar to what was observed with U937 cells, annexin V had no effect on the generation of strong-stop DNA but did block HIV-1 provirus integration (Fig. 1B) . Furthermore, infecting monocytic cells in the presence of PS vesicles, which also inhibit infection, diminished HIV-1 provirus (data not shown). Taken together, these data indicate that PS or signaling pathways initiated by PS do not alter early stages of HIV binding, entry, and RT but are required for establishing HIV provirus integration.

Apoptotic cells inhibit HIV transcription
As HIV infection of lymphocytes has been associated with an increase in apoptosis and as apoptotic cells engage a variety of receptors on macrophages, apoptotic cells might regulate HIV replication in infected monocytic cells [22 ]. Furthermore, the observation that PS-induced signals influence the establishment of HIV provirus led us to consider whether apoptotic cells and their associated PS influenced other steps of HIV replication, in particular, transcription. To test this possibility, U937 cells were infected with the replication-defective HIV-1 NL4-3.Luc clone, and after 24 h, infected cells were cocultured with viable Jurkat cells or Jurkat cells induced to undergo apoptosis by treating with camptothecin, where treatment of Jurkat cells resulted in a population of cells that was over 60% apoptotic, using FITC-labeled annexin V to detect surface PS (Fig. 2A ). HIV transcription, as measured by luciferase activity in U937 cells, was decreased by 70% in the presence of apoptotic cells as compared with viable cells (Fig. 2B and 2C) . Similar results were observed when apoptotic Jurkat cells were generated by treating cells with dexamethasone (data not shown).


Figure 2
View larger version (17K):
[in this window]
[in a new window]
  		Figure 2. Inhibition of HIV-1 transcription in macrophages by apoptotic cells. (A) Apoptosis was induced in Jurkat cells by treating cells with camptothecin for 15 h at 37°C. This treatment consistently yielded ~60% apoptotic cells, as determined by labeling with annexin V-FITC. (B) MDM (3x105) infected with a HIV-luc virus were cocultured with viable or apoptotic Jurkat cells at a ratio of 20 apoptotic cells:1 MDM. Cells were lysed after 24 h, and luciferase activity was analyzed. Similar results were seen in U937 cells (data not shown). (C) U937 cells (3x105) infected with a HIV-luc virus, were cocultured with different ratios of viable or apoptotic Jurkats cells, which were lysed after 24 h, and luciferase activity was analyzed. Each data point represents three independent infections, and error bars show the standard deviation. *, P < 0.05 (t-test). These data are from a single experiment, which was repeated three times. M{phi}, Macrophage.

To determine whether signals delivered by apoptotic cells regulate the induction of latent, proviral HIV, U1 cells, a promonocytic cell line derived from U937 cells, which harbor latent HIV provirus, activated by various chemical stimuli or cytokines [35 ], was used. Cells were stimulated with PMA or TNF-{alpha} and cocultured in the absence or presence of viable or apoptotic cells for 24 h. In the presence of apoptotic cells, U1 cells activated by PMA produced 80% less HIV compared with U1 cells cocultured in the presence of viable cells, as measured by p24 ELISA (Fig. 3 ). TNF-{alpha}-induced HIV expression in U1 cells was similarly inhibited in the presence of apoptotic Jurkat cells (data not shown).


Figure 3
View larger version (9K):
[in this window]
[in a new window]
  		Figure 3. Apoptotic cells inhibit induction of latent HIV. U1 cells (3x105) activated using 10 ng/ml PMA, were cocultured with viable or apoptotic Jurkat cells at a ratio of 20 apoptotic cells:1 U1 cell. Culture supernatants were collected after 24 h and analyzed by HIV-1 p24 ELISA. Results expressed as mean ± SD of three replicate samples. This experiment was repeated three times. *, P < 0.05.

To determine whether PS was sufficient for the inhibitory effect seen, infected cells were coincubated with PS vesicles (Fig. 4A ); however, this treatment did not reproduce the observations made with apoptotic cells. Furthermore, when the PS displayed on the apoptotic cell surface was blocked with annexin V, there was no effect on HIV transcription (Fig. 4B) , suggesting that apoptotic cells are inhibiting HIV transcription through a mechanism, which is not solely dependent on PS. These effects were reproducible in U1 cells, which were similarly insensitive to the addition of PS vesicles after the stimulation of cells with PMA and the blocking of PS on the apoptotic cell surfaces with annexin V (data not shown). Taken together, these data indicate that the signaling events initiated by apoptotic cells to inhibit HIV transcription are distinct from the PS-dependent signals that influence the establishment of HIV infection.


Figure 4
View larger version (8K):
[in this window]
[in a new window]
  		Figure 4. PS is not required for inhibition of HIV transcription. (A) U1 cells (3x105), activated using PMA, were cocultured with 15 nM PC vesicles (P=0.4) or PS vesicles (P=0.1). After 24 h, culture supernatants were analyzed for HIV-1 p24. (B) Infected U937 cells (3x105) were coincubated with viable Jurkat cells or apoptotic Jurkat cells in the absence or presence of 0.1 µM annexin V. (C) Infected U937 cells (3x105) were cocultured with viable or apoptotic Jurkats cells in a 20:1 ratio of apoptotic cells verses U937 cells in direct contact or transwell inserts. After 24 h, cells were lysed and analyzed for luciferase activity, which when observed for the cultures that included viable cells, was set at 100%. Results represent three separate experiments. *, P < 0.05.

These results suggest that apoptotic cells, through direct cell-cell contact or via a secreted factor, initiate signals in monocytic cells and MDM, which directly influence HIV transcription and subsequent replication. As apoptotic cells have been demonstrated to produce soluble mediators, which influence macrophage function [36 ], transwell chambers of 0.4 µm pore size were used to determine whether apoptotic cells required contact with infected cells to inhibit HIV transcription. As shown in Figure 4C , when apoptotic and infected cells were separated in a transwell, HIV transcription was reduced significantly, suggesting that direct cell contact was not required for inhibiting HIV transcription.

ELMO inhibits HIV transcription
The recognition of apoptotic cells by macrophages triggers signaling cascades, which are necessary for engulfment of apoptotic targets. For example, overexpression of ELMO, a key player in the CrkII/Dock180 pathway, is sufficient to induce actin cytoskeleton reorganization associated with phagocytosis of latex beads [37 ]. In addition, phagocytosis of apoptotic cells is regulated by the RhoG signaling pathway, mediated through ELMO [12 ]. To determine whether signals associated with recognition and clearance of apoptotic cells could inhibit HIV transcription, 293T cells were transiently transfected with a HIV-luc cDNA construct in the absence or presence of ELMO. As shown in Figure 5A , overexpression of ELMO specifically inhibited HIV transcription by fivefold, as compared with cells transfected with HIV-luc in the absence of ELMO. This response is specific to HIV, since the SV2 promoter (pSV2-luc) activity was not altered by ELMO (Fig. 5B) . To determine whether ELMO influenced HIV transcription in a physiologically relevant context, HIV-luc-infected U937 cells were transduced with MSCV-ELMO1GFP or MSCV empty vector, harvested 5 days postinfection, and luciferase activity measured to monitor provirus transcription. The expression of ELMO was confirmed in these cells by flow cytometry (Fig. 6A ). Overexpression of ELMO1 reduced HIV transcription in U937 cells by ~50% compared with controls (Fig. 6B) . It is important that these observations were reproduced in primary MDM transduced with MSCV-ELMO1 (Fig. 6C) .


Figure 5
View larger version (10K):
[in this window]
[in a new window]
  		Figure 5. ELMO inhibits HIV transcription. (A) 293T cells were transiently transfected with HIV-luc and ELMO or (B) with SV2-luc and ELMO. Cells were lysed 24 h post-transfection and assayed for luciferase activity. Each data point represents three independent transfections. These data are from a single experiment and are representative of three experiments.


Figure 6
View larger version (11K):
[in this window]
[in a new window]
  		Figure 6. ELMO inhibits HIV transcription in monocytes. (A) U937 cells (3x105) transduced with MSCV or MSCV-ELMO-GFP and analyzed via flow cytometry. (B) U937 cells (3x105) and (C) 1 x 106 MDM were infected with HIV-luc virus. Twenty-four hours postinfection, cells were transduced with MSCV alone or with MSCV-ELMO-GFP. Cells were harvested 4 days post-transduction, and luciferase activity was measured. Each data point represents three independent infections. These data are from a single experiment, which is representative of three independent experiments.

The role of ELMO was substantiated further in experiments in which ELMO-specific siRNA was used to reduce endogenous ELMO expression. ELMO siRNA reduced ELMO1 and ELMO2 in U937 cells, as detected by immunoblots but had no affect on the p85 adaptor subunit of PI3K, indicating that the siRNA was specifically targeting ELMO signaling and not globally influencing the expression of signaling molecules (Fig. 7A ). When ELMO-1 and ELMO-2 were knocked down in infected U937 cells, which were subsequently coincubated with apoptotic cells, there was a threefold increase in HIV transcriptional activity (Fig. 7B) compared with cells treated with siRNA control, indicating that the ability of apoptotic cells to inhibit HIV transcription requires ELMO-1, ELMO-2, or both.


Figure 7
View larger version (30K):
[in this window]
[in a new window]
  		Figure 7. Rescue of HIV transcription upon diminishing ELMO expression. (A) Immunoblots of U937 cells for ELMO1, ELMO2, and the p85 subunit of PI3K following nucleofection with ELMO siRNA as described in Materials and Methods. (B) U937 cells (3x105) were infected with HIV-luc prior to nucleofecting with nonspecific siRNA or ELMO-specific siRNA and coincubated with apoptotic Jurkat cells. After 48 h, cells were lysed, and luciferase activity was measured. Each data point represents three independent infections and nucleofections.


arrow
DISCUSSION
 
In this study, we demonstrate that signals induced by PS are required for infection of monocytic cells early in the virus life cycle. On the contrary, in HIV-infected cells, apoptotic cells inhibit HIV transcription and replication through a PS-independent mechanism. Furthermore, we show that ELMO signaling, which regulates the Rac signaling pathway during engulfment of apoptotic cells, suppresses viral transcription.

Apoptosis is an important and natural process, which animal cells use to shape organs and tissues during development and to maintain tissue homeostasis throughout life; however, apoptosis is also associated with disease. Apoptotic cells are physically characterized by a fragmented nucleus, condensed chromatin, and by the exposure of the aminophospholipid PS in the outer leaflet of their plasma membrane, a general feature used to distinguish healthy cells from their apoptotic counterparts. We have described the role of PS during the early stages of HIV infectivity, where this aminophospholipid affects events after binding and fusion but prior to integration. Our observations are consistent with those reported by Ma et al. [24 ], who describe a role for annexin II during HIV infection of macrophages. Annexin II, like annexin V, is a member of the annexin family of Ca2+-dependent, phospholipid-binding proteins, which are present on the surface of viable macrophages and function during phagocytosis [33 ]. As annexin II is not bound to PS on the macrophage surface, its PS binding site is available to bind PS on the virion. Indeed, blocking annexin II on the macrophage surface using antibodies inhibits infection by principally influencing a step prior to proviral integration [24 ].

Our data indicate that recognition of apoptotic cells by infected macrophages suppresses HIV provirus transcription and that soluble factors produced by apoptotic cells contribute to this activity. A soluble lipid factor, lysophosphatidylcholine (LPC), produced by apoptotic cells, has been shown to attract monocytes and macrophages [36 ], although preliminary data from our laboratories indicate that LPC is not sufficient to inhibit HIV transcription (data not shown). Furthermore, we have not ruled out that small vesicles or membrane fragments produced by the apoptotic cells may be mediating this repression of HIV transcription. Other studies have shown that ingestion of apoptotic cells actively suppresses immune and inflammatory responses (reviewed in ref. [38 ]), in part as a result of the secretion of anti-inflammatory mediators such as TGF-ß [39 ], although in our system, TGF-ß alone is not sufficient for inhibiting HIV transcription (data not shown). On the contrary, HIV infection has been associated with macrophage activation and an increase in the levels of TNF-{alpha} and IL-6 [16 , 17 ]. We hypothesize that the anti-inflammatory signals delivered by apoptotic cells through multiple and redundant effectors mediate the suppression of HIV transcription.

The engulfment of apoptotic cells is characterized by cytoskeletal changes in the phagocyte, which are mediated through a conserved signaling pathway involving Rho-guanosinetriphosphatase (GTPase) activation. ELMO functions with CrkII and Dock180 upstream of Rac1 during engulfment, and overexpression of ELMO alone significantly inhibited HIV transcription in U937 cells and MDM. Although it is unclear what signal transduction pathways and transcription factors downstream of activated Rac1 may be targeted during engulfment, the ELMO-induced suppression of HIV transcription does not seem to be influencing NF-{kappa}B or C/EBPß activity (data not shown).

Our data suggest that apoptotic cells are part of a suppressive microenvironment, which may help to establish reservoirs of latent macrophage populations; however, macrophages remain an important source of infectious virus in tissues such as the CNS. This indicates that HIV has mechanisms to overcome the anti-inflammatory signals associated with recognition of apoptotic cells. Furthermore, macrophages from HIV-infected patients have impaired phagocytic function [40 ], indicating that HIV is able to alter the immunological function of macrophages to improve its pathogenesis. HIV accessory proteins including Nef and Tat have been demonstrated to have multiple functions, including those associated with disrupting cellular signaling pathways [41 42 43 ]. Indeed, Nef has been shown to associate with signaling pathways involving small GTPases [44 ], and it was reported recently that Nef binds the Dock2-ELMO-Rac complex downstream of the TCR, consequently disrupting chemotactic responses of T cells [45 ]. Identifying which HIV proteins might be responsible for regulating macrophage functions, such as phagocytosis of apoptotic cells, to favor HIV pathogenesis, is currently in progress.


arrow
ACKNOWLEDGEMENTS
 
This project is supported by Penn State Tobacco Formula Funds and National Institutes of Health Grants AI46261 and AI62467 to A. J. H. We are grateful to Elaine Kunze and Susan Margagee, the technicians in the Center for Quantitative Cell Analysis at the Pennsylvania State University, for their technical assistance. In addition, Dr. Avery August provided critical scientific discussions and insights.

Received November 7, 2005; revised May 30, 2006; accepted May 31, 2006.


arrow
REFERENCES
 
    1
  1. Martin, D. W., Jesty, J. (1995) Calcium stimulation of procoagulant activity in human erythrocytes—ATP dependence and the effects of modifiers of stimulation and recovery J. Biol. Chem. 270,10468-10474[Abstract/Free Full Text]
    2. 2
  2. Verhoven, B., Schlegel, R., Williamson, P. (1995) Mechanism of phosphatidylserine exposure, a phagocyte recognition signal, on apoptotic lymphocytes J. Exp. Med. 182,1597-1601[Abstract/Free Full Text]
    3. 3
  3. Williamson, P., Schlegel, R. (1994) Back and forth: the regulation and function of transbilayer phospholipid movement in eukaryotic cells Mol. Membr. Biol. 11,199-216[Medline]
    4. 4
  4. Fadok, V. A., Voelker, E., Campbell, P., Cohen, J., Bratton, D., Henson, P. (1992) Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers specific recognition and removal by macrophages J. Immunol. 148,2207-2216[Abstract]
    5. 5
  5. Schlegel, R. A., Williamson, P. (2001) Phosphatidylserine, a death knell Cell Death Differ 8,551-563[CrossRef][Medline]
    6. 6
  6. Krahling, S., Callahan, M., Williamson, P., Schlegel, R. (1999) Exposure of phosphatidylserine is a general feature in the phagocytosis of apoptotic lymphocytes by macrophages Cell Death Differ 6,183-189[CrossRef][Medline]
    7. 7
  7. Callahan, M. K., Williamson, P., Schlegel, R. (2000) Surface expression of phosphatidylserine on macrophages is required for phagocytosis of apoptotic thymocytes Cell Death Differ 7,645-653[CrossRef][Medline]
    8. 8
  8. Hoffmann, P. R., deCathelineau, A., Ogden, C., Leverrier, Y., Bratton, D., Daleke, D., Ridley, A., Fadok, V., Henson, P. (2001) Phosphatidylserine (PS) induces PS receptor-mediated macropinocytosis and promotes clearance of apoptotic cells J. Cell Biol. 155,649-660[Abstract/Free Full Text]
    9. 9
  9. Lauber, K., Blumenthal, S., Waibel, M., Wesselborg, S. (2004) Clearance of apoptotic cells: getting rid of the corpses Mol. Cell 14,277-287[CrossRef][Medline]
    10. 10
  10. Liu, Q. A., Hengartner, M. (1998) Candidate adaptor protein CED-6 promotes the engulfment of apoptotic cells in C. elegans Cell 93,961-972[CrossRef][Medline]
    11. 11
  11. Zhou, Z., Hartwieg, E., Horvitz, H. (2001) CED-1 is a transmembrane receptor that mediates cell corpse engulfment in C. elegans Cell 104,43-56[CrossRef][Medline]
    12. 12
  12. deBakker, C. D., Haney, L., Kinchen, J., Grimsley, C., Lu, M., Klingele, D., Hsu, P., Chou, B., Cheng, L., Blangy, A., Sondek, J., Hengartner, M., Wu, Y., Ravichandran, K. (2004) Phagocytosis of apoptotic cells is regulated by a UNC-73/TRIO-MIG-2/RhoG signaling module and armadillo repeats of CED-12/ELMO Curr. Biol. 14,2208-2216[CrossRef][Medline]
    13. 13
  13. Lundquist, E. A., Reddien, P., Hartwieg, E., Horvitz, H., Bargmann, C. (2001) Three C. elegans Rac proteins and several alternative Rac regulators control axon guidance, cell migration and apoptotic cell phagocytosis Development 128,4475-4488
    14. 14
  14. Wu, Y. C., Cheng, T., Lee, M., Weng, N. (2002) Distinct Rac activation pathways control Caenorhabditis elegans cell migration and axon outgrowth Dev. Biol. 250,145-155[CrossRef][Medline]
    15. 15
  15. Fauci, A. S. (1993) Multifactorial nature of human immunodeficiency virus disease: implications for therapy Science 262,1011-1018[Abstract/Free Full Text]
    16. 16
  16. Breen, E. C., Rezai, A. R., Nakajima, K., Beall, G. N., Mitsuyasu, R. T., Hirano, T., Kishimoto, T., Martinez-Maza, O. (1990) Infection with HIV is associated with elevated IL-6 levels and production J. Immunol. 144,480-484[Abstract]
    17. 17
  17. Merrill, J. E., Koyanagi, Y., Chen, I. (1989) Interleukin-1 and tumor necrosis factor {alpha} can be induced from mononuclear phagocytes by human immunodeficiency virus type 1 binding to the CD4 receptor J. Virol. 63,4404-4408[Abstract/Free Full Text]
    18. 18
  18. Kedzierska, K., Ellery, P., Mak, J., Lewin, S., Crowe, S., Jaworowski, A. (2002) HIV-1 down-modulates {gamma} signaling chain of Fc{gamma}R in human macrophages: a possible mechanism for inhibition of phagocytosis J. Immunol. 168,2895-2903[Abstract/Free Full Text]
    19. 19
  19. Biggs, B. A., Hewish, M., Kent, S., Hayes, K., Crowe, S. (1995) HIV-1 infection of human macrophages imparis phagocytosis and killing of Toxoplasma gondii J. Immunol. 154,6132-6139[Abstract]
    20. 20
  20. Kedzierska, K., Mak, J., Jaworowski, A., Greenway, A., Violo, A., Hocking, H., Purcell, D., Sullivan, S., Mills, J., Crowe, S. (2001) nef-deleted HIV-1 inhibits phagocytosis by monocyte-derived macrophages in vitro, but not by peripheral blood monocytes in vivo AIDS 15,945-955[CrossRef][Medline]
    21. 21
  21. Kedzierska, K., Mak, J., Mijch, A., Cooke, I., Rainbird, M., Roberts, S., Paukovics, G., Jolley, D., Lopez, A., Crowe, S. (2000) Granulocyte-macrophage colony-stimulating factor augments phagocytosis of Mycobacterium avium complex by human immunodeficiency virus type 1-infected monocytes/macrophages J. Infect. Dis. 181,390-394[CrossRef][Medline]
    22. 22
  22. Kornbluth, R. S. (1994) The immunological potential of apoptotic debris produced by tumor cells and during HIV infection Immunol. Lett. 43,125-132[CrossRef][Medline]
    23. 23
  23. Callahan, M. K., Popernack, P., Tsutsui, S., Truong, L., Schlegel, R., Henderson, A. (2003) Phosphatidylserine on HIV envelope is a cofactor for infection of monocytic cells J. Immunol. 170,4840-4845[Abstract/Free Full Text]
    24. 24
  24. Ma, G., Greenwell-Wild, T., Lei, K., Jin, W., Swisher, J., Hardegen, N., Wild, C., Wahl, S. (2004) Secretory leukocyte protease inhibitor binds to annexin II, a cofactor for macrophage HIV-1 infection J. Exp. Med. 200,1337-1346[Abstract/Free Full Text]
    25. 25
  25. Henderson, A. J., Calame, K. (1997) CCAAT/enhancer binding protein (C/EBP) sites are required for HIV-1 replication in primary macrophages but not CD4+ T cells Proc. Natl. Acad. Sci. USA 94,8714-8719[Abstract/Free Full Text]
    26. 26
  26. Chen, B. K., Gandhi, R., Baltimore, D. (1996) CD4 down-modulation during infection of human T cells with human immunodeficiency virus type 1 involves independent activities of vpu, env, and nef J. Virol. 70,6044-6053[Abstract]
    27. 27
  27. Pear, W. S., Nolan, G., Scott, M., Baltimore, D. (1993) Production of high-titer helper-free retroviruses by transient transfection Proc. Natl. Acad. Sci. USA 90,8392-8396[Abstract/Free Full Text]
    28. 28
  28. Henderson, A. J., Zou, X., Calame, K. (1995) C/EBP proteins activate transcription from the human immunodeficiency virus type 1 long terminal repeat in macrophages/monocytes J. Virol. 69,5337-5344[Abstract]
    29. 29
  29. Pradhan, D., Williamson, P., Schlegel, R. (1994) Phosphatidylserine vesicles inhibit phagocytosis of erythrocytes with a symmetric transbilayer distribution of phospholipids Mol. Membr. Biol. 11,181-187[Medline]
    30. 30
  30. Hirt, B. (1967) Selective extraction of polyoma DNA from infected mouse cell cultures J. Mol. Biol. 26,365-369[CrossRef][Medline]
    31. 31
  31. Passati, A., Goff, S. (2001) Characterization of intracellular reverse transcription complexes of human immunodeficiency virus type I J. Immunol. 75,3626-3635
    32. 32
  32. Butler, S. L., Hansen, M., Bushman, F. (2001) A quantitative assay for HIV DNA integration in vivo Nat. Med. 7,631-634[CrossRef][Medline]
    33. 33
  33. Fan, X., Krahling, S., Smith, D., Williamson, P., Schlegel, R. (2004) Macrophage surface expression of annexins I and II in the phagocytosis of apoptotic lymphocytes Mol. Biol. Cell 15,2863-2872[Abstract/Free Full Text]
    34. 34
  34. Van den Eijnde, S. M., Boshart, L., Reutelingsperger, C., de Zeeuw, C., Vermeij-Keers, C. (1997) Phosphatidylserine plasma membrane asymmetry in vivo: a pancellular phenomenon which alters during apoptosis Cell Death Differ 4,311-317[CrossRef][Medline]
    35. 35
  35. Folks, T. M., Justement, J., Kinter, A., Dinarello, C., Fauci, A. (1987) Cytokine-induced expression of HIV-1 in a chronically infected promonocytic cell line Science 238,800-802[Abstract/Free Full Text]
    36. 36
  36. Lauber, K., Bohn, E., Drober, S., Xiao, Y., Blumenthal, S., Lindemann, R., Marini, P., Wiedig, C., Zobywalski, K., Baksh, S., Xu, Y., Autenrieth, I., Schulze-Osthoff, K., Belka, C., Stuhler, G., Wesselborg, S. (2003) Apoptotic cells induce migration of phagocytes via caspase-1-mediated release of a lipid attraction signal Cell 113,717-730[CrossRef][Medline]
    37. 37
  37. Gumienny, T. L., Brugnera, E., Tosello-Trampont, A., Kinchen, J., Haney, L., Nishiwaki, K., Walk, S., Nemergut, M., Macara, I., Francis, R., Schedl, T., Zin, Y., Van Aelst, L., Hengartner, M., Ravichandran, K. (2001) CED-12/ELMO, a novel member of the CrkII/Dock180/Rac pathway, is required for phagocytosis and cell migration Cell 107,27-41[CrossRef][Medline]
    38. 38
  38. Savill, J., Dransfield, I., Gregory, C., Haslett, C. (2002) A blast from the past: clearance of apoptotic cells regulates immune responses Nat. Rev. Immunol. 2,965-975[CrossRef][Medline]
    39. 39
  39. Huynh, M. L., Fadok, V., Henson, P. (2002) Phosphatidylserine-dependent ingestion of apoptotic cells promotes TGF-ß1 secretion and the resolution of inflammation J. Clin. Invest. 109,41-50[CrossRef][Medline]
    40. 40
  40. Kedzierska, K., Azzam, R., Ellery, P., Mak, J., Jaworowski, A., Crowe, S. (2003) Defective phagocytosis by human monocyte/macrophages following HIV-1 infection: underlying mechanisms and modulation by adjunctive cytokine therapy J. Clin. Virol. 26,247-263[CrossRef][Medline]
    41. 41
  41. Garza, H. H., Jr, Carr, D. J. (1995) Interactions of human immunodeficiency virus type 1 transactivator of transcription protein with signal transduction pathways Adv. Neuroimmunol. 5,321-325[CrossRef][Medline]
    42. 42
  42. Renkema, G. H., Saksela, K. (2000) Interactions of HIV-1 NEF with cellular signal transducing proteins Front. Biosci. 5,D268-D283[Medline]
    43. 43
  43. Yang, P., Henderson, A. (2005) Nef enhances c-Cbl phosphorylation in HIV-infected CD4+ lymphocytes Virology 336,219-228[CrossRef][Medline]
    44. 44
  44. Lu, X., Wu, X., Plemenitas, A., Yu, H., Sawai, E., Abo, A., Peterlin, B. (1996) CDC42 and Rac1 are implicated in the activation of the Nef-associated kinase and replication of HIV-1 Curr. Biol. 6,1677-1684[CrossRef][Medline]
    45. 45
  45. Janardhan, A., Swigut, T., Hill, B., Myers, M., Skowronski, J. (2004) HIV-1 Nef binds the DOCK2-ELMO1 complex to activate Rac and inhibit lymphocyte chemotaxis PLoS Biol. 2,E6[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
J. A. Readinger, G. M. Schiralli, J.-K. Jiang, C. J. Thomas, A. August, A. J. Henderson, and P. L. Schwartzberg
Selective targeting of ITK blocks multiple steps of HIV replication
PNAS, May 6, 2008; 105(18): 6684 - 6689.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.1105638v1
80/4/953    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gekonge, B. N.
Right arrow Articles by Henderson, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gekonge, B. N.
Right arrow Articles by Henderson, A. J.