Originally published online as doi:10.1189/jlb.1105684 on July 14, 2006
Published online before print July 14, 2006
(Journal of Leukocyte Biology. 2006;80:630-639.)
© 2006
by Society for Leukocyte Biology
The C-terminal flavin domain of gp91phox bound to plasma membranes of granulocyte-like X-CGD PLB-985 cells is sufficient to anchor cytosolic oxidase components and support NADPH oxidase-associated diaphorase activity independent of cytosolic phospholipase A2 regulation
Itai Pessach*,
Zeev Shmelzer*,
Thomas L. Leto
,
Mary C. Dinauer
and
Rachel Levy*,1
* Infectious Diseases Laboratory, Department of Clinical Biochemistry, Faculty of Health Sciences, Ben-Gurion University of the Negev and Soroka Medical Center, Beer Sheva, Israel;
Laboratory of Host Defenses, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rockville, Maryland; and
Herman B. Wells Center for Pediatric Research and Department of Pediatrics (Hematology/Oncology), James Whitcomb Riley Hospital for Children, Indiana University School of Medicine, Indianapolis
1 Correspondence: Department of Clinical Biochemistry, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer Sheva 84105, Israel. E-mail: ral{at}bgumail.bgu.ac.il
 |
ABSTRACT
|
|---|
We have previously established a model of cytosolic phospholipase A2 (cPLA2)-deficient PLB-985 cells and demonstrated that cPLA2-generated arachidonic acid (AA) is essential for reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase activation and NADPH-dependent diaphorase activity. The present study focuses on the C-terminal cytoplasmic domain of gp91phox (residues 283570), which contains the NADPH binding and flavin adenine dinucleotide-reducing center, to determine if this portion is regulated by AA. The gp91phox C-terminal reductase domain was expressed in X-CGD PLB-985 cells lacking normal gp91phox (X-CGD PLB 91CT cells) and was detected in the plasma membrane. It appears to be bound electrostatically to the plasma membrane, as it is eluted by high salt. Permeabilized, granulocyte-like X-CGD PLB 91CT cells lacking cPLA2 protein and activity, as well as AA release after stimulation, supported NADPH-dependent diaphorase activity after stimulation, similar to granulocyte-like X-CGD PLB 91CT cells. Normal translocation of p47phox and p67phox to the membrane fractions of both stimulated cell types indicated that the gp91phox C-terminal region is sufficient to anchor the cytosolic oxidase components to the membranes. cPLA2 translocated to membranes and bound the assembled oxidase in granulocyte-like X-CGD PLB 91CT cells after stimulation. Therefore, the assembled membrane-bound oxidase complex encompassing the flavin domain of gp91phox provides a docking site for cPLA2 but is not the site of AA-based regulation of oxidase activity.
Key Words: FAD arachidonic acid cPLA2
 |
INTRODUCTION
|
|---|
The reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase is a multicomponent electron transport chain that transfers electrons from NADPH to molecular oxygen to form superoxide, a precursor of microbicidal oxidants. The production of superoxide by NADPH oxidase represents one of the most important phagocyte contributions to host defense. However, during altered physiological states, reactive oxygen products may promote inflammatory reactions and participate in processes that lead to tissue injury. An understanding of the biochemical processes that regulate this function may provide a means to more effectively control this activity during infection and inflammation. In unstimulated neutrophils, NADPH oxidase is dormant, with unassembled subunits located in the cytosol and the plasma membranes [1
2
3
]. Upon stimulation, the cytosolic components p47phox, p67phox, p40phox, and rac2 translocate to the plasma membrane and associate with the heterodimeric transmembrane glycoprotein, flavocytochrome b558. The cytochrome comprises two subunits, gp91phox and p22phox, which contain heme, flavin, and NADPH binding sites [1
, 3
4
5
6
]. The gp91phox subunit is composed of two separate domains: the N-terminal, heme-binding domain with six putative transmembrane segments and a C-terminal domain (residues 289570) containing the NADPH binding site and flavin center [7
]. The activated enzyme transfers electrons from cytosolic NADPH to extracellular or phagosomal molecular oxygen through a transmembrane electron transport chain. The C-terminal flavin center of gp91phox transfers electrons from the physiological electron donor, NADPH, to two membrane-imbedded hemes within the N-terminal domain of the cytochrome. The latter serves as the terminal electron donor to oxygen [1
, 8
].
Cytosolic phospholipase A2 (cPLA2) hydrolyzes phospholipids containing arachidonate at the sn-2 position [9
, 10
] and has been implicated as the major enzyme in the formation of pro- and anti- inflammatory lipid mediators. Their generation has been shown to be regulated in part by perinuclear envelope localization of individual enzymes involved in leukotriene and prostaglandin biosynthesis [11
]. In addition, perinuclear translocation of cPLA2, demonstrated in a variety of cells including neutrophils and monocytes [12
13
14
15
16
], is consistent with its role in leukotriene and prostaglandin formation. In accordance with these studies, we demonstrated a striking correlation between PGE2 production and cPLA2 translocation to the nucleus in the human phagocyte myeloid cell line PLB-985 [17
, 18
]. Using these cells, in which there is a difference between the kinetics of superoxide production and of eicosanoid formation, we were able to show that the regulation of two different functions of cPLA2 in the same cells is achieved by its novel, dual localization to distinct subcellular sites [18
]. We have recently created a p85 cPLA2-deficient model PLB-985 cell line and demonstrated that cPLA2 is responsible for eicosanoids formed in PLB-985 cells [17
]. In addition, cPLA2-generated arachidonic acid (AA) is required for activation of the assembled phagocyte NADPH oxidase [19
], the oxidase-associated H+ channel [20
], and NADPH oxidase-associated diaphorase activity in these cells [21
]. The absolute requirement of cPLA2 for oxidase activation is in line with other studies [22
23
24
25
] using inhibitors and antisense molecules but stands in contrast to observations of normal superoxide production by stimulated phagocytes from cPLA2-deficient mice [26
]. However, the latter may be attributed to species differences or to compensating isoenzyme expression frequently observed in knockout animal models. Our most recent study [18
] has demonstrated that upon activation of peripheral blood neutrophils and granulocyte-like PLB-985 cells, which contain abundant levels of NADPH oxidase, cPLA2 translocates to the plasma membranes and binds the assembled oxidase. Our results were supported by a recent study [27
], demonstrating that the cPLA2 translocates to the phagosomal membrane after engulfment of zymosan particles. The physical association between cPLA2 and the assembled oxidase further supports the role of cPLA2 in activation of NADPH oxidase and may explain how cPLA2 is able to regulate the activation of NADPH oxidase.
An earlier study [28
] has demonstrated that a truncated form of gp91phox (residues 306569) in combination with cytosolic oxidase components was able to support diaphorase activity in a cell-free system; however, the physiological role of cPLA2 and AA in regulation of this activity could not be addressed with this in vitro system. The present study focuses on a similar C-terminal flavoprotein domain of gp91phox (residues 283570) containing the NADPH binding site and the flavin adenine dinucleotide (FAD)-reducing center to determine whether this fragment, together with the oxidase cytosolic components, is sufficient to support FAD reduction in whole permeabilized cells and to anchor cPLA2 to the membrane after cell stimulation. In addition, we examined whether the assembled oxidase composed of this isolated domain of the flavocytochrome and the cytosolic components represents a target site for regulation of the oxidase by AA.
 |
MATERIALS AND METHODS
|
|---|
Cell culture and induction of differentiation
PLB-985 cells and gp91phox-targeted X-CGD PLB-985 cells [29
] used to express the carboxyl-terminal domain of gp91phox were grown in stationary suspension culture in RPMI-1640 medium as described previously [19
]. Optimal concentrations of 1.25% dimethyl sulfoxide (DMSO) were added to the cells (2x105 cells/ml) at their logarithmic growth phase to induce differentiation toward granulocyte-like cells [20
]. Differentiation was induced for 4 days and determined by membrane-activated complex 1 antigen expression, detected by indirect immunofluorescence as described previously [30
].
Production of the MFG-S-gp91phox CT retroviral producer cell line
293T cells were grown as adherent monolayer cultures in Iscoves modified Eagles medium (IMEM) with 10% fetal calf serum, penicillin (100 units/ml), streptomycin (100 ug/ml), and glutamine (2 mM) in a 10% CO2 atmosphere. MFG-S C-terminal domain of gp91phox was engineered for expression in gp91phox-deficient X-CGD PLB-985 cells using the MFG-S retroviral transfer vector [15
]. Sequence encoding the C-terminal flavin-binding domain of gp91phox was amplified by standard polymerase chain reaction protocols using primers targeted to gp91phox coding sequence (residues 283570), which provide NcoI (5') or BamHI restriction sites for cloning into the same sites of the MFG-S. Primer 1 (AACATGCCATGGAGAGGTTGGTGCGGTTTTGGC) provided the NcoI site and a Kozak sequence, followed by a sequence corresponding to codons 283290. Primer 2 (ATATCCTGTCTTTAACAAATTGG) provided the BamHI site, followed by reverse-complementary sequence of gp91phox, starting at the stop codon. The resulting MFG-S-gp91phox CT plasmid DNA (15 ug) was transiently cotransfected into 293T cells along with retroviral packaging plasmids, pMDM mlv gag-pol (10 ug; gift from Richard C. Mulligan, Harvard Medical School, Boston, MA) and pMD.G (4 ug; vesicular stomatitis virus-G plasmid), using standard calcium phosphate precipitation methods [16
]. Retrovirus-containing culture supernatants were harvested 2, 3, and 4 days after transfection and replaced daily with fresh, complete IMEM medium. The viral supernatants were centrifuged at 1500 revolutions per minute (rpm) for 5 min to discard cell debris, filtered through a 0.45-µm syringe filter (Millex-HA), and diluted to 50% with fresh RPMI containing 6 µg/ml protamine. These supernatants were used for spin-transduction of X-CGD PLB 985 cells as described below.
Retroviral spin-transduction of X-CGD cells with MFG-S-gp91phox CT retrovirus encoding amino acids 283570 of gp91phox
X-CGD PLB 985 cells were grown in six-well plates to a density of 150,000 cells per well. Growth medium was aspirated, and 2 ml diluted MFG-S-gp91phox CT retroviral supernatant was added. The plates were spun at 2800 rpm for 20 min at 28°C (using a Rotanta 46R centrifuge, Hettich, Germany) and then incubated for 8 h at 37°C. An additional 2 ml fresh RPMI growth medium was added, and the cells were incubated for 12 more hours. Spin transduction was repeated six more times, and the cells were then transferred to 50 ml flasks. The expression of the gp91phox C-terminal domain was assessed using confocal fluorescence microscopy and immunoblot analysis as described below and was detected in seven different clones.
Isolation of plasma membranes
Subcellular fractionation was performed as described in our previous study for neutrophils [18
]. The cells were treated with diisopropylfluorophosphate, suspended in relaxation buffer [5 mM EGTA, 100 mM KCl, 3 mM NaCl, 3.5 mM MgCl2, 10 mM piperazine bis-2-ethane sulfonic acid, pH 7.4, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 100 µM leupeptin], and disrupted by nitrogen cavitation at 400 pounds per square inch. Nuclei and unbroken cells were pelleted by centrifugation at 500 g for 10 min at 4°C. The supernatant was loaded onto a precooled, discontinuous density gradient Percoll, and 10x concentrated relaxation buffer and distilled water were mixed to give solutions of densities of 1.05, 1.09, and 1.12 g/ml. The gradients were centrifuged at 32,800 g for 35 min (4°C) using a fixed-angle Beckman JA20 rotor. PLB cells do not contain specific granules (ß); thus, the only two visible bands that formed were collected, and the markers for azurophil granules (
) and plasma membranes (
) [myeloperoxidase and Na+/K+ adenosinetriphosphatase (ATPase), respectively] were analyzed as described previously [31
]. In addition, the plasma membranes were immunoblotted with anti-ATPase ß (Na+/K+) antibodies (Novus Biologicals, Inc., Littleton, CO).
Membrane and cytosol fractions
Membrane and cytosol fractions were prepared as described earlier [32
]. Stimulated or unstimulated, permeabilized cells were centrifuged, sonicated in relaxation buffer, and centrifuged for 5 min at 15,600 g to remove unbroken cells, nuclei, and granules. The supernatant was centrifuged (30 min, 134,000 g) to separate the membrane and cytosol fractions. Protein (150 µg) from cell membranes was separated by electrophoresis on 7% or 15% polyacrylamide sodium dodecyl sulfate (SDS) gels and blotted to nitrocellulose.
High salt protein extractions
The membrane fraction was resuspended in relaxation buffer without or with 0.5 NaCl, incubated for 30 min at 37°C, and centrifuged again at 30,000 g for 30 min at 4°C [33
]. Protein (100 µg) from cell membranes was separated by electrophoresis on 15% polyacrylamide SDS gel, blotted to nitrocellulose, and analyzed using anti-gp91phox antibodies and anti-ATPase ß (Na+/K+) antibodies.
Coimmunoprecipitation and Western blot analysis
Coimmunuprecipitation of cPLA2 with the cytosolic components of the NADPH oxidase was performed as described earlier [18
]. Each sample contains
3 x 107 membrane cell equivalents. The samples were brought to an equal protein concentration in 500 µl solubilization buffer. An equal amount of rabbit antiserum raised against cPLA2 [34
] was added to the samples and incubated on ice overnight. The extracts were brought to a volume of 1 ml in solubilization buffer (150 mM NaCl, 5 mM EDTA, 10 mM Tris, pH 7.5, 1% sodium deoxycholate, and 1% Nonidet P-40) containing 30 µl 50% slurry of recombinant protein G-sepharose. The samples were tumbled end-over-end for 1 h and washed twice with 1 ml solubilization buffer containing 20% (w/v) sucrose and 0.15% (w/v) bovine serum albumin (BSA) and twice with 1 ml solubilization buffer containing 20% sucrose. The samples were boiled in SDS sample buffer and electrophoresed on a 7% or 15% SDS polyacrylamide gel. The resolved proteins were transferred electrophoretically to nitrocellulose, and detection of cPLA2 or the oxidase components was analyzed as described previously [19
, 34
]. For detection of the full-length gp91phox or the gp91phox C-terminal domain, goat antiserum raised against the human recombinant gp91phox protein purified from baculovirus-infected insect cells was used [35
, 36
].
Inhibition of cPLA2 expression
Inhibition of cPLA2 expression in gp91phox-targeted PLB-985 cells expressing the gp91phox C-terminal was done as described earlier [19
]. Cells (1x107) in logarithmic growth phase were transfected in 0.3 ml culture medium with 20 µg plasmid DNA (antisense or vector alone) by electroporation at 250 V and 960 µF in a gene pulser unit (BioRad, Melville, NY) and selected in the presence of 0.8 mg/ml G418 (Gibco, Grand Island, NY). Clones resistant to the neomycin analog, G418, were screened by Western blot to select those that were cPLA2 protein-deficient. The results presented were derived from four individual clones.
Immunofluorescence microscopy
Preparation of labeled cells was done as described earlier [18
]. Cells were adhered on coverslips for 30 min at 37°C and fixed with 3% (w/v) formaldehyde. Antibodies that have been raised against the gp91phox C-terminal domain [36
], which do not react with any protein in X-CGD neutrophil membranes or antibodies against cPLA2 [34
], were dissolved in phosphate-buffered saline (PBS) containing 0.2% saponin and added for 1 h at room temperature. cy2- and cy3-conjugated antibodies (Jackson Laboratories, Inc., Bar Harbor, ME) were used as secondary antibodies. In all the experiments, a negative control using the second antibodies only was performed. Fluorescence was visualized using a four-channel Zeiss LSM 510 laser-scanning confocal microscope. The LSM 510 software was used for imaging gp91phox expression.
Measurement of 2-(p-iodophenyl)-3(p-nitrophenyl)-5-phenyl tetrazolium (INT) reduction (diaphorase activity) in permeabilized cells
Detection of INT reduction in permeabilized cells was performed as described in our previous study [21
]. Cells were counted, centrifuged, and then resuspended in cold PBS to a concentration of 1 x 107 cells/ml. Samples of 0.8 x 107 cells were then centrifuged and resuspended in cold electroporation buffer containing 140 mM KCl, 1 mM MgCl2, 100 nM CaCl2, 1 mM EGTA, 10 mM glucose, and 10 mM Hepes titrated to pH 7. The cells were then electroporated in a Bio-Rad Pulser cuvette with two to four discharges of 5 kV/cm2 of a 25-µF capacitor using a Bio-Rad gene pulser (Bio-Rad Laboratories, Melville, NH). Between pulses, the samples were incubated for 30 s on ice. The cells were centrifuged (10 s at 6000 g) and instantly resuspended in the electroporation buffer with the addition of 1 mM adenosine 5'-triphosphate, 100 µM guanosine 5'-triphosphate (GTP), 2 mM NADPH, and 1 mM INT for immediate measurement of INT reduction after activation. Superoxide dismutase (SOD; 60 µg/ml), 0.5 µg/ml rotenone, or 6.5 µM diphenylene iodonium (DPI) was added to the sample when indicated. INT reduction was followed by an increase in absorbance at 490 nm, and the maximal rates of INT reduction in nmoles e/106 cells/min were determined using an extinction coefficient
= 10.5 mM1, cm1, assuming INT is a two-electron acceptor. More than 95% of the cells were permeabilized by this method, as was determined by trypan blue staining, and more than 85% were still permeabilized 15 min after electroporation.
cPLA2 activity
Cell lysates were prepared using 1% Triton X-100, 50 mM HEPES (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 10% glycerol, 25 mM NaF, 10 µM ZnCl2, 1 mM PMSF, and 100 µM leupeptin. cPLA2 activity was determined in cell lysates, using sonicated dispersions of 1-stearoyl-2-[14C]arachidonyl phosphatidyl choline (30 µM, 50,000 DPM/assay) and sn-1,2-dioleoylglycerol (molar ratio 2:1) in an assay mixture containing 5 mM dithiothreitol (DTT) as described before [19
]. The assay mixture contained the phospholipid substrate in 80 mM KCl, 5 mM CaCl2, 5 mM DTT, 1 mg/ml BSA, 1 mM EDTA, and 10 mM Hepes, pH 7.4. The reaction was started by the addition of 50 µg cell lysates (within the linear protein range of the assay) and incubated at 37°C in a shaking water bath for 10 min.
Release of [3H]AA
Assays of incorporation and release of radiolabeled [3H]AA were performed as reported previously [19
]. Cells (108 cells/ml) were incubated for 30 min at 37°C in Ca2+- and Mg2+-free PBS containing 1 µCi [3H]AA. After appropriate washes, the cells (107 cells/ml) were stimulated, and the release of [3H]AA was determined in the linear range of the reaction.
 |
RESULTS
|
|---|
C-terminal of gp91phox is sufficient to support diaphorase activity in whole cells
The first set of experiments was designed to investigate whether the C-terminal region of gp91phox is sufficient to support diaphorase activity in whole cells. A construct encoding the C-terminal domain (residues 283570) of gp91phox was expressed in undifferentiated gp91phox-deficient, PLB-985 cells (X-CGD PLB cells) using a retroviral transduction system. This portion of gp91phox lacks the membrane-imbedded, heme-binding region of the protein but includes the complete, proposed flavin- and NADPH-binding regions. The expression of gp91phox C-terminal protein in X-CGD PLB cells was evaluated by immunofluoresence microscopy and immunoblot analysis, using antibodies raised against the recombinant gp91phox protein [35
], which have been shown to detect gp91phox in normal but not in X-CGD neutrophils [36
], indicating that it does not recognize other flavoproteins unrelated to gp91phox. As shown in Figure 1
, undifferentiated or differentiated X-CGD PLB cells did not express any gp91phox, and after transduction, they expressed high levels of the gp91phox C-terminal domain protein (X-CGD PLB 91CT cells), which did not change after differentiation for 4 days with 1.25% DMSO. Normal, undifferentiated PLB-985 cells did not express gp91phox, but 4 days of differentiation with 1.25% DMSO induced increased expression of this protein at the plasma membrane. As shown by the immunostaining analysis, the location of the trunsduced gp91phox C-terminal protein is identical to the location of full-length gp91phox in normal, differentiated PLB-985 cells, suggesting that the gp91phox C-terminal domain is also located in the plasma membranes. Anti-gp91phox antibody (7D5), which reacts with an extracellular epitope [37
], could not detect the gp91phox C-terminal domain, as expected (data not shown). To verify the location of the gp91phox C-terminal domain in the plasma membranes, cell fractionation was performed, and the different fractions were immunoblotted with anti-gp91phox antibodies. As shown in Figure 2A
, the gp91phox C-terminal domain was detected in the plasma membrane fraction of undifferentiated and differentiated X-CGD PLB 91CT cells in similar levels and not in membranes of X-CGD cells or normal PLB cells before and after differentiation. It could not be detected in the azurophil granule fraction of differentiated X-CGD PLB 91CT cells (not shown) or in the cytosol fractions of undifferentiated or differentiated X-CGD PLB 91CT cells, X-CGD cells, or normal PLB cells (Fig. 2B)
. The full-length gp91phox and p22phox were detected in the plasma membranes of normal PLB-985 cells only after differentiation (Fig. 2A)
but not in X-CGD PLB cells or in X-CGD PLB 91CT cells before and after differentiation (Fig. 2A)
. The C-terminal gp91phox protein was eluted from the plasma membrane fractions of X-CGD PLB 91CT cells by 0.5 M NaCl, and the plasma membrane Na+/K+ ATPase was not affected (Fig. 2C)
, suggesting that the gp91phox C-terminal flavin domain is bound to the plasma membranes by electrostatic interactions.

View larger version (71K):
[in this window]
[in a new window]
|
Figure 1. Immunofluorescence detection of retroviral-mediated expression of the gp91phox C-terminal in X-CGD PLB cells, which with X-CGD PLB cells transduced with gp91phox C-terminal (X-CGD PLB 91CT cells) and PLB cells, before and after 4 days of differentiation with 1.25% DMSO (granulocyte-like X-CGD PLB cells, granulocyte-like X-CGD PLB 91CT cells, and granulocyte-like PLB cells, respectively), were fixed, permeabilized, and incubated with anti-gp91phox antibodies and then with Cy2-conjugated secondary antibodies (original, x400).
|
|

View larger version (52K):
[in this window]
[in a new window]
|
Figure 2. Immunoblotting detection of retroviral-mediated expression of the gp91phox C-terminal in X-CGD PLB cells. Plasma membrane (A) and cytosol (B) fractions separated from parent PLB cells (PLB), X-CGD PLB cells (X-CGD), and X-CGD PLB 91CT cells (X-CGD91CT) before and after differentiation with 1.25% DMSO subjected to immunoblot analysis with anti-gp91phox antibodies or p22phox antibodies. gp91phox C-terminal was detected only in the plasma membrane fraction of X-CGD PLB 91CT cells. Shown is a representative SDS-polyacrylamide gel electrophoresis (PAGE) out of three with identical results. (C) High salt extraction of gp91phox C-terminal from plasma membrane fractions of X-CGD PLB 91CT cells before and after addition of 0.5 M NaCl was subjected to SDS-PAGE electrophoresis, followed by immunoblotting with anti-gp91phox antibodies or an anti-ß subunit of the Na+/K+ ATPase. The right lane (Elution) shows the eluted supernatant. Shown are results of a representative experiment out of three.
|
|
We next studied the translocation of the cytosolic oxidase components to the plasma membrane to form an assembled oxidase in differentiated X-CGD PLB-985 cells containing the gp91phox C terminus. As shown in Figure 3A
, stimulation of permeabilized, granulocyte-like X-CGD PLB 91CT cells with phorbol 12-myristate 13-acetate (PMA) caused significant translocation of p47phox and p67phox to the plasma membranes, similar to their translocation in stimulated, granulocyte-like parent PLB-985 cells. Stimulation of granulocyte-like X-CGD cells did not cause any translocation of the oxidase cytosolic components, indicating that the expression of the gp91phox C-terminal flavin domain is necessary and sufficient for translocation of the cytosolic oxidase components and assembly of the oxidase complex.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 3. DPI-inhibitable diaphorase activity in permeabilized, granulocyte-like X-CGD PLB 91CT cells. (A) Translocation of the cytsolic oxidase components p67phox and p47phox to the plasma membranes of permeabilized, differentiated PLB cells (PLB), X-CGD PLB cells (X-CGD), and X-CGD PLB 91CT cells (X-CGD 91CT) stimulated with 50 ng/ml PMA. Shown are the results of one representative experiment out of three (B, D). The linear rates of DPI-inhibitable diaphorase activity in permeabilized, granulocyte-like X-CGD PLB 91CT and permeabilized, granulocyte-like PLB cells, stimulated with 50 ng/ml PMA, 25 µM GTP S, 10 µM formyl-Met-Leu-Phe (fMLP), or in unstimulated cells. The results are the means ± SEM of eight experiments, where each assay was performed in duplicate (C, E). A representative experiment of the kinetics of DPI-inhibitable diaphorase activity in permeabilized, granulocyte-like X-CGD PLB 91CT and permeabilized, granulocyte-like PLB cells, activated with 50 ng/ml PMA ( ), 25 µM GTP S ( ), 10 µM fMLP ( ), or in unstimulated cells ().
|
|
We have previously developed a method for detecting diaphorase activity in permeabilized peripheral blood neutrophils and differentiated PLB cells [21
]. We showed that diaphorase activity could not be stimulated in permeabilized neutrophils from X-linked CGD patients or in differentiated X-CGD PLB cells but was restored in these cells following transduction with retrovirus encoding gp91phox. This method was applied to differentiated X-CGD PLB 91CT cells, which express cytosolic oxidase components. Differentiated X-CGD PLB 91CT cells did not support superoxide production (data not shown), as expected, as the heme-binding, N-terminal region is absent in the gp91phox C-terminal construct. Table 1
presents a sequential analysis of DPI-inhibitable diaphorase activity supported by the gp91phox C-terminal domain and the cytosolic oxidase components in permeabilized, granulocyte-like X-CGD PLB 91CT cells. INT reduction activity was completely abolished when NADPH was omitted from the reaction mixture. INT reduction activity stimulated with 50 ng/ml PMA, 25 µM GTP
S, or 10 µM fMLP was significantly higher than that detected in nonactivated cells. Addition of 60 µg/ml SOD did not change the activity (data not shown) as expected from their inability to produce superoxide. The addition of DPI caused a significant (P<0.001) inhibition of INT reduction in the stimulated cells but only a negligible inhibition in the nonactivated cells. The means ± SEM of the maximal rates of DPI-inhibitable INT reduction stimulated with PMA, GTP
S, or fMLP were 9.01 ± 2.21, 9.89 ± 2.51, and 10.44 ± 2.58 nmoles e/106 cells/min, respectively, and 1.01 ± 1.18 nmoles e/106 cells/min in unstimulated cells (Fig. 3B
, Table 1
). Permeabilized, granuocyte-like X-CGD PLB cells analyzed in parallel did not support any diaphorase activity after stimulation, which is in accordance with our earlier study [21
]. The means ± SEM of the maximal rates of DPI-inhibitable INT reduction in permeabilized, granuocyte-like X-CGD PLB cells stimulated with PMA, GTP
S, or fMLP were 0.89 ± 1.1, 1.12 ± 1.2, and 1.14 ± 1.1 nmoles e/106 cells/min, respectively, and 1.05 ± 1.07 nmoles e/106 cells/min in unstimulated cells. Representative kinetics of DPI-inhibitable INT reduction in permeabilized, granulocyte-like X-CGD PLB 91CT cells expressing the gp91phox C-terminal and the cytosolic oxidase factors stimulated by PMA, GTP
S, or fMLP are shown in Figure 3C
. Diaphorase activity detected in stimulated, permeabilized, granuocyte-like X-CGD PLB 91CT cells was similar to that detected in permeabilized, granuocyte-like, parent PLB cells studied in parallel (Fig. 3D
and 3E)
. As permeabilized, granuocyte-like X-CGD PLB cells did not support any diaphorase activity after stimulation, the expression of the gp91phox C-terminal flavoprotein domain in the X-CGD PLB cells was sufficient to fully restore the activity.
Association between cPLA2 and the assembled oxidase in differentiated X-CGD PLB 91CT cells
To determine whether the NADPH oxidase composed of the gp91phox C-reductase domain is sufficient to anchor cPLA2 similarly to the full-length gp91phox [18
], the translocation of cPLA2 and its association with this form of the oxidase after stimulation were studied in differentiated X-CGD PLB 91CT cells. As we have shown that the C-terminal gp91phox protein is found in the plasma membranes (Fig. 2)
, and it enables the cytosolic oxidase components to translocate to the plasma membranes (Fig. 3)
, the next experiments were done with particulate membrane fractions for simplicity. As shown in Figure 4A
, stimulation of permeabilized, granuocyte-like X-CGD PLB 91CT cells with 50 ng/ml PMA caused a significant translocation of the cytosolic oxidase components and of cPLA2 to the particulate membrane fraction, similar to their translocation in stimulated, granulocyte-like, parent PLB-985 cells. However, there was no translocation of the cytosolic oxidase components or cPLA2 to the particulate membranes of stimulated, granuocyte-like X-CGD PLB cells. The binding between cPLA2 and NADPH oxidase was studied in coimmunoprecipitation experiments with the membrane fractions of unstimulated and activated cells. As shown in Figure 4B
, there was significant immunoprecipitation of cPLA2 from the membrane fraction of activated, granulocyte-like X-CGD PLB 91CT cells, similar to that observed with the activated, parent, granulocyte-like PLB-985 cells. The NADPH oxidase components, p47phox and p67phox, were coimmunoprecipitated with cPLA2 in the membrane fraction of both types of activated cells. The presence of cPLA2 in the membrane fractions after granulocyte-like X-CGD PLB 91CT cell activation and its binding with the oxidase cytosolic components, p47phox and p67phox, indicate that the assembled oxidase containing the gp91phox C-terminal flavin domain is able to anchor cPLA2 to the plasma membranes. Similar results were obtained when the permeabilized cells were stimulated with fMLP or GTP
S (not shown). The translocation of cPLA2 to the cell periphery upon activation of X-CGD PLB 91CT cells was demonstrated further by immunofluoresence microscopy. As shown in Figure 5
, double-staining immunofluoresence analysis of cPLA2 and the membrane-bound gp91phox C-terminal flavin domain demonstrates that cPLA2 translocates from the cytosol in unstimulated cells to the cell periphery after stimulation, where it colocalizes with the gp91phox C-terminal flavin domain. In contrast, similar to our previous results [18
], double-staining immunofluoresence analysis of granulocyte-like, gp91phox-deficient PLB-985 cells indicated that these cells indeed do not express any gp91phox, and following stimulation, cPLA2 does not translocate from the cytosol to the cell periphery.

View larger version (69K):
[in this window]
[in a new window]
|
Figure 4. Translocation and binding of cPLA2 to the assembled oxidase after stimulation of granulocyte-like X-CGD PLB 91CT cells. (A) Translocation of p67phox, p47phox, and cPLA2 to particulate membrane fractions of permeabilized, granulocyte-like, parent PLB cells (PLB), X-CGD PLB 91CT cells (X-CGD 91CT), and X-CGD cells (X-CGD) stimulated for 2 min with PMA or unstimulated cells (Con) was detected by immunoblot analysis. (B) Coimmunoprecipitation of cPLA2 with NADPH oxidase components: Solubilized membranes of stimulated cells (as described in A) were subjected to immunoprecipitation (IP) with anti-cPLA2 antibodies, followed by immunoblot analysis of p67phox and p47phox. The levels of immunoprecipitated cPLA2 and of coimmunoprecipitated p67phox and p47phox were evaluated by immunoblot analysis. Shown are the results of one representative experiment out of three.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
Figure 5. The subcellular localization of cPLA2 after stimulation of granulocyte-like X-CGD PLB 91CT cells, which with granulocyte-like X-CGD PLB cells, before and after stimulation with 50 ng/ml PMA, 25 µM GTP S, or 10 µM fMLP for 2 min at 37°C, were fixed, permeabilized, and incubated with anti-cPLA2 and anti-gp91phox antibodies and then with cy3- and cy2-conjugated second antibodies, respectively. cPLA2 was detected in the cytosol of both cell types, and C-terminal 91phox protein was detected only in granulocyte-like X-CGD PLB 91CT cells. cPLA2 translocated to the cell periphery after stimulation of the granulocyte-like X-CGD PLB 91CT cells expressing the retroviral C-terminal gp91phox protein (x1000).
|
|
The sites for oxidase regulation by AA are not located within the complex composed of the C-terminal gp91phox flavin domain and the cytosolic components
To determine whether the oxidase composed of the C-terminal flavin domain of gp91phox and cytosolic components is regulated by AA, expression of cPLA2 was inhibited in X-CGD PLB 91CT cells. As shown in Figure 6A
, several stable clones completely deficient in cPLA2 protein were selected (X-CGD PLB-D 91CT), and X-CGD PLB 91CT clones transfected with the empty pcDNA3 vector were shown to contain normal levels of cPLA2, which were indistinguishable from those of untransfected X-CGD PLB 91CT cells.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 6. DPI-inhibitable diaphorase activity in permeabilized, granulocyte-like X-CGD PLB 91CT cells is independent of cPLA2. SDS-PAGE immunoblot analysis of cPLA2 (A) and cPLA2 activity measured by [14C]AA release from PC (B) in lysates of parent X-CGD PLB cells (XCGD), of several X-CGD PLB 91CT clones lacking cPLA2 (D14), and of XCGD PLB 91CT clones transfected with the empty pcDNA3 vector (XCGD-V). The arrow (in A) indicates the specific cPLA2 band detected by the antibody. The results of cPLA2 activity are the mean ± SEM of three experiments, each performed in duplicates. (C) Translocation of p67phox and p47phox to particulate membrane fractions of permeabilized, granulocyte-like X-CGD PLB 91CT cells and X-CGD PLB-D 91CT (cPLA2-deficient) cells, stimulated for 2 min with PMA, was detected by immunoblot analysis. (D) The release of [3H]AA from prelabeled, permeabilized, granulocyte-like X-CGD PLB 91CT cells and X-CGD PLB-D 91CT cells before () and after stimulation with 50 ng/ml PMA, 25 µM GTP S, and 10 µM fMLP. The results, expressed as percent of total, are mean ± SEM from three experiments performed in duplicates. (E) The linear rates of DPI-inhibitable diaphorase activity in permeabilized, differentiated X-CGD PLB-D 91CT (cPLA2-deficient) cells activated with 50 ng/ml PMA, 25 µM GTP S, 10 µM fMLP, or in unstimulated cells. The results are the means ± SEM of eight experiments, each repeated in duplicate. (F) A representative experiment of the kinetics of DPI-inhibitable diaphorase activity in permeabilized, differentiated X-CGD PLB-D 91CT (cPLA2-deficient) cells activated with 50 ng/ml PMA ( ), 25 µM GTP S ( ), 10 µM fMLP ( ), or in unstimulated cells (). OD, Optical density.
|
|
As expected from the absence of cPLA2 protein in X-CGD PLB-D 91CT, cPLA2 activity could not be detected (Fig. 6B)
. Stimulation of permeabilized, granulocyte-like X-CGD PLB-D 91CT cells deficient in cPLA2 caused normal translocation of the cytosolic oxidase components to the particulate membranes (Fig. 6C)
. Under these conditions, labeled AA release from prelabeled granulocyte-like X-CGD PLB-D 91CT cells was not detected after stimulation with PMA, fMLP, or GTP
S, and AA release was significant in differentiated PLB cells (Fig. 6D)
. A significant DPI-inhibitable diaphorase activity was stimulated in granulocyte-like X-CGD PLB-D 91CT cells lacking cPLA2 (Fig. 6E
and 6F)
, similar to that detected in granulocyte-like X-CGD PLB 91CT cells expressing cPLA2 (Fig. 3
, Table 1
). The means ± SEM of the rates of diaphorase activity in X-CGD PLB-D 91CT cells were 10.00 ± 2.93, 10.863 ± 1.59, 13.00 ± 2.22, or 1.85 ± 1.95 nmoles e/106 cells/min when stimulated with PMA, GTP
S, fMLP, or in unstimulated cells, respectively. These results indicate that diaphorase activity supported by the gp91phox C-terminal flavin domain and cytosolic components is not under regulation of AA released by cPLA2.
 |
DISCUSSION
|
|---|
Our previous studies have shown that in addition to cPLA2 translocation to the nuclear membrane to participate in eicosanoid formation, AA generated by cPLA2 is required for activation of the NADPH oxidase. Furthermore, cPLA2 is anchored to the plasma membranes through the assembled oxidase complex, which serves as its docking site. To further explore the target sites for AA and the binding sites for cPLA2 on the assembled NADPH oxidase, we focused on the proximal component of the activated oxidase system by examining diaphorase activity supported by an oxidase composed of the gp91phox C-terminal, flavin-containing domain and the oxidase cytosolic components. The results of the present study demonstrate that we were able to produce the gp91phox C-terminal domain (283570) in undifferentiated X-CGD PLB cells and that this domain is targeted to the plasma membranes, despite the absence of the six putative transmembrane segments of the full-length gp91phox [38
] and detectable p22phox. The gp91phox C-terminal flavin domain is apparently associated peripherally to the plasma membrane and is thus not subjected to the same complicated pathways involved in the biosynthesis of the complete protein containing the membrane-imbedded, heme-binding domain, which requires p22phox for stabilization and complete processing. This interaction between this C-terminal flavin domain and the plasma membranes has not been recognized previously, although its extraction by high salt (Fig. 2C)
indicates that this membrane association is primarily electrostatic in nature. The amino-terminal sequence of the gp91phox C-terminal domain (283294) is rich with ionic amino acids, particularly with positive charge, suggesting that this domain is capable of binding the inner surface of the plasma membrane through ionic interactions with negatively charged lipid head groups or proteins facing the cytoplasm. Furthermore, the high content of hydrophilic amino acids in this region may strengthen this interaction. A shorter construct encompassing residues 307570 was detected only in the cytosolic fraction (data not shown), further suggesting that the interaction to the plasma membranes is through these first amino acids of the C-terminal construct capable of membrane-binding. Stimulation of differentiated X-CGD PLB 91CT cells expressing the gp91phox C-terminal flavin domain caused translocation of the oxidase cytosolic components to form an assembled oxidase and to support diaphorase activity by PMA, fMLP, or GT
S in whole, permeabilized cells. The assembly of the oxidase further suggests that the extreme carboxyl terminus of gp91phox resides on the cytoplasmic face of the membrane, where it functions as a docking site for the cytosolic oxidase subunits p47phox and as the proximal oxidase component capable of binding NADPH.
The truncated gp91phox C-terminal flavin domain appears to associate with the membrane by less-complicated pathways than those involved in the biosynthesis of the complete protein containing a membrane-imbedded, heme-binding domain, which requires an association with p22phox. Our results in whole, permeabilized cells are in accordance with earlier studies [39
, 40
] performed in vitro using the carboxyl terminus. Various studies have suggested that gp91phox residues 559RGVHFIF565 interact with p47phox at an early step of oxidase assembly [39
, 41
42
43
44
45
]. Although the C-terminal portion of the p22phox subunit of cytochrome b558 has also been shown to mediate translocation of cytosolic oxidase components through interactions with the Src homology 3 domains of p47phox [46
, 47
], the present study shows that the overexpressed gp91phox C-terminal domain by itself is sufficient to function as an anchor, mediating the translocation of the cytosolic oxidase components p47phox and p67phox after stimulation of these cells. Based on our results, we may conclude that similar to the full-length gp91phox, the gp91phox C-terminal flavin domain (residues 283570) expressed in X-CGD PLB cells is located in the plasma membranes, is able to anchor the cytosolic components, and serves as a catalytically active flavoprotein in the presence of NADPH, similar to full-length gp91phox.
The translocation of cPLA2 to the plasma membranes and its binding to oxidase subunits in stimulated, differentiated X-CGD PLB 91CT cells but not in stimulated, differentiated X-CGD cells (Figs. 4
and 5
and our previous study [21
]) indicates that the membrane-bound oxidase complex, encompassing the C-terminal domain of gp91phox and the cytosolic oxidase components, provides a binding site for cPLA2 and establishes its role in targeting cPLA2 to the plasma membranes. The binding of cPLA2 to the assembled oxidase is probably through interactions with the NADPH oxidase cytosolic components, as we have previously shown its binding to the recombinant cytosolic proteins [18
]. Furthermore, cPLA2 translocation to the plasma membranes does not occur when the translocation of the cytosolic components is inhibited, as demonstrated previously [48
], suggesting that cPLA2 does not bind the flavocytochrome b558 directly but the assembled oxidase.
The assembly of the oxidase in the absence of cPLA2 expression and activity or AA release, demonstrated in the present study (Fig. 6)
, further supports our earlier observations in intact and in permeabilized cells [19
, 21
], indicating that AA is not required for normal membrane translocation of the cytosolic factors but rather acts at some later stage on the assembled oxidase. The normal diaphorase activity, supported by the assembled NADPH oxidase composed of the C-terminal domain of gp91phox and the cytosolic components in the absence of cPLA2, suggests that the target sites for AA are not located in this form of the reconstituted, assembled oxidase. In contrast, diaphorase activity could not be stimulated in normal, differentiated PLB 985 cells producing the full-length gp91phox in the absence of cPLA2 [21
], suggesting that AA acts on the N-terminal portion of gp91phox. Furthermore, our previous studies about differentiated PLB cells have shown that the NADPH oxidase-associated H+ channel, which has been proposed to involve the gp91phox N-terminal, membrane-spanning domain [49
], is indeed regulated by cPLA2 in differentiated PLB-985 cells [20
]. Thus, it appears likely that the target sites for AA are located within the N-terminal domain of gp91phox, where they have a regulatory role in activation of the H+ channel [20
] as well as in electron transfer involving diaphorase activity coupled with the transfer of electrons to the heme-containing domain, which can only be supported by full-length gp91phox. In agreement with this suggestion, several studies [50
51
52
53
54
55
56
] have proposed that the NADPH oxidase activation process by AA affects the gp91phox N-terminal domain by inducing conformational changes of flavocytochrome b, although the induction of an active state geometry of flavocytochrome b has not been demonstrated directly.
In conclusion, the present study demonstrates that stimulation-dependent diaphorase activity can be supported by an assembled form of the oxidase composed of the gp91phox C-terminal domain (residues 283570) in place of full-length gp91phox in whole, permeabilized cells. This domain appears to be attached to the plasma membrane by electrostatic interactions mediated by the amino acids at the N-terminal of this domain, enabling the extreme carboxyl terminus of gp91phox to reside on the cytoplasmic face of the membrane, to function as an anchor for the oxidase cytosolic components, and to support diaphorase activity upon stimulation. The assembled oxidase, composed of the gp91phox C-terminal domain and the cytosolic oxidase components, also serves as a target for cPLA2, indicating that this assembled form of the oxidase contains the binding sites for cPLA2. Although cPLA2 binds the assembled oxidase upon stimulation of granulocyte-like X-CGD PLB 91CT cells, it is not required for diaphorase activity, suggesting that the sites for AA-based regulation of oxidase activity are not located on this assembled complex composed of the C-terminal gp91phox flavin domain and the cytosolic components.
 |
ACKNOWLEDGEMENTS
|
|---|
This research was supported by a grant from the Israel Sciences Foundation founded by the Israel Academy of Sciences and Humanities 438/03. I. P. and Z. S. contributed equally to the study.
Received November 24, 2005;
accepted April 4, 2006.
 |
REFERENCES
|
|---|
- Babior, B. M. (1999) NADPH oxidase: an update Blood 93,1464-1476[Free Full Text]
- Babior, B. M., Lambeth, J. D., Nauseef, W. (2002) The neutrophil NADPH oxidase Arch. Biochem. Biophys. 397,342-344[CrossRef][Medline]
- Leto, T. L. (1999) The respiratory burst oxidase Gallin, J. Snyderman, R. Fearon, D. Haynes, B. Nathan, C. eds. Inflammation: Basic Principles and Clinical Correlates ,769-786 Lippincott, Williams, and Wilkins Philadelphia, PA.
- Segal, A. W., Abo, A. (1993) The biochemical basis of the NADPH oxidase of phagocytes Trends Biochem. Sci. 18,43-47[CrossRef][Medline]
- Yu, L., Cross, A. R., Zhen, L., Dinauer, M. C. (1999) Functional analysis of NADPH oxidase in granulocytic cells expressing a
488-497 gp91phox deletion mutant Blood 94,2497-2504[Abstract/Free Full Text] - Segal, B. H., Leto, T. L., Gallin, J. I., Malech, H. L., Holland, S. M. (2000) Genetic, biochemical, and clinical features of chronic granulomatous disease Medicine (Baltimore) 79,170-200[CrossRef][Medline]
- Vignais, P. V. (2002) The superoxide-generating NADPH oxidase: structural aspects and activation mechanism Cell. Mol. Life Sci. 59,1428-1459[CrossRef][Medline]
- Cross, A. R., Yarchover, J. L., Curnutte, J. T. (1994) The superoxide-generating system of human neutrophils possesses a novel diaphorase activity. Evidence for distinct regulation of electron flow within NADPH oxidase by p67phox and p47phox J. Biol. Chem. 269,21448-21454[Abstract/Free Full Text]
- Kramer, R. M., Roberts, E. F., Manetta, J., Putnam, J. E. (1991) The Ca2+-sensitive cytosolic phospholipase A2 is a 100-kDa protein in human monoblast U937 cells J. Biol. Chem. 266,5268-5272[Abstract/Free Full Text]
- Clark, J. D., Milona, N., Knopf, J. L. (1990) Purification of a 110-kilodalton cytosolic phospholipase A2 from the human monocytic cell line U937 Proc. Natl. Acad. Sci. USA 87,7708-7712[Abstract/Free Full Text]
- Ueno, N., Murakami, M., Tanioka, T., Fujimori, K., Tanabe, T., Urade, Y., Kudo, I. (2001) Coupling between cyclooxygenase, terminal prostanoid synthase, and phospholipase A2 J. Biol. Chem. 276,34918-34927[Abstract/Free Full Text]
- Pouliot, M., McDonald, P. P., Krump, E., Mancini, J. A., McColl, S. R., Weech, P. K., Borgeat, P. (1996) Colocalization of cytosolic phospholipase A2, 5-lipoxygenase, and 5-lipoxygenase-activating protein at the nuclear membrane of A23187-stimulated human neutrophils Eur. J. Biochem. 238,250-258[Medline]
- Fatima, S., Yaghini, F. A., Ahmed, A., Khandekar, Z., Malik, K. U. (2003) CaM kinase II
mediates norepinephrine-induced translocation of cytosolic phospholipase A(2) to the nuclear envelope J. Cell Sci. 116,353-365[Abstract/Free Full Text] - Schievella, A. R., Regier, M. K., Smith, W. L., Lin, L. L. (1995) Calcium-mediated translocation of cytosolic phospholipase A2 to the nuclear envelope and endoplasmic reticulum J. Biol. Chem. 270,30749-30754[Abstract/Free Full Text]
- Marshall, J., Krump, E., Lindsay, T., Downey, G., Ford, D. A., Zhu, P., Walker, P., Rubin, B. (2000) Involvement of cytosolic phospholipase A2 and secretory phospholipase A2 in arachidonic acid release from human neutrophils J. Immunol. 164,2084-2091[Abstract/Free Full Text]
- Sheridan, A. M., Sapirstein, A., Lemieux, N., Martin, B. D., Kim, D. K., Bonventre, J. V. (2001) Nuclear translocation of cytosolic phospholipase A2 is induced by ATP depletion J. Biol. Chem. 276,29899-29905[Abstract/Free Full Text]
- Liberty, I. F., Raichel, L., Hazan-Eitan, Z., Pessach, I., Hadad, N., Schlaeffer, F., Levy, R. (2004) Cytosolic phospholipase A2 is responsible for prostaglandin E2 and leukotriene B4 formation in phagocyte-like PLB-985 cells: studies of differentiated cPLA2-deficient PLB-985 cells J. Leukoc. Biol. 76,176-184[Abstract/Free Full Text]
- Shmelzer, Z., Haddad, N., Admon, E., Pessach, I., Leto, T. L., Eitan-Hazan, Z., Hershfinkel, M., Levy, R. (2003) Unique targeting of cytosolic phospholipase A2 to plasma membranes mediated by the NADPH oxidase in phagocytes J. Cell Biol. 162,683-692[Abstract/Free Full Text]
- Dana, R., Leto, T. L., Malech, H. L., Levy, R. (1998) Essential requirement of cytosolic phospholipase A2 for activation of the phagocyte NADPH oxidase J. Biol. Chem. 273,441-445[Abstract/Free Full Text]
- Lowenthal, A., Levy, R. (1999) Essential requirement of cytosolic phospholipase A2 for activation of the H+ channel in phagocyte-like cells J. Biol. Chem. 274,21603-21608[Abstract/Free Full Text]
- Pessach, I., Leto, T. L., Malech, H. L., Levy, R. (2001) Essential requirement of cytosolic phospholipase A2 for stimulation of NADPH oxidase-associated diaphorase activity in granulocyte-like cells J. Biol. Chem. 276,33495-33503[Abstract/Free Full Text]
- Li, Q., Cathcart, M. K. (1997) Selective inhibition of cytosolic phospholipase A2 in activated human monocytes. Regulation of superoxide anion production and low density lipoprotein oxidation J. Biol. Chem. 272,2404-2411[Abstract/Free Full Text]
- Bae, Y. S., Kim, Y., Kim, J. H., Lee, T. G., Suh, P. G., Ryu, S. H. (2000) Independent functioning of cytosolic phospholipase A2 and phospholipase D1 in Trp-Lys-Tyr-Met-Val-D-Met-induced superoxide generation in human monocytes J. Immunol. 164,4089-4096[Abstract/Free Full Text]
- Zhao, X., Bey, E. A., Wientjes, F. B., Cathcart, M. K. (2002) Cytosolic phospholipase A2 (cPLA2) regulation of human monocyte NADPH oxidase activity. cPLA2 affects translocation but not phosphorylation of p67phox and p47phox J. Biol. Chem. 277,25385-25392[Abstract/Free Full Text]
- ODowd, Y. M., El-Benna, J., Perianin, A., Newsholme, P. (2004) Inhibition of formyl-methionyl-leucyl-phenylalanine-stimulated respiratory burst in human neutrophils by adrenaline: inhibition of phospholipase A2 activity but not p47phox phosphorylation and translocation Biochem. Pharmacol. 67,183-190[CrossRef][Medline]
- Rubin, B. B., Downey, G. P., Koh, A., Degousee, N., Ghomashchi, F., Nallan, L., Stefanski, E., Harkin, D. W., Sun, C., Smart, B. P., et al (2005) Cytosolic phospholipase A2-
is necessary for platelet-activating factor biosynthesis, efficient neutrophil-mediated bacterial killing, and the innate immune response to pulmonary infection: cPLA2-
does not regulate neutrophil NADPH oxidase activity. Groups IV, V, and X phospholipases A2s in human neutrophils: role in eicosanoid production and gram-negative bacterial phospholipid hydrolysis. Extended lamivudine retreatment for chronic hepatitis B: maintenance of viral suppression after discontinuation of therapy J. Biol. Chem. 280,7519-7529[Abstract/Free Full Text] - Girotti, M., Evans, J. H., Burke, D., Leslie, C. C. (2004) Cytosolic phospholipase A2 translocates to forming phagosomes during phagocytosis of zymosan in macrophages J. Biol. Chem. 279,19113-19121[Abstract/Free Full Text]
- Han, C. H., Nisimoto, Y., Lee, S. H., Kim, E. T., Lambeth, J. D. (2001) Characterization of the flavoprotein domain of gp91phox which has NADPH diaphorase activity J. Biochem. (Tokyo) 129,513-520[Abstract/Free Full Text]
- Zhen, L., King, A. A., Xiao, Y., Chanock, S. J., Orkin, S. H., Dinauer, M. C. (1993) Gene targeting of X chromosome-linked chronic granulomatous disease locus in a human myeloid leukemia cell line and rescue by expression of recombinant gp91phox Proc. Natl. Acad. Sci. USA 90,9832-9836[Abstract/Free Full Text]
- Hazav, P., Shany, S., Moran, A., Levy, R. (1989) Involvement of intracellular pH elevation in the effect of 1,25-dihydroxyvitamin D3 on HL-60 cells Cancer Res. 49,72-75[Abstract/Free Full Text]
- Kaufman, M., Leto, T., Levy, R. (1996) Translocation of annexin I to plasma membranes and phagosomes in human neutrophils upon stimulation with opsonized zymosan: possible role in phagosome function Biochem. J. 316,35-42
- Levy, R., Rotrosen, D., Nagauker, O., Leto, T. L., Malech, H. L. (1990) Induction of the respiratory burst in HL-60 cells. Correlation of function and protein expression J. Immunol. 145,2595-2601[Abstract]
- Leto, T. L., Marchesi, V. T. (1984) A structural model of human erythrocyte protein 4.1 J. Biol. Chem. 259,4603-4608[Abstract/Free Full Text]
- Hazan, I., Dana, R., Granot, Y., Levy, R. (1997) Cytosolic phospholipase A2 and its mode of activation in human neutrophils by opsonized zymosan. Correlation between 42/44 kDa mitogen-activated protein kinase, cytosolic phospholipase A2 and NADPH oxidase Biochem. J. 326,867-876
- Leto, T. L., Garrett, M. C., Fujii, H., Nunoi, H. (1991) Characterization of neutrophil NADPH oxidase factors p47phox and p67phox from recombinant baculoviruses J. Biol. Chem. 266,19812-19818[Abstract/Free Full Text]
- Jirapongsananuruk, O., Malech, H. L., Kuhns, D. B., Niemela, J. E., Brown, M. R., Anderson-Cohen, M., Fleisher, T. A. (2003) Diagnostic paradigm for evaluation of male patients with chronic granulomatous disease, based on the dihydrorhodamine 123 assay J. Allergy Clin. Immunol. 111,374-379[CrossRef][Medline]
- Yamauchi, A., Yu, L., Potgens, A. J., Kuribayashi, F., Nunoi, H., Kanegasaki, S., Roos, D., Malech, H. L., Dinauer, M. C., Nakamura, M. (2001) Location of the epitope for 7D5, a monoclonal antibody raised against human flavocytochrome b558, to the extracellular peptide portion of primate gp91phox Microbiol. Immunol. 45,249-257[Medline]
- Nauseef, W. M. (2004) Assembly of the phagocyte NADPH oxidase Histochem. Cell Biol. 122,277-291[CrossRef][Medline]
- Rotrosen, D., Kleinberg, M. E., Nunoi, H., Leto, T., Gallin, J. I., Malech, H. L. (1990) Evidence for a functional cytoplasmic domain of phagocyte oxidase cytochrome b558 J. Biol. Chem. 265,8745-8750[Abstract/Free Full Text]
- Imajoh-Ohmi, S., Tokita, K., Ochiai, H., Nakamura, M., Kanegasaki, S. (1992) Topology of cytochrome b558 in neutrophil membrane analyzed by anti-peptide antibodies and proteolysis J. Biol. Chem. 267,180-184[Abstract/Free Full Text]
- Kleinberg, M. E., Malech, H. L., Rotrosen, D. (1990) The phagocyte 47-kilodalton cytosolic oxidase protein is an early reactant in activation of the respiratory burst J. Biol. Chem. 265,15577-15583[Abstract/Free Full Text]
- Kleinberg, M. E., Mital, D., Rotrosen, D., Malech, H. L. (1992) Characterization of a phagocyte cytochrome b558 91-kilodalton subunit functional domain: identification of peptide sequence and amino acids essential for activity Biochemistry 31,2686-2690[CrossRef][Medline]
- Nakanishi, A., Imajoh-Ohmi, S., Fujinawa, T., Kikuchi, H., Kanegasaki, S. (1992) Direct evidence for interaction between COOH-terminal regions of cytochrome b558 subunits and cytosolic 47-kDa protein during activation of an O(2)-generating system in neutrophils J. Biol. Chem. 267,19072-19074[Abstract/Free Full Text]
- DeLeo, F. R., Yu, L., Burritt, J. B., Loetterle, L. R., Bond, C. W., Jesaitis, A. J., Quinn, M. T. (1995) Mapping sites of interaction of p47phox and flavocytochrome b with random-sequence peptide phage display libraries Proc. Natl. Acad. Sci. USA 92,7110-7114[Abstract/Free Full Text]
- DeLeo, F. R., Nauseef, W. M., Jesaitis, A. J., Burritt, J. B., Clark, R. A., Quinn, M. T. (1995) A domain of p47phox that interacts with human neutrophil flavocytochrome b558 J. Biol. Chem. 270,26246-26251[Abstract/Free Full Text]
- Leto, T. L., Adams, A. G., de Mendez, I. (1994) Assembly of the phagocyte NADPH oxidase: binding of Src homology 3 domains to proline-rich targets Proc. Natl. Acad. Sci. USA 91,10650-10654[Abstract/Free Full Text]
- Groemping, Y., Lapouge, K., Smerdon, S. J., Rittinger, K. (2003) Molecular basis of phosphorylation-induced activation of the NADPH oxidase Cell 113,343-355[CrossRef][Medline]
- Hazan-Halevy, I., Levy, T., Wolak, T., Lubarsky, I., Levy, R., Paran, E. (2005) Stimulation of NADPH oxidase by angiotensin II in human neutrophils is mediated by ERK, p38 MAP-kinase and cytosolic phospholipase A2 J. Hypertens. 23,1183-1190[Medline]
- Henderson, L. M., Thomas, S., Banting, G., Chappell, J. B. (1997) The arachidonate-activatable, NADPH oxidase-associated H+ channel is contained within the multi-membrane-spanning N-terminal region of gp91phox Biochem. J. 325,701-705
- Doussiere, J., Poinas, A., Blais, C., Vignais, P. V. (1998) Phenylarsine oxide as an inhibitor of the activation of the neutrophil NADPH oxidaseidentification of the ß subunit of the flavocytochrome b component of the NADPH oxidase as a target site for phenylarsine oxide by photoaffinity labeling and photoinactivation Eur. J. Biochem. 251,649-658[Medline]
- Doussiere, J., Bouzidi, F., Poinas, A., Gaillard, J., Vignais, P. V. (1999) Kinetic study of the activation of the neutrophil NADPH oxidase by arachidonic acid. Antagonistic effects of arachidonic acid and phenylarsine oxide Biochemistry 38,16394-16406[CrossRef][Medline]
- Doussiere, J., Gaillard, J., Vignais, P. V. (1999) The heme component of the neutrophil NADPH oxidase complex is a target for aryliodonium compounds Biochemistry 38,3694-3703[CrossRef][Medline]
- Doussiere, J., Bouzidi, F., Vignais, P. V. (2001) A phenylarsine oxide-binding protein of neutrophil cytosol, which belongs to the S100 family, potentiates NADPH oxidase activation Biochem. Biophys. Res. Commun. 285,1317-1320[CrossRef][Medline]
- Cross, A. R., Erickson, R. W., Curnutte, J. T. (1999) Simultaneous presence of p47phox and flavocytochrome b-245 are required for the activation of NADPH oxidase by anionic amphiphiles. Evidence for an intermediate state of oxidase activation J. Biol. Chem. 274,15519-15525[Abstract/Free Full Text]
- Paclet, M. H., Coleman, A. W., Vergnaud, S., Morel, F. (2000) p67phox-mediated NADPH oxidase assembly: imaging of cytochrome b558 liposomes by atomic force microscopy Biochemistry 39,9302-9310[CrossRef][Medline]
- Foubert, T. R., Burritt, J. B., Taylor, R. M., Jesaitis, A. J. (2002) Structural changes are induced in human neutrophil cytochrome b by NADPH oxidase activators, LDS, SDS, and arachidonate: intermolecular resonance energy transfer between trisulfopyrenyl-wheat germ agglutinin and cytochrome b558 Biochim. Biophys. Acta 1567,221-231[Medline]