Published online before print May 2, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



Divisions of
* Clinical Neurology and
Molecular and Clinical Immunology and
School of Pharmacy, University of Nottingham, United Kingdom
1 Correspondence: Division of Clinical Neurology, Queens Medical Centre, Medical School, University of Nottingham, UK, NG7 2UH. E-mail: cris.constantinescu{at}nottingham.ac.uk
|
|
|---|
. IFN-ß increases the expression of the anti-inflammatory cytokine IL-10 and suppresses IL-12. Signaling pathways through IFN-ß and the IL-12 receptor (IL-12R) involve activation by phosphorylation of signal transducer and activator of transcription 4 (STAT4). Our aim was to investigate the effects of dexamethasone on STAT4 activation by IFN-ß and IL-12 in human T cell blasts. We report that dexamethasone decreases IL-12-induced STAT4 phosphorylation and IFN-
production and enhances IFN-ß-induced STAT4 activation and IL-10 production. These effects are associated with a down-regulation of IL-12Rß1 expression but an up-regulation of IFN-ßR. These results indicate that the effect of glucocorticoids on the STAT4 signaling pathway depends on the stimulus activating that pathway.
Key Words: modulation signal transduction
|
|
|---|
(IFN-
). Previous studies have indicated that although IL-12 exerts effects that are independent of IFN-
, induction of Th1 cells is reduced when IFN-
is blocked [6
]. IL-12 is known to act via the signal transducer and activation of transcription 4 (STAT4) signaling pathway. Signal transduction through the IL-12 receptor (IL-12R) induces tyrosine phosphorylation of the Janus family kinases (JAK2) and tyrosine kinase 2 (TYK2), which in turn, phosphorylates STAT4 [7
]. Phosphorylated STAT4 (pSTAT4) dimerizes, translocates to the nucleus, and instigates DNA transcription [8
]. Although it is clear that the differentiation of Th1 cells is crucial for an effective immunity to a wide variety of intracellular pathogens, Th1 cells and IL-12 may also contribute to the pathogenesis of a variety of immune-mediated, inflammatory disorders including multiple sclerosis (MS) and rheumatoid arthritis [9
]. IL-23 is a heterodimeric cytokine of the IL-12 family. It is similar to IL-12 in that it shares the same heavy-chain p40 subunit. It is however covalently linked, not to the IL-12 p35 subunit but to a p19 subunit [10 ]. IL-23 signals through its own receptor complex, which is composed of the IL-12Rß1 chain and a gp130-like chain. Also similar to IL-12, IL-23, through its receptor, activates Tyk2, Jak2, STAT3, and STAT4 [11 ]. The type I interferon, IFN-ß, is the best-characterized and most-used disease-modifying treatment for MS. Its beneficial effects in MS are attributed to its ability to suppress IL-12 [12 ]. It has also been demonstrated that IFN-ß significantly increases the expression of the anti-inflammatory cytokine IL-10 [13 ], a major suppressor of cytokine production by Th1 cells [14 , 15 ]. Conversely, type I IFNs, including IFN-ß, are known to have a number of proinflammatory effects and to induce glucocorticoid-suppressible genes. IL-12 and IFN-ß are often considered to have biologically opposing effects; however, IFN-ß also acts via the STAT4 pathway. Glucocorticoids suppress a variety of immune responses [16 ], and it is important to establish whether glucocorticoids such as dexamethasone can inhibit some of the beneficial effects of IFN-ß, especially as these two agents may be used in combination in medical treatment. Alternatively, some immunologic effects of glucocorticoids and IFN-ß may be synergistic, which may indicate that such combined treatment may be beneficial. In this study, we investigated whether the inhibitory effects of dexamethasone were specific to IL-12 or whether similar effects would be observed with IFN-ß. Here, we report that dexamethasone has a differential effect on IL-12 and IFN-ß, not only through differential effects on STAT4 phosphorylation but also upstream at the receptor level. This in turn results in a differential modulation on the level of cytokine induction by IFN-ß and IL-12.
|
|
|---|
(PeproTech EC, London, UK), IFN-ß (Rebif®, a gift of Dr. Paul Byrne, Serono, London, UK), polyclonal rabbit anti-STAT4 antibody, polyclonal rabbit antiphospho-STAT4 antibody, mouse monoclonal anti-STAT1, mouse monoclonal antiphospho-STAT1 (Zymed Laboratories Inc., San Francisco, CA), and rabbit polyclonal anti-c-Jun (D) antibody (Santa Cruz Biotechnology, Inc., CA). Monoclonal anti-human CD3 phycoerythrin (PE) antibody, monoclonal anti-human IFN receptor (IFNAR) 1 antibody, monoclonal anti-human IFN-
fluorescein isothiocyanate (FITC) antibody, and monoclonal anti-human IL-12Rß1 PE antibody and rhIL-23 were purchased from R&D Systems (Oxford, UK). Purified rat anti-human monoclonal IL-12Rß2 antibody was purchased from BD PharMingen (San Diego, CA). Monoclonal anti-human IL-10 PE antibody, goat anti-mouse FITC secondary antibody, goat anti-rabbit PE secondary antibody, and goat anti-rat PE secondary antibody were purchased from Caltag Laboratories (S. San Francisco, CA). IFN-
and IL-10 solid-phase sandwich enzyme-linked immunosorbent assays (ELISAs) were purchased from BD PharMingen (BD OptEIATM, BD Biosciences, Oxford, UK). The reporter construct, plasmid pINFGRE-enhanced green fluorescent protein (GFP) containing the promoter region of the human IFN-
gene (347 to +2) inserted into the basic vector PGL3, was kindly provided by Shoikiro Miyatake (Tokyo Metropolitan Institute of Medical Science, Japan). The reporter construct, plasmid pIL10RE-luciferase, containing the promoter region of the human IL-10 gene (890 to +120) cloned into the basic vector PGL3, was kindly donated by Ashok Kumar (University of Ottawa, Ontario, Canada).
Cell preparation
Peripheral blood mononuclear cells (PBMC) from healthy donors were isolated by standard gradient centrifugation with Histopaque 1077 (Sigma-Aldrich, Dorset, UK). The mononuclear cells were prepared at 1 x 106 cells/ml in media consisting of RPMI 1640, 2 mM glutamine, 20 mM Hepes, 0.1 mg/ml penicillin, streptomycin, and 10% fetal calf serum (FCS; Sigma-Aldrich). The cells were cocultured with 10 µg/ml phytohemagglutinin (PHA; Sigma-Aldrich) at 37°C and 5% CO2 for 72 h. Following PHA-induced proliferation, the cells were washed with media and stimulated with 100 U/ml IL-2 (R&D Systems, Minneapolis, MN) at 37°C and 5% CO2 for a further 24 h. The cells were then allowed to rest for 24 h in serum-free media under the same conditions.
PBMC-derived CD3+ cells were isolated by fluorescein-activated cell sorter (FACS) sorting, PBMC cells were washed by centrifugation in 2% FCS RPMI, the supernatant was poured off, and the cells were resuspended in the residue, to which 10 µl monoclonal anti-human CD3 PE-labeled antibody was added and incubated on ice for 30 min. The cells were washed again by centrifugation in 2% FCS RPMI. Cells were sorted in 1 ml 10% FCS RPMI and left overnight in fresh media until stimulation.
Cell stimulation
PHA/IL-2-induced T cell blasts (1x106cells/ml) were left untreated or pretreated with 100 ng/ml dexamethasone (Sigma-Aldrich) for 30 min at 37°C. Both sets of cells were then left unstimulated or incubated with 10 ng/ml IFN-ß, 10 ng/ml IFN-
, or 0.1 µg/ml IL-12 for 30 min at 37°C. The method used was refined so that the optimum concentrations of cytokines were used. Varying concentrations of IFN-ß, IFN-
, and IL-12 were analyzed for their effect on STAT4 phosphorylation; the concentrations used in this experiment were those that produced the peak pSTAT4 value. The length of stimulation on STAT4 phosphorylation was also observed. The results generated suggested that the best stimulation was achieved after 30 min. For flow cytometry and ELISA analysis, cells were pretreated with dexamethasone for 30 min and 18 h, respectively.
Intracellular staining
Following incubation, the cells were fixed in 1 ml ice-cold 70% ethanol and incubated on ice for 20 min. The cells were then washed by centrifugation once in phosphate-buffered saline (PBS), 0.5% bovine serum albumin, and 1% sodium azide (PBA; Sigma-Aldrich), once in saponin buffer [PBA+0.1% saponin (Sigma-Aldrich)], and once in 10% FCS in saponin buffer at 300 g for 5 min. The supernatant was poured off, and the cells were resuspended in the residue, to which 0.5 µg of the primary antibody, rabbit polyclonal anti-STAT4 or rabbit polyclonal antiphospho-STAT4 (tyrosine-phosphorylated site Y693), mouse monoclonal anti-STAT1 or mouse monoclonal antiphospho-STAT1 (tyrosine-phosphorylated site Y701; Zymed Laboratories Inc.; method adapted for intracellular staining specific for STAT4 and phosphorylated STAT4, described by Uzel et al. [17
]) and 10 µl monoclonal anti-human IFN-
FITC antibody, monoclonal anti-human IL-10 PE, or rabbit polyclonal anti c-Jun (D) were added and incubated at room temperature for 30 min. Following incubation, the cells were washed by centrifugation with saponin buffer, and those cells incubated with nonconjugated primary antibodies (rabbit polyclonal anti-STAT4, antiphosphorylated STAT4, rabbit polyclonal c-Jun, and mouse monoclonal anti-STAT1 and antiphospho-STAT1) were incubated with the secondary antibody, 1 µg PE-conjugated goat anti-rabbit immunoglobulin G (IgG) or 1 µg FITC-conjugated goat anti-mouse IgG, respectively, for 30 min at room temperature. All cells were washed with 1 ml saponin buffer before resuspension in 500 µl 0.5% formaldehyde for flow cytometry or immunofluorescence.
Surface staining
Following incubation with IFN-ß or IL-12, the cells were washed by centrifugation in 2% FCS RPMI, the supernatant was poured off, and the cells were resuspended in the residue, to which 10 µl IFNAR 1, IL-12Rß1 PE-labeled, or IL-12ß2 antibodies were added and incubated on ice for 30 min. The cells were washed again by centrifugation in 2% FCS RPMI. Those cells incubated with nonconjugated primary antibodies (IFNAR and IL-12Rß2) were incubated with the secondary antibody (5 µl goat anti-mouse FITC and goat anti-rat PE, respectively) and incubated for a further 30 min on ice. All cells were washed twice in 1 ml 2% FCS RPMI before resuspension in 500 µl 0.5% formaldehyde for flow cytometry.
Cytokine assay using ELISA
PHA/IL-2-induced T cell blasts (1x106cells/ml) were left untreated or pretreated with 100 ng/ml dexamethasone (Sigma-Aldrich) for 18 h at 37°C. Both sets of cells were then left unstimulated or incubated with 10 ng/ml IFN-ß, 0.1 µg/ml IL-12, or 0.1 µg/ml IL-23 for a further 18 h at 37°C. The cell supernatants were removed for cytokine assay. IFN-
and IL-10 levels were measured using a solid-phase sandwich ELISA purchased from BD PharMingen (BD OptEIATM BD Biosciences) and were performed following the manufacturers instructions.
Immunofluorescence
To visualize intracellular staining by indirect immunofluorescence, cells were centrifuged onto a microscope slide at 500 g for 5 min using Cytospin4 (ThermoShandon, UK). DNA was stained with 0.5 µg/ml Hoechst 33258 (Sigma-Aldrich), and cells were viewed with a confocal laser-scanning microscope (LSM; Zeiss LSM510 Meta). Images were taken with a 63x objective (NA 1.4), PE was excited with the 543-nm laser, and detection settings were kept constant between conditions to compare fluorescence intensities. LSM images were exported as tiffs and assembled using Adobe Photoshop.
Quantitative real-time polymerase chain reaction (PCR)
Quantitative real-time reverse transcriptase (RT)-PCR was used to assess IL-10 mRNA abundance in human PHA/IL-2 T cell blasts that had been stimulated with dexamethasone and/or IFN-ß. RNA was extracted using the RNeasy miniprep kit (Qiagen, Valencia, CA) following the manufacturers instructions. The RNA concentration was determined at 260 nm, and purity was assessed by measuring the 260/280-nm ratio. Only samples within a 1.701.95 range were used. First-strand cDNA synthesis was initiated from 0.5 µg total RNA using random hexamers (Promega, Madison, WI) and avian myeloblastosis virus RT (Promega) using conditions as described by the manufacturer in a final volume of 25 µl. Specific oligonucleotide primers were designed for the published sequence BC104253 [18
]. The IL-10 primers used were as follows: forward 5' CAACCTGCCTAACATGCTTC 3'; reverse 5' GGACTCCTTTAACAACAAGTTG 3'. All real-time PCR was carried out using the SYBR Green fluorescence method with SYBR Green qPCR Master Mix (Stratagene, La Jolla, CA) as specified by the manufacturer. The real-time PCR reactions were carried out in triplicate on a MX4000® Multiplex Quantitative qPCR system (Stratagene) using standard default thermal cycling conditions. Nontemplate controls were loaded in triplicate and were prepared by replacing the cDNA fraction of the PCR reaction with an equivalent volume of nuclease-free water. Quantification of transcripts was carried out using the relative standard curve method as described by Applied Biosystems [19
]. An equal aliquot of undiluted cDNA from each sample was pooled together. This cDNA pool was serially diluted (neat, 1:10, 1:100, 1:1000) to produce a set of standards, from which the comparative threshold cycle value (cycle number at which the reporter dye emission intensity rises above background noise) of a particular variant could be converted to nanograms of total RNA equivalent, used for first-strand synthesis.
Transient transfection of Jurkat cells and reporter assay
IFN-
promoter
The reporter construct pIFNGRE-eGFP, containing the promoter region of the human IFN-
gene (374 to +2), was kindly donated by O. Kaminuma [20
]. Transfection of Jurkat Tag cells (1x107/condition) was performed in triplicate by electroporation (250 V, 960 µF) with 15 µg reporter construct and 3 µg pEF-BOS, a plasmid encoding ß-galactosidase in 400 µl PBS. Cells were left on ice for 15 min before being added to 1 ml 10% FCS RPMI, supplemented with 1% glutamine, and incubated at 37°C overnight. Following the incubation, transfected cells were left untreated or pretreated with 100 ng/ml dexamethasone (Sigma-Aldrich) for 8 h at 37°C. Both sets of cells were then left unstimulated or incubated with 0.1 µg/ml IL-12 for a further 12 h at 37°C. After stimulation, cells were harvested, and the fluorescence of synthetic eGFP in the transfected cells was measured by flow cytometry using an Epics XL flow cytometer (Beckman Coulter, Fullerton, CA), and the results were analyzed using the computer software WINMDI 2.8.
Transient transfection of Jurkat cells and measurement of luciferase activity
IL-10 promoter
The reporter construct IL10RE-luciferase, containing the promoter region of the human IL-10 gene, was kindly donated by A. Kumar [21
]. Transfection of Jurkat Tag cells (1x107/condition) was performed in triplicate by electroporation (250 V, 960 µF) with 12 µg promoter reporter construct and 3 µg pEF-Bos in 400 µl PBS. Cells were left on ice for 15 min before being added to 1 ml 10% FCS RPMI, supplemented with 1% glutamine, and incubated at 37°C overnight. Following the incubation, transfected cells were left untreated or pretreated with 100 ng/ml dexamethasone (Sigma-Aldrich) for 8 h at 37°C. Both sets of cells were then left unstimulated or incubated with 0.1 µg/ml IFN-ß for a further 8 h at 37°C. Cells were harvested in 50 µl lysis buffer (Dual Light system kit, Applied Biosystems, Foster City, CA), and then 5 µl extract was assayed for luciferase and ß-galactosidase activity in duplicate using a 96-well Orion plate reader (Becton Dickinson, San Jose, CA). ß-Galactosidase activity was used to normalize the results. Reporter activation is shown as the fold induction over control values, i.e., the reporter activity in the absence of treatment. The results shown are averages of two experiments performed in triplicate, and the error bars indicate the standard deviation.
Measurements
The PHA/IL-2 blasts were evaluated following antibody staining on an Epics XL flow cytometer (Beckman Coulter), and the results were analyzed using the computer software WINMDI 2.8. Each experiment was repeated five times, using five independent donors (see Table 1
). IFN-
and IL-10 levels were also measured using a solid-phase sandwich ELISA. Statistical analysis was performed using the Friedman nonparametric test for multiple-related groups. If a significant value was obtained (P<0.05), further statistical analysis was carried out on the data. To compare between paired groups, the Wilcoxon test was preformed. Jurkat cells transfected with the IFN-
construct were evaluated on an Epics XL flow cytometer (Beckman Coulter), and the results were analyzed using the computer software WINMDI 2.8. For the IL-10 promoter, luciferase activity was normalized for ß-galactosidase activity to give relative luciferase units (RLU). The results shown are a mean ± SD of two experiments performed in triplicate and normalized for ß-galactosidase activity.
|
View this table: [in a new window] |
Table 1. pSTAT4 Induction by IL-12, IFN-ß, and IFN- with or without Prior Exposure to Dexamethasone and Dexamethasone Plus RU486
|
|
|
|---|
and enhances IFN-ß-induced IL-10
is important in the generation of a cell-mediated immune response. In this study, increased IFN-
production by IL-12 in human T cells was observed; however, pretreatment of these cells with dexamethasone reduced this induction (Fig. 1B)
. Again, these results were confirmed using ELISA (Fig. 2A)
. The duration of exposure of the cells to dexamethasone was 30 min in the experiments shown (except for the ELISA, where the duration of exposure was 18 h). Similar results were obtained after exposing the cells to dexamethasone for 18 h (data not shown).
![]() View larger version (21K): [in a new window] |
Figure 1. IFN-ß (10 ng/ml) induces IL-10 production in human T cells (n=5; shaded curve in A). IL-10 production is enhanced by prior exposure of the cells to dexamethasone (A). IL-12 (0.1 µg/ml) induces IFN- production in human T cells (n=5; shaded curve in B); pretreatment with dexamethasone (100 ng/ml) reduces this induction (B). Dotted lines represent unstimulated cells.
|
![]() View larger version (20K): [in a new window] |
Figure 2. IFN- and IL-10 levels were measured using a solid-phase sandwich ELISA. Bars denote the median value, and error bars represent range. IL-12 (0.1 µg/ml) and IL-23 (0.1 µg/ml) induce IFN- production in human T cells (A). Pretreatment of these cells with dexamethasone (100 ng/ml) reduces this induction. No change is observed with IFN-ß (10 ng/ml) and IL-23 (0.1 µg/ml), which induce IL-10 production in human T cells (B). IL-10 production is enhanced by prior exposure to dexamethasone. No change is observed with IL-12. The duration of exposure of the cells to IFN-ß, IL-12, IL-23, and dexamethasone was 18 h.
|
![]() View larger version (11K): [in a new window] |
Figure 3. Quantitative real-time RT-PCR was used to assess IL-10 mRNA abundance in human PHA/IL-2 T cell blasts, which had been stimulated with dexamethasone and/or IFN-ß, and IFN-ß stimulation increased IL-10 mRNA production compared with unstimulated cells, an induction that was enhanced by prior treatment of the cells with dexamethasone.
|
will induce STAT4 phosphorylation [22
]. We next examined the effect of dexamethasone pretreatment on IFN-
-induced STAT4 phosphorylation to assess whether the inhibiting/enhancing effects of dexamethasone were specific to IL-12 or IFN-ß, respectively. We observed that IFN-
-induced STAT4 phosphorylation was also inhibited by dexamethasone, consistent with previous reports [4
] (Table 1)
. The duration of exposure of the cells to dexamethasone was 30 min in the experiments shown. Similar results were obtained after exposing the cells to dexamethasone for 18 h (data not shown). All these effects are mediated by the glucocorticoid receptor as RU486 (100 ng/ml), as a glucocorticoid receptor antagonist eliminated the effects observed after prior stimulation with dexamethasone (Table 1)
. The results are the medians and ranges from five independent experiments. These differences were statistically significant (P<0.05). The results for IFN- or IL-12-stimulated cells without dexamethasone and with dexamethasone plus RU486 were not statistically significant (P>0.05). Dexamethasone appeared to have no significant effect on total STAT4 expression (data not shown).
![]() View larger version (16K): [in a new window] |
Figure 4. pSTAT4 in human PBMC-derived PHA/IL-2 T cell blasts. Cells were left unstimulated (shaded curves on each graph) or incubated with 10 ng/ml IFN-ß (A) or 0.1 µg/ml IL-12 (B) for 30 min at 37°C. IL-12 and IFN-ß increased pSTAT4 generation compared with unstimulated cells.
|
![]() View larger version (15K): [in a new window] |
Figure 5. pSTAT4 in human PBMC-derived PHA/IL-2 T cells blasts. Cells were left untreated (shaded curves) or pretreated with 100 ng/ml dexamethasone for 30 min at 37°C. Both sets of cells were incubated with 10 ng/ml IFN-ß or 0.1 µg/ml IL-12 for 30 min at 37°C. Pretreatment with dexamethasone followed by IFN-ß results in increased pSTAT4 (A); incubation with dexamethasone and then IL-12 results in decreased pSTAT4 (B).
|
![]() View larger version (22K): [in a new window] |
Figure 6. pSTAT4 in CD3+ cells. Sorted CD3+ cells were left untreated (shaded curves) or pretreated with 100 ng/ml dexamethasone for 30 min at 37°C. Both sets of cells were incubated with 10 ng/ml IFN-ß or 0.1 µg/ml IL-12 for 30 min at 37°C. Pretreatment with dexamethasone followed by IFN-ß results in increased pSTAT4. (A) Incubation with dexamethasone and then IL-12 resulted in decreased pSTAT4 generation (B).
|
![]() View larger version (110K): [in a new window] |
Figure 7. The pSTAT4 and activated protein 1 (AP-1) staining was observed and analyzed on a Zeiss confocal LSM. (A) Incubation with dexamethasone and then IFN-ß resulted in an increase in pSTAT4 generation, and prior treatment with dexamethasone followed by IL-12 resulted in a decrease in pSTAT4 generation. (B) IL-12 and IFN-ß resulted in increased AP-1 staining when compared with unstimulated cells; greater staining was observed for cells stimulated with IL-12 compared with IFN-ß. Prior stimulation with dexamethasone followed by IFN-ß resulted in similar AP-1 staining when compared with cells incubated with IFN-ß alone. However, prior treatment with dexamethasone and then IL-12 resulted in reduced AP-1 when compared with cells stimulated with IL-12 alone.
|
and IFN-ß
and -ß also signal via STAT1, and therefore, we next investigated the activation of STAT1 by IFN-
or -ß and its modulation by dexamethasone. IFN-
and IFN-ß stimulation resulted in increased pSTAT1 generation when compared with unstimulated cells (Fig. 8
); however, no significant difference in total STAT1 expression was observed. Dexamethasone alone had no effect on pSTAT1 generation. Prior stimulation with dexamethasone and then IFN-
increased pSTAT1 generation when compared with cells stimulated with IFN-
alone (P<0.05; see Fig. 8
). Prior incubation with dexamethasone and then IFN-ß, however, resulted in similar pSTAT1 (Fig. 8)
generation when compared with cells incubated with IFN-ß alone.
![]() View larger version (17K): [in a new window] |
Figure 8. Activation and modulation of STAT1. PBMCs were left unstimulated or incubated with 10 ng/ml IFN-ß or 10 ng/ml IFN- for 30 min at 37°C. IFN- and IFN-ß increased pSTAT1 generation compared with unstimulated (US) cells. Prior incubation with dexamethasone and then IFN-ß did not affect pSTAT1 generation, and prior stimulation with dexamethasone followed by incubation with IFN- resulted in an increase in pSTAT1 generation (P<0.05).
|
![]() View larger version (18K): [in a new window] |
Figure 9. Dexamethasone (100 ng/ml) increases IFN-ßR expression (A). Dexamethasone (100 ng/ml) decreases the IL-12Rß1 expression (B) and increases IL-12Rß2 expression (see Table 2
).
|
|
View this table: [in a new window] |
Table 2. Prior Exposure to Dexamethasone, IFN-ß, and IFN- Increases IL-12Rß2 Expression in Human T Cell Blasts
|
production in PHA/IL-2 T cell blasts. However, pretreatment of these cells with dexamethasone reduced this induction significantly (Fig. 2A)
. We also examined whether dexamethasone affected IL-23-induced STAT4 phosphorylation. As shown in Figure 7
, exposure to IL-23 resulted in increased pSTAT4 induction when compared with unstimulated cells. However, pretreatment of the cells with dexamethasone followed by IL-23 resulted in a decrease in pSTAT4 generation (Fig. 10
). We also observed up-regulation of IL-10 production by IL-23, which was enhanced by prior treatment of the cells with dexamethasone (Fig. 2B)
.
![]() View larger version (23K): [in a new window] |
Figure 10. pSTAT4 in human PBMC-derived PHA/IL-2 T cells blasts. Cells were left untreated (unfilled curve) or pretreated with 100 ng/ml dexamethasone for 30 min at 37°C. Both sets of cells were incubated 0.1 µg/ml IL-23 for 30 min at 37°C. Pretreatment with IL-23 results in increased pSTAT4 generation. Pretreatment with dexamethasone reduces this induction (shaded curve). Dotted line represents unstimulated cells.
|
and IL-10 promoter expression
was a result of the inhibition of gene transcription, the effect of dexamethasone and IL-12 on promoter activity of the human IFN-
gene was analyzed. Jurkat Tag cells that had been transiently transfected with the IFN-
promoter/eGFP reporter construct were stimulated with dexamethasone and/or IL-12; fluorescence of synthetic eGFP was measured by flow cytometry. The IFN-
promoter was activated upon stimulation with IL-12; however, this induction was suppressed when the cells had been pretreated with dexamethasone (Fig. 11
). This is consistent with the observations already in this study, which show that dexamethasone can decrease the ability of T cells to respond to IL-12.
![]() View larger version (24K): [in a new window] |
Figure 11. Jurkat Tag cells that had been transiently transfected with the IFN- promoter/eGFP reporter construct were left untreated or stimulated with 100 ng/ml dexamethasone for 30 min at 37°C. Both sets of cells were incubated with 0.1 µg/ml IL-12 for 30 min at 37°C; fluorescence of synthetic eGFP was measured by flow cytometry. The IFN- promoter was activated upon stimulation with IL-12 (unfilled curve); pretreatment with dexamethasone suppressed this induction (filled curve). Dotted line represents unstimulated cells.
|
and IL-10.
![]() View larger version (16K): [in a new window] |
Figure 12. Jurkat Tag cells that had been transiently transfected with the IL-10 promoter/luciferase reporter construct were left untreated or stimulated with 100 ng/ml dexamethasone for 30 min at 37°C. Both sets of cells were incubated with 0.1 µg/ml IFN-ß for 30 min at 37°C; following which, relative luciferase activity was assessed. The data were normalized relative to ß-galactosidase activities in the same extracts and expressed as RLU. Reporter activities are expressed as fold induction of the normalized luciferase activity relative to that as a result of the reporter alone in the absence of ligand (i.e., unstimulated). Luciferase activity increased 1.4-fold and 2.1-fold when stimulated with IFN-ß or dexamethasone, respectively, relative to unstimulated cells. Pretreatment with dexamethasone and then IFN-ß increased the IL-10 promoter activity further (2.4-fold higher than unstimulated cells).
|
promoter to synergistically enhance IFN-
mRNA expression induced by IL-12 and IL-18 [23
]. Here, we investigated the effect of IFN-ß or IL-12 on the level of c-Jun, (a component of AP-1) expression and whether dexamethasone also exerts its effects on AP-1 induction. IL-12 and IFN-ß resulted in increased AP-1 staining when compared with unstimulated cells; greater staining, however, was observed for cells stimulated with IL-12 compared with IFN-ß (Fig. 7B)
. Prior stimulation with dexamethasone followed by IFN-ß resulted in similar AP-1 staining when compared with cells incubated with IFN-ß alone (Fig. 7B)
. However, prior treatment with dexamethasone and then IL-12 resulted in reduced AP-1 when compared with cells stimulated with IL-12 alone (Fig. 7B)
. The results suggest that AP-1 is not involved in the modulation of IFN-ß-induced STAT4 activation by dexamethasone; however, it may play a role in IL-12-induced STAT4 activation. We have already shown that pretreatment with dexamethasone can reduce IL-12-induced IFN-
production and its ability to activate STAT4 and have shown a reduction in IFN-
promoter activity. Here, we observe a reduction in c-Jun staining, which could link the decreased activation of transcription to a reduction in the level of AP-1 recruitment by STAT4. |
|
|---|
, and tumor necrosis factor/lymphotoxin
, whereas Th2 cells produce IL-5, IL-4, and IL-10 [24
]. Cytokines produced by each Th cell subset are inhibitory for the opposite subset [25
]. IFN-
and IL-10 antagonize each other. In this study, we determined the effect of dexamethasone on the IFN-
induction by IL-12 and on the IFN-ß-induced IL-10.
IL-12 is the major cytokine that induces the development of Th1 cells. Many effects associated with IL-12 are attributable to the induction of IFN-
[26
]. Although first characterized based on its potent antiviral functions, IFN-ß also has a variety of immunoregulatory effects [27
] and has been shown to increase significantly the expression of the anti-inflammatory cytokine IL-10 [13
].
IFN-
is a potent activator of macrophages and monocytes and induces a variety of inflammatory mediators in these cells. IL-10 is potent suppressor of several effector functions of macrophages, T cells, and natural killer cells. From an immunotherapeutic perspective, an important property of IL-10 is its capacity to inhibit Th1 cells [28
]. The inhibition of the Th1 cell pathway by IL-10 is mediated by several mechanisms, including inhibition of IL-12 production by antigen-presenting cells and blocking of IFN-
synthesis by differentiated Th1 cells [29
].
Glucocorticoids modulate cytokine production in lymphocytes, and several studies have shown that the type of modulation is dependent on the T cell phenotype [3
, 16
]. We found that prior treatment with dexamethasone enhanced IFN-ß-induced IL-10 production (an anti-inflammatory cytokine), and the induction of IFN-
(a proinflammatory cytokine) by IL-12 in human T cells was reduced by pretreatment with dexamethasone.
The action of IFN-ß is still not fully understood, and its effects appear to be contradictory, as it has been seen to enhance and inhibit inflammatory responses. IFN-ß has the ability to inhibit IL-12 induction and block its downstream effects [27
]; conversely, it increases the induction of the IL-12Rß2 [30
]. IFN-ß is of therapeutic value in the treatment of MS, as measured by reduced relapse frequency, delayed disease progression, and demyelinating plaque formation [31
]. It is thought that the beneficial effect of IFN-ß in MS is a result of the induction of a protective Th2 immune response or by the inhibition of an ongoing, detrimental Th1 response. However, type I IFNs, including IFN-ß, have also been implicated in Th1 development [32
] and have several proinflammatory effects, which include increasing the number of IFN-
-secreting cells and enhancing T cell IFN-
responses [33
]. Conversely, other evidence supports opposite effects of IFN-ß, such as reduction of IFN-
production [13
, 30
, 34
, 35
]. It is most interesting perhaps that IL-12 and IFN-ß signal through the STAT4 pathway, a key signaling pathway for Th1 responses. Mice deficient for STAT4 have dramatically diminished responses to IL-12 and show impaired Th1 [36
, 37
] but enhanced Th2 differentiation [36
]. A recent study comparing the direct action of IL-12 and IFN-
on naïve Th cell phenotype development found that IFN-
and IL-12 differed quite markedly in their potency in terms of driving Th1 cell differentiation [38
]. The authors commented that one explanation could be the difference in the kinetics of STAT4 activation by IL-12 and IFN-
. IL-12 was shown to induce a sustained signaling through STAT4 in human T cells, whereas the IFN-
response was transient.
It has been observed that glucocorticoids suppress the Th1 immune response by decreasing the ability of T cells to respond to IL-12 [4
]. As IL-12 and IFN-ß use the same signaling pathway via STAT4, it may be expected that prior treatment with dexamethasone would also decrease the ability of the T cells to respond to IFN-ß. This was not the case in this study. In fact, prior exposure to dexamethasone enhanced the IFN-ß response. Therefore, we show that dexamethasone has a differential effect on the activation of STAT4 by IL-12 and IFN-ß and appears to decrease the ability of T cells to respond to IL-12 and enhances the effect of IFN-ß on STAT4 activation. We observed that IFN-
-induced STAT4 phosphorylation was also inhibited by dexamethasone, which is consistent with previous reports [4
]. Although IFN-
and IFN-ß use the same receptor and signaling pathway, differences in their biological effects have been documented, which include the higher potency of IFN-ß in the treatment of MS and certain cancers [39
]. It is thought that these functional differences may be a result of the interaction of the IFNs with their receptor. For example, IFN-ß but not IFN-
induces the association of tyrosine-phosphorylated receptor components IFNAR1 and IFNAR2 [40
]. In addition, Tyk2-deficient cells retain partial responsiveness to IFN-ß but are completely unresponsive to IFN-
[41
]. Our results in this study have shown that the modulation of STAT1 and STAT4 by glucocorticoids is dependent on the cytokine by which their activation is induced and that this modulation is different for IFN-
and -ß. This may explain some of the differences in the biological effects of the type I IFNs.
The suppression of IFN-
by dexamethasone may be a result of a direct effect on the promoter, as it has been shown that corticoisteroids down-regulate the IFN-
promoter [42
, 43
], an effect mediated by interference with AP-1 [43
]. As in normal situations, basal production of IFN-
in the absence of a stimulus is much lower than the production induced by specific stimuli, notably IL-12, we hypothesize that dexamethasones effect on STAT4 suppression is at least an important contributing factor to the suppression of IFN-
production.
A previous study reported that IL-12R expression, as assessed by RNase protection assays, was unaffected by dexamethasone pretreatment [4
], although a decrease in IL-12-induced STAT4 phosphorylation by dexamethasone was observed. In contrast, our findings, using determination of the protein by flow cytometry, show that the differential effects of dexamethasone are also evident at the receptor level. Prior exposure to dexamethasone increased IFNAR expression and decreased the IL-12ß1R expression, although IL-12ß2R expression was increased modestly. Exposure to IL-12 alone produced the exact opposite effect; those cells stimulated only with IL-12 were observed to have an increased ß1R and decreased ß2 expression. As IL-23 also uses the IL-12ß1R chain, we examined dexamethasone effects on IL-23, which has previously been shown to induce IFN-
production and proliferation in human T lymphocytes [10
, 44
]. In our study, although modestly, IL-23 was observed to induce IFN-
production in PHA/IL-2 T cell blasts; however, pretreatment of these cells with dexamethasone reduced this induction significantly. Upon receptor engagement, IL-23 activates a pattern of intracellular signaling molecules that is similar to that of IL-12 and includes STAT4, although STAT4 activation has been reported to be substantially weaker in response to IL-23 compared with IL-12 [11
]. We examined whether dexamethasone affected IL-23-induced STAT4 phosphorylation and found that exposure to IL-23 resulted, as expected, in increased pSTAT4 generation when compared with unstimulated cells. However, pretreatment of the cells with dexamethasone followed by IL-23 resulted in a decrease in pSTAT4 generation. Up-regulation of IL-10 production by IL-23 has been reported recently [44
]. We also observed an increase in IL-10 induction by IL-23, which was enhanced by prior treatment of the cells with dexamethasone. This is an interesting observation, as it appears to show that dexamethasone can affect the induction of two different, antagonistic cytokines differentially (in this case, IFN-
and IL-10) by the same cytokine, IL-23.
The results of this study support the anti-inflammatory role of IFN-ß and association with a response characterized by increased IL-10 production at the protein and gene level and decreased IFN-
production. Glucocorticoids generally suppress the inflammatory, cellular immune response and induce a shift from Th1 to Th2 cytokine secretion; here, we show that dexamethasone enhanced the cells response to IFN-ß. Although dexamethasone followed by IFN-ß increased pSTAT4 and IL-10, it remains unclear whether the increase in IL-10 is directly a result of the increase in phosphorylated STAT4 or indirectly, through an intermediate signal. However, when observing IFN-
and IL-10 promoter activity, a potential link between the phosphorylation state of STAT4 and gene transcription was shown. A reduction/enhancement in pSTAT4 levels by dexamethasone corresponded with a suppression of the IFN-
promoter and an increase in IL-10 promoter activity, respectively.
The results from this study may also have implications for IFN-ß treatment of immune-mediated diseases such as MS, where there is an increasing tendency for synergistic combination therapies including combinations of steroids and IFN-ß. One concern when considering such treatments is that IFN-ß induces a number of steroid-responsive genes, and glucocorticoids may theoretically suppress IFN-ß-induced immunoregulatory molecule expression. Although IFN-ß is a promising drug that reduces disease activity in MS, it is no cure for the disease and only works for a subset of patients. Therefore, more refined therapies need to be designed, which may expand on the positive effects of IFN-ß. The results suggest that a combination of IFN-ß and steroids may have synergistic, immunomodulatory effects in MS. A study investigating the effect of IFN-ß and steroids on the blood brain barrier (BBB) in relapsing-remitting MS patients, as evaluated by MRI, suggested that IFN-ß prolongs the beneficial effect of steroids on the BBB by reducing the number and volume of enhancing lesions [45 ]. Previous studies have suggested that steroids may be more effective in MS patients that have been treated with IFN-ß, as IFN-ß was observed to increase the expression of glucocorticoid receptors and hence, actuate an enhanced sensitivity of the cells to the glucocorticoid [46 ]. In this study, the reverse situation also is true: Prior exposure with dexamethasone results in increased sensitivity of the cells to IFN-ß and up-regulation of its receptor expression.
Of further relevance to MS, our preliminary observations indicate that the results of these experiments can also be confirmed in T cells from patients with MS, where dexamethasone exerts the same effects on IFN-ß and IL-12 induction of cytokines, STAT4 phosphorylation, and IFN-ß and IL-12R expression (data not shown).
In vitro and in vivo experiments have led to the thought that Th1-type cytokines may be important in the pathogenesis of autoimmune diseases. Such IL-12 (and IL-23)-dependent Th cell responses have been implicated in a number of experimental autoimmune disorders including insulin-dependent diabetes mellitus [47 ] and experimental autoimmune encephalomyelitis [48 , 49 ]. Th2 cytokines are important in allergic diseases [24 ]. Understanding the mechanisms of T cell activation, inactivation, and modulation by glucocorticoids may lead to modalities for the treatment of different immune-mediated, pathological situations.
Received June 3, 2005; revised February 23, 2006; accepted March 2, 2006.
|
|
|---|
and is inhibited by transforming growth factor-ß Eur. J. Immunol. 24,793-798[Medline]
producing T cells in MS patients J. Neuroimmunol. 96,92-100[CrossRef][Medline]
promoter activity independently of binding to cis-regulatory elements FEBS Lett. 570,63-68[CrossRef][Medline]
response to viral infection Science 297,2063-2066
gene expression: IL-12-induced STAT4 contributes to IFN-
promoter activation by up-regulating the binding activity of IL-18-induced activator protein 1 J. Immunol. 168,1146-1153
and interleukin-4 J. Neuroimmunol. 111,86-92[CrossRef][Medline]
and ß as immune regulatorsa new look Immunity 14,661-664[CrossRef][Medline]
increases the frequency of interferon
-producing human CD4+ T cells J. Exp. Med. 178,1655-1663
and ß subunits of the type I interferon receptor. Interferon-ß selectively induces tyrosine phosphorylation of an
subunit-associated protein J. Biol. Chem. 269,17761-17764
and ß interferons Mol. Cell. Biol. 11,4189-4195
gene promoter by corticosteroids. Implications for inflammatory bowel diseases Ann. N. Y. Acad. Sci. 859,194-197[CrossRef][Medline]
promoter by glucocorticoids and dominant negative mutants of c-Jun J. Biol. Chem. 270,12548-12556
production by increasing the number of glucocorticoid receptors on a human monocytic cell line J. Interferon Cytokine Res. 21,133-135[CrossRef][Medline]This article has been cited by other articles:
![]() |
A. J. Fahey, R. A. Robins, and C. S. Constantinescu Reciprocal effects of IFN-{beta} and IL-12 on STAT4 activation and cytokine induction in T cells J. Leukoc. Biol., June 1, 2007; 81(6): 1562 - 1567. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||