Pepro Tech
Originally published online as doi:10.1189/jlb.0705357 on August 1, 2006

Published online before print August 1, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.0705357v1
80/4/870    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Józefowski, S.
Right arrow Articles by Kobzik, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Józefowski, S.
Right arrow Articles by Kobzik, L.
(Journal of Leukocyte Biology. 2006;80:870-879.)
© 2006 by Society for Leukocyte Biology

Role of scavenger receptor MARCO in macrophage responses to CpG oligodeoxynucleotides

Szczepan Józefowski, Timothy H. Sulahian, Mohamed Arredouani and Lester Kobzik1

Physiology Program, Harvard School of Public Health, Boston, Massachusetts

1 Correspondence: Physiology Program, Harvard School of Public Health, 665 Huntington Avenue, SPH-2, Room 221, Boston, MA 02115. E-mail: lkobzik{at}hsph.harvard.edu


arrow
ABSTRACT
 
The macrophage Class A scavenger receptor MARCO (macrophage receptor with a collagenous structure) functions as a pattern-recognition receptor for bacterial components, but its role in responses to CpG oligonucleotide sequences (CpG-ODN) in microbial DNA has not been characterized. Phosphorothioate (PS)-linked CpG-ODN stimulated IL-12 and NO production in wild-type but not in MARCO-deficient, thioglycollate-elicited peritoneal macrophages. MARCO and the related class A receptor SR-A belong to a redundant system of receptors for PS ODNs. The ability of MARCO to bind CpG-ODNs and conversely, to costimulate IL-12 and NO production upon specific ligation with immobilized mAb is consistent with MARCO being a signaling receptor for CpG-ODNs, costimulating TLR9-mediated NO and IL-12 production in macrophages. In contrast to MARCO, SR-A is likely to mediate negative regulation of macrophage responses to CpG-ODNs. In particular, increased affinity toward SR-A may contribute to decreased potency of oligo G-modified CpG-ODNs in stimulating IL-12 production. The results suggest that differential involvement of activating and inhibitory membrane receptors, such as SR-A and MARCO, may underlie profound differences observed in biological activities of different ODN sequences.

Key Words: oligonucleotides • interleukin-12 • nitric oxide


arrow
INTRODUCTION
 
Microbial DNA has potent, immunoregulatory properties, which include stimulation of IL-12, TNF-{alpha}, and NO release from macrophages and dendritic cells (DCs) and consequently, promotion of strongly Th1-polarized, adaptive immune responses. These biological activities of bacterial or viral DNA derive from the presence of oligodeoxynucleotide sequences containing unmethylated CG dinucleotides (CpG-ODNs). In comparison to LPS, synthetic CpG-ODNs exhibit little toxicity and therefore, have been intensively studied during recent years because of their potential for immunotherapy of cancer, allergies, and as vaccine adjuvants. To improve stability in vivo, phosphorothioate (PS) analogs of CpG-ODNs have been developed, where one of the nonbinding oxygen atoms in the phosphodiester (PO) backbone has been replaced with sulfur atoms. This modification markedly increases the biological activity of CpG-ODNs, which cannot be explained fully by increased resistance to degradation by DNases [1 ].

TLR9 is indispensable for PO and PS CpG-ODN signaling in macrophages, as revealed by targeted deletion of its gene [2 , 3 ]. However, although TLR9 seems to be the dominant receptor for CpG-ODNs, the observation that different types of CpG-ODN sequences produce qualitatively different responses in different cell types suggests that other receptor(s) function along with TLR9 in responses to CpG-ODNs. The most frequently studied Class A and Class B CpG-ODNs represent opposite ends of the biological activity spectrum of CpG-ODNs. Class A CpG-ODNs (CpG-A) are built of a PO-linked, palindromic CpG sequence, flanked by PS-linked, poly G motifs. They are exceptionally potent inducers of IFN-{alpha} production in human plasmocytoid precursors of DCs (pDCs) but weak activators of B cells. In contrast, Class B CpG-ODNs (CpG-B), containing a fully PS-modified backbone, one or more CpG motifs, and no poly G motifs, have enhanced B cell stimulatory properties dramatically. In comparison with CpG-A, CpG-B induces little IFN-{alpha} in pDCs, despite similar abilities to induce DC maturation and TNF-{alpha} production [1 , 4 , 5 ].

Involvement of receptors other than TLR9 in response to CpG-ODNs is also suggested by the fact that TLR9 is expressed endosomally in innate immune cells and interacts with CpG-ODNs at late endosomal compartments [6 , 7 ]. This means that internalization and endosomal maturation are conditional for CpG-ODNs to activate TLR9. The receptor(s) mediating initial recognition and endocytosis of CpG-ODNs have not been identified.

The Class A family of scavenger receptors (SRAs) is defined by the presence of collagenous and scavenger receptor cysteine-rich domains in the extracellular portions of receptors and includes Types I and II Class A scavenger receptors (scavenger receptor AI/II, SR-A), derived from the alternative splicing of a single gene product, and macrophage receptor with a collagenous structure (MARCO), encoded by a separate gene [8 , 9 ]. SR-A and MARCO are expressed predominately on macrophages and DCs [9 10 11 12 ] and have been implicated in scavenging [13 , 14 ] and immune functions of these cells [9 , 13 , 15 16 17 ]. Involvement of SR-As in cellular uptake of ODNs by macrophages has been suggested by sensitivity of this uptake to inhibition by polyanionic ligands, which bind to SRAs [18 , 19 ]. Moreover, increased binding to SRAs, mediated through flanking oligo G sequences in CpG-A, has been linked to increased biological activity of this class of CpG-ODNs [20 ]. However, results of experiments using SR-A-deficient macrophages were inconclusive regarding the role of SR-A in CpG-ODN uptake and biological effects. In one of these studies, resident peritoneal macrophages (PMs) from SR-A-deficient mice were reported to exhibit an ~50% decrease in high-affinity/low-capacity uptake of PS ODNs but a normal, low-affinity/high-capacity component of ODN binding [21 ]. In contrast, Zhu et al. [22 ] did not notice differences in uptake and intracellular distribution of CpG-ODNs between wild-type and SR-A–/– bone marrow-derived macrophages. In the latter study—injection with CpG-ODN stimulated higher serum levels of IL-12 in SR-A-deficient than in wild-type mice—isolated macrophages generated similar responses to CpG-ODNs in vitro.

Prompted by the sensitivity of CpG-ODN uptake by macrophages to inhibition by polyanionic ligands of SRAs, despite the reported modest effect of SR-A deficiency on this uptake, we examined the involvement of the second SRA, MARCO, in macrophage interactions with CpG-ODNs. Our results reveal an unexpected role of this receptor in macrophage IL-12 and NO responses to PS-linked CpG-ODNs.


arrow
MATERIALS AND METHODS
 
Reagents
Rat anti-mouse MARCO (Clone ED31) and anti-mouse SR-A (2F8) mAb were purchased from Serotec (Oxford, UK); irrelevant rat IgG2b [isotype-matched control IgG2b (cIgG2b), Clone A95-1] and IgG1 (cIgG1, R3-34) from PharMingen (San Diego, CA); rat anti-mouse TLR9 (M9.D6, FITC-conjugated) from eBiosciences (San Diego, CA); and ImmunoPure goat anti-rat IgG Fc-specific antibody from Pierce (Rockford, IL). Murine recombinant IFN-{gamma} was from R&D Systems (Minneapolis, MN). Nuclease-resistant Class B PS-linked oligonuleotide 1826, containing (underlined) two mouse-optimized, immunostimulatory CpG motifs (CpG-B: TCCATGACGTTCCTGACGTT), control ODN 2138 (GC-ODN: TCCATGAGCTTCCTGAGCTT), and Class A ODN 2336, containing central PO-linked (italic) CpG motif flanked by PS-linked oligo Gs (CpG-A: GGGGACGACGTCGTGGGGGGG) were obtained from Coley Pharmaceutical Group (Wellesley, MA). 5' Alexa Fluor 488 N-hydroxysuccinimide ester of ODN 1826 (AF488-CpG-B) was synthesized and HPLC-purified by Integrated DNA Technologies (Coralville, IA). AF488-labeled acetylated low-density lipoprotein (AcLDL) and Staphylococcus aureus bioparticles as well as carboxyl-modified 1 µm fluorescent (green) polystyrene spheres were purchased from Molecular Probes (Eugene, OR). All chemical reagents not otherwise specified were obtained from Sigma Chemical Co. (St. Louis, MO).

Preparation of mAb-coated plates
We used anti-MARCO mAb ED31 to specifically stimulate MARCO on macrophages. When used in the soluble form, ED31 and isotype-matched control rat IgG1 mAb produced strong inhibition of IL-12 release in wild-type and MARCO-deficient thioglycollate-elicited peritoneal macrophages (PEMs), hindering any MARCO-specific effect. To block Fc fragments of mAb, likely mediating this "nonspecific" effect [23 ], and to produce more extensive receptor cross-linking, the antibodies were linked to protein G-coated surfaces through a goat antibody, specific for Fc portions of rat IgG, essentially as described previously [24 ]. In brief, goat anti-rat Fc at 40 µg/ml was immobilized on Reacti-Bind protein G-coated plates (Pierce) by 2.5 h (room temperature) or overnight (4°C) incubation in 0.1 ml ImmunoPure (G) IgG-binding buffer (PGBB; Pierce). Subsequently, plates were washed two times with 0.16 ml/well PGBB and once with 0.32 ml/well 0.1% BSA (low-endotoxin, IgG-free) plus 20 µg/ml polymyxin B in PBS (pH 7, BioWhittaker, Walkersville, MD). ED31 or cIgG1 mAb, at 20 µg/ml in 0.1 ml BSA/polymyxin B, were added for 1.5 h incubation at 37°C. Finally, plates were washed four times with PBS, directly before use in experiments described below.

Animals
MARCO-deficient mice, developed by R. Soininen [17 , 26 ], and SR-A-deficient mice [13 ], both on the C57BL/6 background, were maintained in our facility under pathogen-free conditions. Mice deficient in SR-A and MARCO [double-knockout (dKO)] were generated by cross-breeding [25 , 26 ], using validation by genotyping and immunohistology [absence of normal expression in spleen and liver using anti-MARCO (ED31) and anti-SR-AI/II (2F8) antibodies] to confirm absence of both genes (data not shown). These mice are fertile and are normal in development and appearance. C57BL/6 mice were purchased from Charles River Laboratories (Wilmington, MA), C3H/HeJ mice from Jackson Laboratories (Bar Harbor, ME), and mice deficient in {gamma} chain of FcRs on C57BL/6 background from Taconic (Germantown, NY). Female mice, 9–14 weeks old, were used in the experiments. The studies have been reviewed and approved by an appropriate institutional review committee.

Cell culture
Mice were killed by inhalation of halothane (Halocarbon Labs, River Edge, NJ). Resident or inflammatory peritoneal cells (PECs), elicited with 1 ml aged, 3% thioglycollate (Difco, Detroit, MI), injected i.p. 4–5 days earlier, were washed out with PBS and collected into centrifuge tubes kept on ice. After washing once, PECs were resuspended in RPMI-1640 medium with 25 mM HEPES, supplemented with 10% FCS (Gemini Bio-Products, Woodland, CA), 2 mM L-glutamine, and antibiotics (FCS-RPMI medium). After overnight incubation, adherent macrophages (PEMs) were stimulated in 0.2 ml medium with 10 µg/ml ODNs (1.7 µM) or 20 ng/ml IFN-{gamma}. To ensure equal cell densities in all experiments using wild-type and KO macrophages, relative numbers of adherent cells were determined on the basis of lactate dehydrogenase (LDH) activities in cell lysates, and the medium volumes for KO cells were adjusted appropriately.

The second type of experiments involved receptor cross-linking with immobilized mAb. Suspensions of freshly isolated PECs in FCS-RPMI medium were plated in mAb-coated plates at 1.6 x 105/ml in 0.1 ml medium. Following 40' preincubation at 37°C, another 0.1-ml portion of medium containing double-concentrated solution of CpG-B was added, and the incubation was continued overnight.

IL-12 p70 and NO assays
Nitrite and IL-12 p70 concentrations were determined in supernatants from 22 h cultures of macrophages, stimulated as described above.

Nitrite concentrations in 70 µl aliquots of culture supernatants were determined according to the modified Griess method, as described before [24 ]. IL-12 p70 determinations were performed with the use of mouse IL-12 p70 Duo Set ELISA kit from R&D Systems, according to the manufacturer’s instructions.

Adhesion assay
Ninety six-well, tissue-culture plates were blocked with FCS-RPMI medium for ~1 h at 37°C. Resident or thioglycollate-elicited PECs were plated at 1 x 105/well and preincubated for 25' at 4°C, with or without receptor-specific mAb. Subsequently, the cells were transferred to 37°C and allowed to adhere for 1 h or for a period indicated in figure legends. Nonadherent cells were removed by washing three times with PBS, and LDH activities in 1% Triton X-100 lysates of adherent cells were determined with the use of a cytotoxity detection kit (LDH; Roche, Indianapolis, IN), as described previously [24 ]. In parallel, the total LDH content in plated cells has been determined and used to calculate percentages of adherent cells.

Flow cytometry
Expression of MARCO on freshly isolated, resident PECs was assessed by flow cytometry, as described previously [26 ]. To characterize TLR9 expression by PECs from wild-type, MARCO, and SR-A-deficient mice, we used flow cytometric quantification of labeling by anti-TLR9 mAb after saponin permeabilization (0.5%) to allow labeling of intracellular antigen.

Transfection of Chinese hamster ovary (CHO)-K1 cells
CHO-K1 cells were grown in Ham’s F12 (Mediatech, Herndon, VA) supplemented with 10% FCS and 20 µg/ml gentamicin. Dr. Karl Tryggvason (Karolinska Institute, Sweden) and Dr. Tatsuhiko Kodama (University of Tokyo, Japan) kindly provided human MARCO (hMARCO) and hSR-AI expression vectors, respectively. Dr. Timo Pikkarainen (Kardinska Institute, Sweden) kindly provided mouse MARCO cDNA [9 ]. MARCO and SR-AI were transiently transfected into CHO-K1 cells using FuGENE6 (Roche), according to the manufacturer’s instructions. Briefly, cells were washed with Ham’s F-12/10% FBS (without antibiotics), and DNA/transfection reagent mix was prepared by mixing FuGENE6 and cDNA at a 9:2 ratio (µl FuGENE6:µg cDNA) in serum-free medium. The DNA mix was then added to the cells, which were cultured overnight before binding assays were performed. Expression of functional receptors in transfected cells has been confirmed by strongly increased binding of established ligands of SRAs: latex beads, AF488-labeled S. aureus (6.2–19.6- and 4.5–5.8-fold increase of, respectively, latex beads and S. aureus binding to hMARCO transfectants in three independent experiments), and in the case of hSR-A, also AcLDL (see Go Go Go Fig. 4B ). Moreover, binding of latex beads to CHO cells transfected with hMARCO was inhibited by 75% by 20 µg/ml anti-hMARCO mAb polo-like PLK-1 [27 ].


Figure 1
View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. MARCO participates in macrophage IL-12 and NO responses to CpG-ODNs. Class B ODN (CpG-B; 10 µg/ml) stimulates significant IL-12 (A) and NO (B) production in wild-type but not in MARCO-deficient, thioglycollate-elicited PEMs. IL-12 and NO production induced by a combination of CpG-B and IFN-{gamma} (20 ng/ml) are also markedly diminished in MARCO–/– PEMs. No responses are seen with control GC-ODN (10 µg/ml). IFN-{gamma} alone stimulates similar NO and no IL-12 production in wild-type and MARCO–/– PEMs. (C) Immobilized anti-MARCO mAb enhances the CpG-B effect on NO production in PECs from wild-type and Fc{gamma}R–/– but not MARCO–/– mice. (D) In contrast to results with PEMs, CpG-ODN does not significantly stimulate IL-12 production in PECs. Results are presented as mean ± SEM of indicated (N) numbers of experiments, each performed in three to five replicates. #, Significant effect of IFN-{gamma} or CpG-B treatment (P<0.05 in unpaired t test); *, significant effect of ED31 versus control IgG1 mAb (P<0.05 in paired t-test).


Figure 2
View larger version (17K):
[in this window]
[in a new window]
 
Figure 2. Lack of MARCO involvement in macrophage adhesion. (A) Resident PMs from SR-A-deficient but not MARCO-deficient mice exhibit impaired, overnight adhesion to tissue culture-treated plates in serum-containing medium. Cellular adhesion is not impaired further in SR-A-deficient PEMs also lacking MARCO (dKO). (B) Anti-MARCO mAb ED31 has no effect on total or divalent cation-independent (EDTA-resistant) adhesion of SR-A-deficient, thioglycollate-elicited PEMs. Graphs present results (means±SEM of three to six replicates) of single experiments, each representative of two such experiments done. #, Statistically significant difference (P<0.05).


Figure 3
View larger version (30K):
[in this window]
[in a new window]
 
Figure 3. Scavenger receptors mediate uptake of PS-linked ODNs by macrophages. (A) PEMs exhibit robust uptake of 1.7 µM AF488-CpG-B. Most of bound AF488-CpG-B has been internalized, as indicated by strongly decreased uptake at 4°C, conditions that prevent endocytosis. (B) The binding of AF488-CpG-B to wild-type (wt) and MARCO–/– PEMs is largely specific but not selective for the GC sequence, as it is similarly and almost completely inhibited by tenfold molar excess of unlabeled CpG-B and GC-ODN, and is mediated through scavenger-type receptors, as dextran sulfate (DS; 400 µg/ml) but not chondroitin sulfate (CS; 400 µg/ml) shows effective competition. (C) CHO cells transfected with hSR-AI, hMARCO, or mouse MARCO (mMARCO) exhibit strongly enhanced uptake of AF488-CpG-B, which (D) is increased in MARCO–/– PEMs, unaffected by SR-A deficiency, but decreased in PEMs lacking SR-A and MARCO. Graphs present results of one of two or three similar experiments (mean±SEM; A–C) or are averages (±SEM) of three to four experiments (D), each performed in four to five replicates. #, Statistically significant difference (P<0.05).


Figure 4
View larger version (33K):
[in this window]
[in a new window]
 
Figure 4. CpG-A and CpG-B CpG-ODNs differ in IL-12-stimulating potency and in affinity for SR-A. (A) CpG-B, at 10 µg/ml, stimulates higher IL-12 production in wild-type PEMs than equimolar (1.7 µM) CpG-A, whereas both ODNs are equipotent in SR-A–/– PEMs. (B) Uptake of AF488-AcLDL in wild-type PEMs is largely SR-A-mediated, as indicated by strongly decreased AcLDL uptake in SR-A-deficient PEMs and robust AcLDL uptake in CHO cells transfected with hSR-AI but not in nontransfected or hMARCO-transfected CHO cells. (C) CpG-A exhibit much higher potency than CpG-B for inhibition of the largely SR-A-mediated AcLDL uptake in wild-type PEMs. Both ODNs inhibit AcLDL uptake in SR-A–/– PEMs with similar potencies. (D) Higher than CpG-B affinity of CpG-A to SR-A is confirmed by relatively higher potency of CpG-A in competing with AF488-CpG-B binding to hSR-AI expressed in transfected CHO cells. Graphs present mean results from three to seven independent expreriments ± SEM, each performed in four to five replicates (A), or results of single experiments, representative of two such experiments performed (B–D). *, Statistically significant difference (P<0.05).

Uptake of a fluorochrome-labeled CpG-ODN
Monolayers of adherent macrophages or CHO-K1 cells were incubated for 1.5 h at 0 or 37°C with AF488-conjugated CpG-B (1–20 µg/ml) or AcLDL (10 µg/ml) in 0.1 ml FCS-RPMI medium. In some cases, 10–400 µg/ml polyanionic ligands (added as double-concentrated solutions 10 min earlier) were included in the incubation medium. At the end of incubation, cells were washed four times with HBSS, and cell-associated ligands were quantified by measuring their 488 nm/530 nm fluorescence in a fluorescence plate reader (Spectrafluor Plus, Tecan, Research Triangle Park, NC). Presented data have been normalized for slight differences in number of adherent cells in different experimental groups, as described above.

In saturation experiments, receptor-specific binding has been defined as the difference between binding to transfected and nontransfected CHO cells for each AF488-CpG-B concentration. Dissociation constants and maximal binding were determined by nonlinear regression curve-fitting using GraphPad Prism software (San Diego, CA).

Statistical analysis
After assessing homogeneity of variances with an F-test, means were compared with Student’s t-test for single comparisons or ANOVA for multiple comparisons with the assumption that P values <0.05 indicate statistically significant differences. Paired Student’s t-test was applied to compare effects of receptor-specific mAb with effects of isotype-matched, control mAb (GraphPad Prism software).


arrow
RESULTS
 
Impaired responsiveness of MARCO-deficient macrophages to CpG-ODN stimulation
We measured the Class B CpG-ODN 1826 (CpG-B)-induced release of IL-12 and NO by thioglycollate-elicited PEMs from wild-type and MARCO–/– mice. CpG-B stimulated significant IL-12 production only in wild-type but not in MARCO–/– PEMs (Fig. 1A ). Expression of MARCO was also required for stimulation of low-level NO production by CpG-B, as CpG-B stimulated significant NO production in wild-type but not in MARCO–/– PEMs (Fig. 1B) . A control oligonucleotide, with reversed CpG motifs (GC-ODN), did not have any effect on IL-12 or NO production in both strains of mice (Fig. 1A and 1B) .

Impaired responsiveness of MARCO-deficient macrophages to CpG-ODN stimulation does not seem to result from decreased expression of TLR9, as saponin-permeabilized PECs from wild-type, MARCO, and SR-A-deficient mice exhibited equal intracellular labeling with anti-TLR9 mAb (data not shown).

We demonstrated previously that PEMs express MARCO and that specific cross-linking of MARCO with immobilized ED31 mAb, in the presence of IFN-{gamma}, costimulates IL-12 and NO production in these cells [26 ]. Therefore, looking for a mechanism of MARCO involvement in macrophage responses to CpG-ODNs, we assessed effects of MARCO stimulation with immobilized mAb on macrophage responses to CpG-B. In freshly isolated, thioglycollate-elicited PECs from wild-type but not MARCO-deficient mice, the CpG-B effect on NO production was enhanced specifically by immobilized anti-MARCO mAb ED31 (Fig. 1C) . The MARCO specificity of this ED31 mAb effect is confirmed further (and a spurious role of Fc{gamma}Rs excluded) by its duplication in PECs from Fc{gamma}RI- and -III-deficient mice (Fig. 1C) . In contrast to results with tissue-culture, plastic-adherent PEMs (Fig. 1A) , stimulation of IL-12 by CpG-ODN in freshly isolated PECs did not reach statistical significance, nor was it enhanced significantly by immobilized anti-MARCO mAb (Fig. 1D) . The discordance between CpG-ODN effects on IL-12 release in PEMs versus PECs may reflect the presence of nonmacrophage cells amongst PECs. Consistent with this interpretation, Yi et al. [28 ] have reported previously that in mixed culture of PECs, IL-10 released from CpG-ODN-stimulated B cells mediates paracrine inhibition of IL-12 production in PEMs.

Stimulation of only low levels of IL-12 p70 (Fig. 1A) and NO (Fig. 1B) by CpG-B alone in macrophages in vitro is consistent with previous reports [28 29 30 ]. However, CpG-ODN effects on NO and IL-12 p70 production can be enhanced strongly by IFN-{gamma} priming [28 29 30 ]. Indeed, we have found that CpG-B effects on IL-12 (Fig. 1A) and NO (Fig. 1B) production are enhanced synergistically by IFN-{gamma} cotreatment of PEMs. Costimulation with CpG-B and IFN-{gamma} triggered lower levels of production of IL-12 and NO in MARCO–/– PEMs, which were, on average, 1.6 (NO, P=0.03) and 2.8 (IL-12, P=0.03) times lower than in wild-type PEMs (Fig. 1A and 1B) .

MARCO-mediated adhesion does not contribute to costimulation of macrophage responses to CpG-ODN
Cellular adhesion, including that mediated by SR-A [31 ], is known to initiate intracellular signaling [32 ]. Moreover, responses to soluble mediators have been described, which occur only in adherent cells [33 , 34 ]. SR-A has been identified as a major receptor, mediating the divalent, cation-independent adhesion of thioglycollate-elicited PEMs to tissue culture-treated plates in serum-containing media [13 , 35 ]. As SR-A and MARCO share ligand-binding repertoires, we considered the possibility that costimulation arising from MARCO-mediated cellular adhesion is required for CpG-ODN-stimulated responses to occur. The following observations are, however, inconsistent with such a mechanism. First, in tissue-culture, plastic-adherent PEMs from wild-type and MARCO-deficient mice, IFN-{gamma} stimulated production of similar quantities of NO (Fig. 1B) and did not cause IL-12 production (Fig. 1A) , despite the ability of ligation of MARCO with immobilized mAb to specifically enhance IFN-{gamma} effects on IL-12 and NO production in PECs [26 ]. These results suggest that MARCO is not ligated/stimulated in adherent PEMs.

Also, results of adhesion experiments do not support a role of MARCO as a substratum-interacting receptor. Whereas resident PMs from SR-A–/– mice exhibited impaired cellular adhesion, adhesion of MARCO–/– macrophages was normal under our assay conditions (Fig. 2A ). Resident rather than thioglycollate-elicited PECs were used in these experiments because of quite a high interindividual variability in percentages of macrophages among inflammatory PECs (43–74%) [26 ]. In contrast, resident PECs from wild-type, SR-A–/–, and MARCO–/– mice contained similar percentages of macrophages, as indicated by similar adhesion to tissue culture-treated plates in serum-free medium (41–52%). Expression of MARCO on PMs has been confirmed by flow cytometry, which revealed specific binding of ED31 mAb to wild-type (geometric mean fluorescence intensity of 0.8 and 6.2 for cIgG1 and ED31 mAb, respectively, in a representative experiment) but not MARCO-deficient PMs (data not shown). The possibility that the dominant, SR-A-mediated adhesion masks the involvement of MARCO in cellular adhesion is excluded by the lack of any further impairment in adhesion by PMs from mice deficient in MARCO and SR-A compared with SR-A alone (Fig. 2A) . A role of MARCO in cellular adhesion is contradicted further by the observation that function-blocking anti-MARCO mAb ED31 affected neither total nor divalent cation-independent adhesion of PEMs from SR-A–/– mice (Fig. 2B) . The feasibility of blocking cellular adhesion with mAb under our assay conditions has been demonstrated by the effect of anti-SR-A mAb 2F8 on adhesion by C3H/HeJ PMs, which unlike C56BL/6 PMs, express an allelic isoform of SR-A, recognizable by 2F8 mAb [36 ]. Similarly, as in the case of PEMs [35 ], 2F8 mAb at 2.5 µg/ml blocked divalent, cation-independent adhesion of PMs specifically and completely (data not shown).

MARCO and SR-A as receptors for CpG-ODN
We next assessed the role of MARCO and SR-A as binding receptors for CpG-ODNs. Wild-type and MARCO-deficient PEMs incubated for 1.5 h with 10 µg/ml fluorescent AF488-CpG-B exhibited easily detected binding (Fig. 3A ). Most of bound AF488-CpG-B was endocytosed as indicated by comparison of binding at 37°C and 4°C, a temperature that prevents internalization (Fig. 3A) . Binding/uptake of AF488-CpG-B at 37°C and binding at 4°C were inhibited dose-dependently by unlabeled CpG-B (Fig. 3B and data not shown) with, respectively, 95% and 92% inhibition produced by its 200-µg/ml concentration. Further analysis showed that the binding site was not specific for the CpG sequence, as it was inhibited equally well by "cold", nonfluorescent, sequence-scrambled GC- and CpG-ODNs. The receptor activity showed features of scavenger receptors, as dextran sulfate but not chondroitin sulfate was an effective competitor (Fig. 3B) . In contrast, soluble fibrinogen, reported to block {alpha}Mß2 integrin-mediated binding of oligonucleotides [37 ] at 200 µg/ml, only slightly (by ~12%) inhibited AF488-CpG-B binding to PEMs.

To address more directly the role of SRAs as receptors for CpG-ODNs, we studied binding of AF488-CpG-B to CHO cells transfected with MARCO or SR-A. CHO cells transfected with hSR-A or hMARCO exhibited strongly increased cellular association of AF488-CpG-B compared with untransfected controls (Fig. 3C) . Transfection using mouse MARCO cDNA gave essentially identical results, as shown in Figure 3C . Binding of AF488-CpG-B to transfected cells has been inhibited by dextran sulfate (by 77–91% in the case of hSR-AI transfectants) but not by chondroitin sulfate (data not shown).

However, AF488-CpG-B binding and its inhibition by competitors are similar in wild-type and MARCO–/– PEMs (Fig. 3B) . In fact, MARCO–/– PEMs consistently bound slightly more AF488-CpG-B than wild-type PEMs [by 12±2.6% in average from four experiments (P=0.02), Fig. 3D ]. Thus, although these results do not rule out the role of MARCO as a CpG-ODN receptor when present, impaired CpG-B responsiveness of MARCO–/– PEMs (as seen in Fig. 1A and 1B ) is unlikely to be caused by decreased intracellular availability of CpG-B. A possible explanation for the increased AF488-CpG-B uptake in MARCO-deficient PEMs might be compensatory up-regulation of other receptors, which are more efficient than MARCO in mediating endocytosis of CpG-ODNs.

Prompted by the sensitivity of AF488-CpG-B uptake in PEMs to inhibition by polyanionic ligands of SRs, we also assessed the effect of SR-A deficiency on AF488-CpG-B uptake. As previously reported for resident PMs [21 ] and bone marrow-derived [22 ] macrophages, the uptake of CpG-B was not impaired substantially in SR-A–/– PEMs (Fig. 3D) . We therefore tested the effect of lack of SR-A and MARCO. dKO PEMs bound significantly less AF488-CpG-B than wild-type PEMs, by 28 ± 1.2% (N=3, P=0.002; Fig. 3D ). These data suggest that although they differ in signaling effects, both SRAs contribute to a highly redundant system of receptors for CpG-ODNs. As in wild-type and MARCO-deficient PEMs, dextran sulfate but not chondroitin sulfate almost completely inhibited AF488-CpG-B uptake, also in dKO PEMs [75±2.5% and 79±2.5% (N=2) inhibition by 200 µg/ml dextran sulfate in, respectively, wild-type and dKO PEMs].

Different affinities to inhibitory receptors such as SR-A may explain different biological activities of CpG-ODNs
Substantial differences exist in biological activity between the most frequently studied CpG-A and CpG-B CpG-ODNs. In particular, CpG-B is the more potent inducer of IL-12 and NO production in macrophages and DCs in vitro than CpG-A [38 39 40 ]. We found that CpG-B stimulated higher IL-12 production in wild-type PEMs than equimolar amounts of CpG-A, without (Fig. 4A ) and with IFN-{gamma} costimulation (1001±445 vs. 55±15 pg/ml, N=4). As SR-A can mediate inhibition of IL-12 production in macrophages [24 ], we hypothesized that the lower IL-12-stimulating potency of CpG-A may be caused by its increased binding to SR-A, conferred on CpG-A by the presence of SR-A-targeting oligo G motifs [41 , 42 ]. Consistent with the postulate that the SR-A receptor discriminates between CpG-A and CpG-B, the differences in IL-12 response are abolished when both types of ODNs are used to stimulate SR-A-deficient PEMs (Fig. 4A) .

We have also assessed relative affinities of CpG-B versus CpG-A toward SR-A in binding studies. For this purpose, we have applied two different approaches: namely, comparing potencies of ODNs in competing with AcLDL binding to SR-A on PEMs and direct binding studies using transfected cells.

Amongst the many SR-A ligands identified to date, AcLDL seems to be the most SR-A-dependent [13 , 36 ]. Indeed, whereas in SR-A–/– PEMs, the uptake/binding of AF488-AcLDL was decreased by ~60% (Fig. 4B) , uptake of other SR-A ligands (polystyrene beads, S. aureus) was completely unaffected by SR-A deficiency [26 ]. Transfection with hSR-A confers on CHO cells robust uptake of AF488-AcLDL, whereas uptake mediated by endogenous receptors of CHO cells or by transfected hMARCO was negligible (Fig. 4B) .

Consistent with a higher affinity for SR-A, CpG-A was much a more effective competitor than CpG-B of the largely SR-A-mediated Ac-LDL uptake in wild-type PEMs, producing 80% and 93% (means from two experiments) inhibition at, respectively, 1.7 and 8.5 µM (Fig. 4C) . In contrast, at these concentrations, CpG-B inhibited AcLDL uptake by 13% and 27% only. It is interesting that the redundant, non-SR-A AcLDL receptor(s) in SR-A–/– PEMs are less selective for the ODN sequence; e.g., CpG-B exhibited strongly increased, and CpG-A slightly decreased, potencies as competitors (Fig. 4C) . CpG-B showed greater inhibition of AcLDL uptake in SR-A–/– PEMs but decreased potency in stimulating IL-12 production (Fig. 4A) . Decreased potency of CpG-B to stimulate IL-12 production in SR-A–/– PEMs may therefore be caused by compensatory up-regulation of other scavenger receptors, which like SR-A, inhibit IL-12 production, but exhibit higher affinity than SR-A toward CpG-B.

We next directly assessed relative affinities of CpG-A and CpG-B for binding to hSR-A and hMARCO expressed in transfected CHO cells. CpG-A bound to SR-A with a higher affinity than CpG-B, as indicated by relative potencies in competing with AF488-labeled CpG-B binding, whereas both ODNs bound to MARCO with similar affinities (Fig. 4D) . Unlike CpG-A, CpG-B does not appear to exhibit preferential binding to SR-A over MARCO. Based on partial (four concentrations of CpG-B) saturation experiments on transfected cells, we have estimated dissociation constant values for AF488-labeled CpG-B binding to SR-A and MARCO as 7.5 ± 2.09 and 9.4 ± 0.07 µg/ml, respectively (data not shown).


arrow
DISCUSSION
 
MARCO-deficient macrophages show severe impairment in IL-12 and NO production in response to CpG-ODN. The potential mechanisms for the role of MARCO in macrophage responses to CpG-ODNs merit discussion. One possibility is that MARCO engagement, by adhesion to substrate or by CpG-ODNs themselves, may generate costimulatory signals required for optimal TLR9-mediated IL-12 and NO production. We have excluded MARCO involvement in cellular adhesion by demonstrating that neither MARCO deficiency nor function-blocking anti-MARCO mAb has any effect on macrophage adhesion. A role of MARCO-mediated adhesion in macrophage responses to CpG-ODNs is contradicted further by the observation that adherent PEMs from wild-type and MARCO–/– mice generate similar NO and IL-12 responses to IFN-{gamma}, despite the ability of MARCO to enhance IFN-{gamma} effects on IL-12 and NO production in PECs upon ligation with immobilized mAb [26 ].

Alternately, MARCO might participate in CpG-ODN delivery to endosomal sites of interaction with TLR9. Internalization and endosomal maturation appear to be required for CpG-ODNs to activate the functionally dominant receptor, TLR9 [2 , 6 , 7 , 43 ]. The specific receptor(s) responsible for initial recognition and endocytosis of CpG-ODNs have not been identified. Involvement of SRAs in cellular uptake of ODNs by macrophages has been suggested by sensitivity of this uptake to inhibition by polyanionic ligands, which bind to SRAs [18 , 19 , 38 ]. However, results of experiments using SR-A-deficient macrophages indicated that SR-A does not play a major role in ODN uptake [21 , 22 ]. We also did not observe impaired CpG-ODN binding by SR-A-deficient PEMs.

Additional evaluation of receptor-CpG-ODN interactions indicates that MARCO and SR-A belong to a redundant system of receptors for CpG-ODNs. First, PEMs lacking both receptors exhibit a significantly reduced uptake. Second, CHO cells transfected with SR-A or MARCO show strongly enhanced binding of CpG-ODN. Three lines of indirect evidence suggest, however, that involvement of MARCO in generating the macrophage IL-12 and NO response to CpG-ODN is not limited to CpG-ODN delivery to intracellular sites of interaction with TLR9 but includes generation of costimulatory signaling. First, the enhancing effect of MARCO cross-linking with mAb on IFN-{gamma}-stimulated IL-12 and NO production and on CpG-ODN-stimulated NO production shows that MARCO ligation per se is capable of costimulating IL-12 and NO production in PEMs. Second, MARCO-deficient PEMs also exhibit decreased IL-12 production in response to LPS [26 ], which like CpG-ODN, is a ligand of a TLR and MARCO but does not require internalization for signaling [6 , 44 45 46 ]. Finally, although CpG-B did bind to MARCO, its uptake was not impaired in MARCO–/– PEMs, suggesting that also, its intracellular availability to TLR9 is not decreased in MARCO–/– PEMs. It is also worth noting the possibility that serum proteins are required to create ligands of SR-A and MARCO via interaction of PS-ODNs. Our experiments showing increased binding of fluorescent ODNs to SR-expressing cells were carried out in the presence of 10% serum. We have obtained identical results with 1% serum, but in the absence of serum, no binding was detected in control or transfected cells (data not shown). The potential role of serum cofactors in SR interaction, as part of the ligand structure or in indirect effects on cell viability or differentiation, remains to be investigated further.

The potential role of the SRA as CpG-ODN signaling receptors has been suggested by previous reports. For instance, increased binding to a SRA-type receptor, mediated through flanking oligo G sequences [20 , 38 ], has been reported to increase [20 , 40 ] or even condition [5 , 38 , 47 ] biological activity of PO-linked CpG-ODNs. Oligo G sequences were subsequently found responsible for aggregation of CpG-ODNs [5 , 38 , 47 ], which is essential for binding to SR-A [38 , 41 , 42 ] and for triggering of TLR9-dependent responses [5 , 38 , 47 ]. It is important that higher cellular uptake does not seem responsible for increased activity of ODN aggregates [5 ].

Without flanking oligo G sequences, PO-linked CpG-ODNs do not aggregate [5 , 47 ], do not bind avidly to SRA-type receptors [20 , 38 , 41 , 42 , 48 ], and are inactive in stimulating IL-12 release [38 , 47 ], despite their ability of binding to isolated TLR9 [49 ]. These results suggest that bacterial DNA may have biological activity only when released from phagocytosed bacteria inside the endosomal compartment. PO-linked CpG-ODNs (without oligo G motifs) gain strong biological activity in promoting antibacterial host defense, characterized by high IL-12 and NO production, when their cellular uptake is improved by encapsulation inside liposomes [50 , 51 ]. Conversely, oligo G-modified CpG-ODNs may be considered as mimetics of DNA released extracellularly from virally infected dead cells. As a result of the presence of host-derived oligo G sequences [52 ], this type of ODN can be endocytosed through SRA-type receptors [20 , 38 , 41 , 42 ]. Consistent with this interpretation, oligo G-modified CpG-ODNs are known to promote strong, antiviral responses, characterized by relatively low IL-12 and high IFN-{alpha} production [5 , 53 ]. It is interesting that in pilot studies using gene-expression profiling, specific ligation of SR-A with 2F8 mAb increased by approximately twofold LPS plus IFN-{gamma}-stimulated IFN-{alpha}1 and IFN-{alpha}11 transcription in PEMs (unpublished results).

Increased cellular binding and augmentation of biological activity of CpG-ODNs are also achieved upon PS modification of their PO backbone, as in CpG-B [39 , 40 ]. Our results suggest that increased affinity to SRs such as SR-A and MARCO may be responsible for increased cellular uptake of PS-ODNs as compared with PO-ODNs. Thanks to the presence of a more hydrophobic PS backbone, PS-ODNs self-aggregate as well as form multimers by binding to plasma proteins, which may explain why CpG-B do not require oligo G sequences for biological activity or for binding to SRA-like receptors [40 , 42 , 47 , 54 ].

As SR-A and MARCO mediate the opposite effects on IL-12 production in macrophages [24 , 26 ], binding of PS-ODNs to SR-A and MARCO may be expected to exert opposite effects on this macrophage response. Consequently, the potency of a particular CpG-ODN sequence in stimulating NO and IL-12 production may depend on the relative affinities of this sequence for SR-A versus MARCO and on relative levels of SR-A versus MARCO expression on a given cell. The mouse-optimized Class B ODN 1826 we used was bound by SR-A and MARCO with similar affinities but stimulated low levels of NO and IL-12 in thioglycollate-elicited PEMs, which expressed much more SR-A than MARCO [26 ].

In contrast to the effect of such modification on activity of PO-linked ODNs, addition of consecutive deoxyriboguanosine residues to PS-linked CpG-B was reported to diminish their potency [38 , 40 , 55 ]. We hypothesize that lower NO- and IL-12-stimulating activity of CpG-A or oligo G-modified CpG-B in macrophages may result from increased binding of these modified oligos to inhibitory receptors such as SR-A [41 , 42 ]. Indeed, CpG-A bound to SR-A with a higher affinity than CpG-B and also stimulated lower IL-12 production in wild-type PEMs. In contrast to SR-A, MARCO and other non-SR-A AcLDL receptor(s) had little ability to discriminate between CpG-A and CpG-B in binding studies. Compensatory, functional up-regulation of non-SR-A AcLDL receptors with increased affinity toward CpG-B in SR-A–/– PEMs might be responsible for decreased potency of CpG-B in these cells. It is notable that the SR-B CD36, which is the major AcLDL receptor in SR-A-deficient macrophages [56 ], was reported to mediate inhibition of IL-12 production [57 ].

In summary, we found that the scavenger receptor MARCO promotes macrophage IL-12 and NO release in response to CpG-ODN. The data also identify differences in macrophage responses depending on which SRA is involved and structural features of the CpG-ODN. We postulate that macrophage-mediated recognition of "self" from microbial DNA may include cooperation with TLR9 by inhibitory receptors such as SR-A and activating receptors such as MARCO, in a manner analogous to recognition mediated by inhibitory and activating NK cell receptors [58 ]. Further characterization of signaling by macrophage scavenger receptors will facilitate progress in this area.


arrow
ACKNOWLEDGEMENTS
 
The study was supported by Grants NIH ES 11008 and 00002.

Received July 2, 2005; revised April 24, 2006; accepted May 3, 2006.


arrow
REFERENCES
 
    1
  1. Krieg, A. M. (2002) CpG motifs in bacterial DNA and their immune effects Annu. Rev. Immunol. 20,709-760[CrossRef][Medline]
  2. 2
  3. Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M., Hoshino, K., Wagner, H., Takeda, K., Akira, S. (2000) A Toll-like receptor recognizes bacterial DNA Nature 408,740-745[CrossRef][Medline]
  4. 3
  5. Roberts, T. L., Sweet, M. J., Hume, D. A., Stacey, K. J. (2005) Cutting edge: species-specific TLR9-mediated recognition of CpG and non-CpG phosphorothioate-modified oligonucleotides J. Immunol. 174,605-608[Abstract/Free Full Text]
  6. 4
  7. Verthelyi, D., Zeuner, R. A. (2003) Differential signaling by CpG DNA in DCs and B cells: not just TLR9 Trends Immunol. 24,519-522[CrossRef][Medline]
  8. 5
  9. Kerkmann, M., Costa, L. T., Richter, C., Rothenfusser, S., Battiany, J., Hornung, V., Johnson, J., Englert, S., Ketterer, T., Heckl, W., Thalhammer, S., Endres, S., Hartmann, G. (2005) Spontaneous formation of nucleic acid-based nanoparticles is responsible for high IFN-{alpha} induction by CpG-A in plasmocytoid dendritic cells J. Biol. Chem. 280,8086-8093[Abstract/Free Full Text]
  10. 6
  11. Ahmad-Nejad, P., Hacker, H., Rutz, M., Bauer, S., Vabulas, R. M., Wagner, H. (2002) Bacterial CpG-DNA and lipopolysaccharides activate Toll-like receptors at distinct cellular compartments Eur. J. Immunol. 32,1958-1968[CrossRef][Medline]
  12. 7
  13. Latz, E., Schoenemeyer, A., Visintin, A., Fitzgerald, K. A., Monks, B. G., Knetter, C. F., Lien, E., Nilsen, N. J., Espevik, T., Golenbock, D. T. (2004) TLR9 signals after translocation from the ER to CpG DNA in the lysosome Nat. Immunol. 5,190-198[CrossRef][Medline]
  14. 8
  15. Kodama, T., Freeman, M., Rohrer, L., Zabrecky, J., Matsudaira, P., Krieger, M. (1990) Type I macrophage scavenger receptor contains {alpha}-helical and collagen-like coiled coils Nature 343,531-535[CrossRef][Medline]
  16. 9
  17. Elomaa, O., Kangas, M., Sahlberg, C., Tuukkanen, J., Sormunen, R., Liakka, A., Thesleff, I., Krall, G., Tryggvason, K. (1995) Cloning of a novel bacteria-binding receptor structurally related to scavenger receptors and expressed in a subset of macrophages Cell 80,603-609[CrossRef][Medline]
  18. 10
  19. Hughes, D. A., Fraser, I. P., Gordon, S. (1995) Murine macrophage scavenger receptor: in vivo expression and function as receptor for macrophage adhesion in lymphoid and non-lymphoid organs Eur. J. Immunol. 25,466-473[Medline]
  20. 11
  21. Granucci, F., Vizzardelli, C., Virzi, E., Rescigno, M., Ricciardi-Castagnoli, P. (2001) Transcriptional reprogramming of dendritic cells by differentiation stimuli Eur. J. Immunol. 31,2539-2546[CrossRef][Medline]
  22. 12
  23. Harshyne, L. A., Zimmer, M. I., Watkins, S. C., Barratt-Boyes, S. M. (2003) A role for class A scavenger receptor in dendritic cell nibbling from live cells J. Immunol. 170,2302-2309[Abstract/Free Full Text]
  24. 13
  25. Suzuki, H., Kurihara, Y., Takeya, M., Kamada, N., Kataoka, M., Jishage, K., Ueda, O., Sakaguchi, H., Higashi, T., Suzuki, T., et al (1997) A role for scavenger receptors in atherosclerosis and susceptibility to infection Nature 386,292-296[CrossRef][Medline]
  26. 14
  27. Palecanda, A., Paulauskis, J., Al-Mutairi, E., Imrich, A., Qin, G., Suzuki, H., Kodama, T., Tryggvason, K., Koziel, H., Kobzik, L. (1999) Role of the scavenger receptor MARCO in alveolar macrophage binding of unopsonized environmental particles J. Exp. Med. 189,1497-1506[Abstract/Free Full Text]
  28. 15
  29. Van der Laan, L. J. V., Kangas, M., Dopp, E. A., Broug-Holub, E., Elomaa, O., Tryggvason, K., Kraal, G. (1997) Macrophages scavenger receptor MARCO: in vitro and in vivo regulation and involvement in the anti-bacterial host defense Immunol. Lett. 57,203-208[CrossRef][Medline]
  30. 16
  31. Thomas, C. A., Li, Y., Kodama, T., Suzuki, H., Silverstein, S. C., El Khoury, J. (2000) Protection from gram-positive infection by macrophage scavenger receptor-dependent phagocytosis J. Exp. Med. 191,147-155[Abstract/Free Full Text]
  32. 17
  33. Arredouani, M., Yang, Z., Ning, Y. Y., Qin, G., Soininen, R., Tryggvason, K., Kobzik, L. (2004) The scavenger receptor MARCO is required for lung defense against pneumococcal pneumonia and inhaled particles J. Exp. Med. 200,267-272[Abstract/Free Full Text]
  34. 18
  35. Steward, A., Christian, R. A., Hamilton, K. O., Nicklin, P. L. (1998) Co-administration of polyanions with a phosphorothioate oligodeoxynucleotide (CpG 69846A): a role for scavenger receptor in its in vivo disposition Biochem. Pharmacol. 56,509-516[CrossRef][Medline]
  36. 19
  37. Takagi, T., Hashiguchi, M., Mahato, R. I., Tokuda, H., Takakura, Y., Hashida, M. (1998) Involvement of specific mechanism in plasmid DNA uptake by mouse peritoneal macrophages Biochem. Biophys. Res. Commun. 245,729-733[CrossRef][Medline]
  38. 20
  39. Kimura, Y., Sonehara, K., Kuramoto, E., Makino, T., Yamamoto, S., Yamamoto, T., Kataoka, T., Tokunaga, T. (1994) Binding of oligoguanylate to scavenger receptors is required for oligonucleotides to augment NK cell activity and induce IFN J. Biochem. (Tokyo) 116,991-994[Abstract/Free Full Text]
  40. 21
  41. Butler, M., Crooke, R. M., Graham, M. J., Lemonidis, K. M., Lougheed, M., Murray, S. F., Witchell, D., Steinbrecher, U., Bennett, C. F. (2000) Phosphorothioate oligodeoxynucleotides distribute similarly in class A scavenger receptor knockout and wild-type mice J. Pharmacol. Exp. Ther. 292,489-496[Abstract/Free Full Text]
  42. 22
  43. Zhu, F-G., Reich, C. F., III, Pisetsky, D. S. (2001) The role of macrophage scavenger receptor in immune stimulation by bacterial DNA and synthetic oligonucleotides Immunology 103,226-234[CrossRef][Medline]
  44. 23
  45. Sutterwala, F. S., Noel, G. J., Salgame, P., Mosser, D. M. (1998) Reversal of proinflammatory responses by ligating the macrophage Fc{gamma} receptor type I J. Exp. Med. 188,217-222[Abstract/Free Full Text]
  46. 24
  47. Jozefowski, S., Kobzik, L. (2004) Scavenger receptor A mediates H2O2 production and suppression of IL-12 release in murine macrophages J. Leukoc. Biol. 76,1066-1074[Abstract/Free Full Text]
  48. 25
  49. Chen, Y., Pikkarainen, T., Elomaa, O., Soininen, R., Kodama, T., Kraal, G., Tryggvason, K. (2005) Defective microarchitecture of the spleen marginal zone and impaired response to a thymus-independent type 2 antigen in mice lacking scavenger receptors MARCO and SR-A J. Immunol. 175,8173-8180[Abstract/Free Full Text]
  50. 26
  51. Jozefowski, S., Arredouani, M., Sulahian, T., Kobzik, L. (2005) Disparate regulation and function of the class A scavenger receptors SRAI/II and MARCO J. Immunol. 175,8032-8041[Abstract/Free Full Text]
  52. 27
  53. Arredouani, M. S., Palecanda, A., Koziel, H., Huang, Y-C., Imrich, A., Sulahian, T. H., Ning, Y. Y., Yang, Z., Pikkarainen, T., Sankala, M., Vargas, S. O., Takeya, M., Tryggvason, K., Kobzik, L. (2005) MARCO is the major binding receptor for unopsonized particles and bacteria on human alveolar macrophages J. Immunol. 175,6058-6064[Abstract/Free Full Text]
  54. 28
  55. Yi, A-K., Yoon, J-G., Yeo, S-J., Hong, S-C., English, B. K., Krieg, A. M. (2002) Role of mitogen-activated protein kinases in CpG DNA-mediated IL-10 and IL-12 production: central role of extracellular signal-regulated kinase in the negative feedback loop of the CpG DNA-mediated Th1 response J. Immunol. 168,4711-4720[Abstract/Free Full Text]
  56. 29
  57. Sweet, M. J., Stacey, K. J., Kakuda, D. K., Markovich, D., Hume, D. A. (1998) IFN-{gamma} primes macrophage responses to bacterial DNA J. Interferon Cytokine Res. 18,263-271[Medline]
  58. 30
  59. Datta, N., Mukherjee, S., Das, L., Das, P. K. (2003) Targeting of immunostimulatory DNA cures experimental visceral leishmaniasis through nitric oxide up-regulation and T cell activation Eur. J. Immunol. 33,1508-1518[CrossRef][Medline]
  60. 31
  61. El Khoury, J., Hickman, S. E., Thomas, C. A., Cao, L., Silverstein, S. C., Loike, J. D. (1996) Scavenger receptor-mediated adhesion of microglia to ß-amyloid fibrils Nature 382,716-719[CrossRef][Medline]
  62. 32
  63. Haskill, S., Beg, A. A., Tompkins, S. M., Morris, J. S., Yurochko, A. D., Sampson-Johannes, A., Mondal, K., Ralph, P., Baldwin, A. S., Jr (1991) Characterization of an immediate-early gene induced in adherent monocytes that encodes I{kappa}B-like activity Cell 65,1281-1289[CrossRef][Medline]
  64. 33
  65. Shappell, S. B., Toman, C., Anderson, D. C., Taylor, A. A., Entman, M. L., Smith, C. W. (1990) Mac-1 (CD11b/CD18) mediates adherence-dependent hydrogen peroxide production by human and canine neutrophils J. Immunol. 144,2702-2711[Abstract]
  66. 34
  67. Hodge-Dufour, J., Noble, P. W., Horton, M. R., Bao, C., Wysoka, M., Burdick, M. D., Strieter, R. M., Trinchieri, G., Pure, E. (1997) Induction of IL-12 and chemokines by hyaluronan requires adhesion-dependent priming of resident but not elicited macrophages J. Immunol. 159,2492-2500[Abstract/Free Full Text]
  68. 35
  69. Fraser, I., Hughes, D., Gordon, S. (1993) Divalent cation-independent macrophage adhesion inhibited by monoclonal antibody to murine scavenger receptor Nature 364,343-346[CrossRef][Medline]
  70. 36
  71. Daugherty, A., Whitman, S. C., Block, A. E., Rateri, D. L. (2000) Polymorphism of class A scavenger receptors in C57BL/6 mice J. Lipid Res. 41,1568-1577[Abstract/Free Full Text]
  72. 37
  73. Benimetskaya, L., Loike, J. D., Khaled, Z., Loike, G., Silverstein, S. C., Cao, L., el Khoury, J., Cai, T. Q., Stein, C. A. (1997) Mac-1 (CD11b/CD18) is an oligodeoxynucleotide-binding protein Nat. Med. 3,414-420[CrossRef][Medline]
  74. 38
  75. Lee, S. W., Song, M. K., Baek, K. H., Park, Y., Kim, J. K., Lee, C. H., Cheong, H-K., Cheong, C., Sung, Y. C. (2000) Effects of hexameric deoxyriboguanosine run conjugation into CpG oligedeoxynucleotides on their immunostimulatory potentials J. Immunol. 165,3631-3639[Abstract/Free Full Text]
  76. 39
  77. Sester, D. P., Naik, S., Beasley, S. J., Hume, D. A., Stacey, K. J. (2000) Phosphorothioate backbone modification modulates macrophage activation by CpG DNA J. Immunol. 165,4165-4173[Abstract/Free Full Text]
  78. 40
  79. Dalpke, A. H., Zimmermann, S., Albrecht, I., Heeg, K. (2002) Phospodiester CpG oligonucleotides as adjuvants: polyguanosine runs enhance cellular uptake and improve immunostimulative activity of phosphodiester CpG oligonucleotides in vitro and in vivo Immunology 106,102-112[CrossRef][Medline]
  80. 41
  81. Pearson, A. M., Rich, A., Krieger, M. (1993) Polynucleotide binding to macrophage scavenger receptors depends on the formation of base-quartet-stabilized four-stranded helices J. Biol. Chem. 268,3546-3554[Abstract/Free Full Text]
  82. 42
  83. Suzuki, K., Doi, T., Imanishi, T., Kodama, T., Tanaka, T. (1999) Oligonucleotide aggregates bind to the macrophage scavenger receptor Eur. J. Biochem. 260,855-860[Medline]
  84. 43
  85. Manzel, L., Macfarlane, D. E. (1999) Lack of immune stimulation by immobilized CpG oligodeoxynucleotide Antisense Nucleic Acid Drug Dev. 9,459-464[Medline]
  86. 44
  87. Sankala, M., Brännström, A., Schulthess, T., Bergmann, U., Morgunova, E., Jürgen, E., Tryggvason, K., Pikkarainen, T. (2002) Characterization of recombinant soluble macrophage scavenger receptor MARCO J. Biol. Chem. 277,33378-33385[Abstract/Free Full Text]
  88. 45
  89. Bin, L-H., Nielson, L. D., Liu, X., Mason, R. J., Shu, H-B. (2003) Identification of uteroglobin-related protein 1 and macrophage receptor with collagenous structure as a lung-specific ligand-receptor pair J. Immunol. 171,924-930[Abstract/Free Full Text]
  90. 46
  91. Dunzendorfer, S., Lee, H-K., Soldau, K., Tobias, P. S. (2004) TLR4 is the signaling but not the lipopolysaccharide uptake receptor J. Immunol. 173,1166-1170[Abstract/Free Full Text]
  92. 47
  93. Wu, C. C. N., Lee, J., Raz, E., Corr, M., Carson, D. A. (2004) Necessity of oligonucleotide aggregation for Toll-like receptor 9 activation J. Biol. Chem. 279,33071-33078[Abstract/Free Full Text]
  94. 48
  95. Takakura, Y., Takagi, T., Hashiguchi, M., Nishikawa, M., Yamashita, F., Doi, T., Imanishi, T., Suzuki, H., Kodama, T., Hashida, M. (1999) Characterization of plasmid DNA binding and uptake by peritoneal macrophages from class A scavenger receptor knockout mice Pharm. Res. 16,503-508[CrossRef][Medline]
  96. 49
  97. Rutz, M., Metzger, J., Gellert, T., Luppa, P., Lipford, G. B., Wagner, H., Bauer, S. (2004) Toll-like receptor 9 binds single-stranded CpG-DNA in a sequence- and pH-dependent manner Eur. J. Immunol. 34,2541-2550[CrossRef][Medline]
  98. 50
  99. Yasuda, K., Ogawa, Y., Yamane, I., Nishikawa, M., Takakura, Y. (2005) Macrophage activation by a DNA/cationic liposome complex requires endosomal acidification and TLR9-dependent and -independent pathways J. Leukoc. Biol. 77,71-79[Abstract/Free Full Text]
  100. 51
  101. Yasuda, K., Yu, P., Kirschning, C. J., Schlatter, B., Schmitz, F., Heit, A., Bauer, S., Hochrein, H., Wagner, H. (2005) Endosomal translocation of vertebrate DNA activates dendritic cells via TLR9-dependent and -independent pathways J. Immunol. 174,6129-6136[Abstract/Free Full Text]
  102. 52
  103. Stacey, K. J., Young, G. R., Clark, F., Sester, D. P., Roberts, T. L., Naik, S., Sweet, M. J., Hume, D. A. (2003) The molecular basis for the lack of immunostimulatory activity of vertebrate DNA J. Immunol. 170,3614-3620[Abstract/Free Full Text]
  104. 53
  105. Hochrein, H., Schlatter, B., O’Keeffe, M., Wagner, C., Schmitz, F., Schiemann, M., Bauer, S., Suter, M., Wagner, H. (2004) Herpes simplex virus type-1 induces IFN-{alpha} production via Toll-like receptor 9-dependent and -independent pathways Proc. Natl. Acad. Sci. USA 101,11416-11421[Abstract/Free Full Text]
  106. 54
  107. Cossum, P. A., Sasmor, H., Dellinger, D., Truong, L., Cummins, L., Owens, S. R., Markham, P. M., Shea, J. P., Crooke, S. (1993) Disposition of the 14C-labeled phosphorothioate oligonucleotide ISIS 2105 after intravenous administration to rats J. Pharmacol. Exp. Ther. 267,1181-1190[Abstract/Free Full Text]
  108. 55
  109. Ballas, Z. K., Rasmussen, W. L., Krieg, A. M. (1996) Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA J. Immunol. 157,1840-1845[Abstract]
  110. 56
  111. Kunjathoor, V. V., Febbraio, M., Podrez, E. A., Moore, K. J., Andersson, L., Koehn, S., Rhee, J. S., Silverstein, R., Hoff, H. F., Freeman, M. W. (2002) Scavenger receptors class A-I/II and CD36 are the principal receptors responsible for the uptake of modified low density lipoproteins leading to lipid loading in macrophages J. Biol. Chem. 277,49982-49988[Abstract/Free Full Text]
  112. 57
  113. Urban, B. C., Willcox, N., Roberts, D. J. (2001) A role for CD36 in the regulation of dendritic cell function Proc. Natl. Acad. Sci. USA 98,8750-8755[Abstract/Free Full Text]
  114. 58
  115. Bottino, C., Castriconi, R., Moretta, L., Moretta, A. (2005) Cellular ligands of activating NK receptors Trends Immunol. 26,221-226[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
A. M. Avalos, E. Latz, B. Mousseau, S. R. Christensen, M. J. Shlomchik, F. Lund, and A. Marshak-Rothstein
Differential Cytokine Production and Bystander Activation of Autoreactive B Cells in Response to CpG-A and CpG-B Oligonucleotides
J. Immunol., November 15, 2009; 183(10): 6262 - 6268.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. Sorio and P. Melotti
Editorial: The role of macrophages and their scavenger receptors in cystic fibrosis
J. Leukoc. Biol., September 1, 2009; 86(3): 465 - 468.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Zhu, X. Liu, L. S. Treml, M. P. Cancro, and B. D. Freedman
Mechanism and Regulatory Function of CpG Signaling via Scavenger Receptor B1 in Primary B Cells
J. Biol. Chem., August 21, 2009; 284(34): 22878 - 22887.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. J. Rogers, M. J. Lees, L. Gabriel, E. Maniati, S. J. Rose, P. K. Potter, and B. J. Morley
A Defect in Marco Expression Contributes to Systemic Lupus Erythematosus Development via Failure to Clear Apoptotic Cells
J. Immunol., February 15, 2009; 182(4): 1982 - 1990.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
G. V. Limmon, M. Arredouani, K. L. McCann, R. A. C. Minor, L. Kobzik, and F. Imani
Scavenger receptor class-A is a novel cell surface receptor for double-stranded RNA
FASEB J, January 1, 2008; 22(1): 159 - 167.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Wang, G. Roderiquez, T. Jones, P. McPhie, and M. A. Norcross
Control of In Vitro Immune Responses by Regulatory Oligodeoxynucleotides through Inhibition of pIII Promoter Directed Expression of MHC Class II Transactivator in Human Primary Monocytes
J. Immunol., July 1, 2007; 179(1): 45 - 52.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.0705357v1
80/4/870    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Józefowski, S.
Right arrow Articles by Kobzik, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Józefowski, S.
Right arrow Articles by Kobzik, L.