Published online before print May 9, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



* Department of Evolutionary Immunobiology, Institute of Zoology, Jagiellonian University Krakow, Poland;
Department of Physiotherapy, Faculty of Anatomy, Academy of Physical Education, Krakow, Poland;
Department of Molecular Cell Biology, Faculty of Medicine, Vrije Universiteit, Amsterdam, The Netherlands;
Laboratory of Immunobiology, Rega Institute for Medical Research, University of Leuven, Belgium; and
¶ Laboratory for Molecular Immunology, German Cancer Research Center, Heidelberg, Germany
1 Correspondence: Department of Evolutionary Immunobiology, Institute of Zoology, Jagiellonian University, ul. Ingardena 6, PL-30-060 Krakow, Poland. E-mail: kolac{at}zuk.iz.uj.edu.pl
|
|
|---|
Key Words: metalloproteinase-9 peritonitis peritoneal inflammation vasopermeability cyclooxygenase prostaglandin
|
|
|---|
(TNF-
) [3
4
5
6
7
8
]}. All of these mediators normally act through their receptors localized on vascular endothelium [9
, 10
]. The cellular sources of the mediators differ, but in the case of zymosan peritonitis, it was shown that peritoneal mast cells and macrophages co-mediate an early increase of vascular permeability by means of mast cell-histamine and PGs (e.g., PGE2), the latter being produced in a similar proportion by both cell types [3
, 4
]. However, cysteinyl-LTs of macrophage origin are the main mediators of this process [3
, 11
]. Inflammatory exudate, the result of vascular leakage/permeability, is important for diluting toxins, and it also assists in antigen elimination by providing opsonins such as antibodies and components of the complement system. Moreover, it leads to cellular infiltration, as it consists of some first-line chemoattractants [2 ]. Just minutes after release of the mediators, small gaps are formed between endothelial cells, but the underlying basement membrane forms a continuum, which may be destroyed by some enzymatic activity. Among the proteolytic enzymes, Zn2+-endopeptidases of the MMP family were shown to trigger breakdown of vascular basement membranes and degradation of extracellular matrix (ECM) macromolecules [12 , 13 ]. The MMPs are synthesized in the form of proenzymes, and tissue inhibitors of MMPs (TIMP-1 to TIMP-4) naturally control their activity [14 ]. One of the subgroups among MMPs, gelatinases, are known to process substrates such as denatured types IV and V collagen, fibronectin, elastin, and denatured interstitial collagen (gelatin) [15 16 17 ], which are components of the basement membranes and ECM, located outside the vasculature. Of the two gelatinases, MMP-2 (6575 kDa; gelatinase A) and MMP-9 (>85 kDa; gelatinase B), the former is expressed constitutively, and the latter can be induced, usually during inflammation and cancer [18 , 19 ].
Here, we show that in mice deficient in MMP-9, early vascular permeability is increased significantly, and this is a result of the enhanced production of PGE2 of cyclooxygenase 1 (COX-1) origin by peritoneal macrophages.
|
|
|---|
Some of the studies were performed on Balb/c mice, as all our previous investigations were performed on this strain [3 , 21 , 22 ], and the results from those studies led to the question about the role of Gelatinase B in zymosan peritonitis. As a contrast, the available KO mice were generated on a C57Bl/6 background genotype. However, we did not detect any significant differences in any compared innate response between Balb/c and WT C57Bl/6 mice in this study or in our previous investigations [1 , 21 ]. Furthermore, such differences were not observed between the two strains either, in case of some basic immunological parameters [23 ].
Mice were kept at a room temperature of 20 ± 2°C and a 12-h:12-h light/dark cycle. The mice were fed on a commercially pelleted diet, and tap water was available ad libitum. The animals were housed four to five mice per cage in polycarbonate cages on beddings containing dust-free, microbiologically clean, soft wood granules.
Peritonitis
Peritoneal inflammation was induced as described previously [21
, 24
]. Zymosan A (Sigma Chemical Co., St. Louis, MO) was prepared freshly (2 mg/ml) in sterile 0.9% w/v saline, and 0.5 ml was injected intraperitoneally (i.p.). At the selected time-points, animals were killed by decapitation. The peritoneal cavity was lavaged with 1 ml saline, and after 30 s, gentle, manual massage exudate was retrieved, centrifuged at 3000 g for 3 min, and frozen at 20°C prior to analysis. Cells were counted with a hemocytometer following staining with Turks solution (0.01% crystal violet in 3% acetic acid) as described previously [21
]. Mast cells were stained with safranin O (dye-specific for connective tissue mast cells; Sigma Chemical Co.), as described previously [21
].
Immunocytochemistry
Cytospin preparations of peritoneal leukocytes were fixed with a methanol:acetone mixture (1:1) and stored at 20°C until analysis. For macrophage identification, they were treated further with rat anti-mouse anti-membrane-activated complex 3 (Mac-3) monoclonal antibodies (mAb; BD Biosciences, San Jose, CA), followed by mouse anti-rat biotin-conjugated anti-immunoglobulin G (IgG) secondary antibody (BD Biosciences). Thereafter, the preparations were incubated with streptavidin-peroxidase complex (BD Biosciences), and the products of reaction were visualized with 3',3'-diaminobenzidine tetrahydrochloride (DAB; ICN International, Costa Mesa, CA), as described previously [25
]. For COX-1 detection, primary rabbit anti-mouse anti-COX-1-purified antibody (Cayman Chemicals, Ann Arbor, MI) was used, followed by secondary goat anti-rabbit IgG peroxidase-conjugated antibody (Sigma Chemical Co.). The reaction was developed with the DAB system. For COX-2 identification, the following antibodies were used: mouse anti-mouse anti-COX-2 (BD Biosciences) and purified anti-mouse IgG (BD Biosciences). Subsequently, the preparations were incubated with streptavidin-peroxidase complex (BD Biosciences), and the products of the reaction were visualized with DAB.
Vascular permeability
Evans blue was suspended in saline (10 mg/ml) and injected intravenously into the caudal vein (0.2 ml/mouse). Evans blue injection was followed immediately by i.p. injection of zymosan. Thirty minutes later, the animals were killed, and the peritoneal cavity was lavaged with 1.5 ml saline, as described above. The lavage fluid was centrifuged, and the absorbance of dye in the supernatant was measured at 620 nm with a Microplate Reader Expert Plus (ASYS Hitech, Austria) as described previously [3
, 21
].
MMP activity assay
For measurement of MMP-9, an activity assay (Amersham Biosciences, UK) was used that measures total active MMP-9 (zymogens and active forms) following activation of pro-forms by p-aminophenylmercuric acetate (APMA). The MMP-2 activity assay (Amersham Biosciences) was also used. The assays were carried out as indicated by the manufacturer.
Gelatin zymography
Zymography was performed as described before [1
]. Briefly, samples of peritoneal exudate were normalized for protein concentration. Then, the exudates were electrophoresed in 10% sodium dodecyl sulfate-polyacrylamide gels, containing 1% porcine gelatin (Sigma Chemical Co.) with nonreducing conditions. The gels were washed twice in 2.5% Triton X-100 (15 min each) and developed overnight at 37°C in incubation buffer (50 mM Tris-HCl, pH 8.0, 5 mM CaCl2, 0.02% NaN3, 1 uM ZnCl2). The gels were fixed and stained with 0.5% Coomassie brilliant blue (Sigma Chemical Co.) in acetic acid/isopropanol/distilled water 1:3:6 and then washed in equilibrating solution with 40% methanol, 10% acetic acid, and 3% glycerol (all from Sigma Chemical Co.). Protein bands with gelatinolytic activity appeared as clear lysis zones within the blue background of the gelatin gel. The degradation of gelatin was visualized under long-wave ultraviolet light. Latent and activated (by APMA treatment) forms of recombinant mouse MMP-9 (R&D Systems, Minneapolis, MN) and a prestained broad-range molecular weight standard (Bio-Rad, Hercules, CA) were used. Densitometric analysis of protein bands was performed through use of the UVISoft-UVIMap program (UVItec, Ltd., UK).
Gelatinase inhibition
Some Balb/c mice as well as MMP-9/ KO and their controls (WT) were treated i.p. with a specific peptide inhibitor of gelatinases (MMP-2 and MMP-9), cyclic CTTHWGFTLC [inhibitor (INH)], or a negative control peptide STTHWGFTLS {control (CTR); Biomol Research Laboratories, Plymouth Meeting, PA [26
]}. The peptides were administrated by a single i.p. injection of 100 µg/mouse (in 100 µl) 24 h before induction of inflammation [1
].
Mediator content
Content of the peritoneal fluid was measured by the following tests: histamine enzyme-linked immunosorbent assay (ELISA) kit (ICN Pharmaceuticals, Plan View, NY), murine (m)TNF-
ELISA kit (BioSource International, Camarillo, CA), and LTC4 and PGE2 by enzyme immunoassay kits (Cayman Chemicals). mTIMP-1 was measured by the Quantikine ELISA kit (R&D Systems). The assays were carried out as indicated by the manufacturers.
COX inhibition
Indomethacin (Sigma Chemical Co.) was dissolved with the addition of 1 N NaOH (final pH 7.4) [27
] in 5% gum arabic aqueous solution and used in a dose of 3 mg/kg [28
]. N-[-2-cyclohexyloxy]-4-nitrophenyl methanesulfonamide (NS-398; Sigma Chemical Co., 3 mg/kg) was suspended in 5% gum arabic aqueous solution [28
]. Both inhibitors were administered orally (10 ml/kg) 30 min before i.p. zymosan injection.
Cell depletion
Resident peritoneal mast cells were depleted by a single i.p. injection of compound 48/80 (Sigma Chemical Co.) in a dose of 1.2 mg/kg (100 µl/mouse), 72 h before induction of peritonitis [29
]. The successful depletion was confirmed by microscopic analysis of safranin O-positive peritoneal leukocytes collected from compound-treated and untreated mice; the treatment led to depletion of 92% and 94% mast cells for WT and KO mice, respectively. Resident peritoneal macrophages were depleted by i.p. injections of 100 µl dichloromethylene diphosphonate (Cl2MDP) liposomes for 3 consecutive days, and peritonitis was induced on Day 4 [3
, 30
]. Multilamellar liposomes containing Cl2MDP liposomes were prepared as described previously [31
]. Control mice were injected with phosphate-buffered saline liposomes or sterile saline. Cl2MDP was a gift of Roche Diagnostics GmbH (Mannheim, Germany). The successful depletion was confirmed by immunocytochemical (ICH) analysis of Mac-3-positive peritoneal leukocytes collected from Cl2MDP-treated and untreated mice; the treatment led to depletion of 89% and 88% macrophages for WT and KO mice, respectively.
Quantitative reverse transcription-polymerase chain reaction (RT-PCR) analysis
Total RNA from cells collected from intact or inflammed peritoneum was isolated using the QIAshredder and RNeasy mini kit (Qiagen, Valencia, CA). The amount and purity of the total RNA were determined by spectophotometry (GENESYS 10 UV, Thermo Electron Corp., Waltham, MA) at 260 nm. RNA was translated into single-stranded cDNA using the Superscript cDNA synthesis kit (Invitrogen, Carlsbad, CA) and random hexamers (Amersham Biosciences). Relative gene expression levels were determined using real-time PCR TaqMan technology (GeneAmp 5700 sequence detection system, Applied Biosystems, Foster City, CA) and SYBR green (Eurogentec, San Diego, CA) incorporation. The mouse hypoxanthine phosphoribosyltransferase (HPRT) gene served as an internal standard. The following mouse-specific primers (5'3') were used: MMP-9: CGGCACGCTGGAATGATC, TCGAACTTCGACACTGACAAGAA; c-kit: CTGGTTGGCCTTCCCTTGT, GAGAGATTTCCCATCACACTCGAT; COX-1: CACCAGTCAATCCCTGTTGTTACT, GGTAGTTGTCGAGGCCAAAGC; COX-2: GAACCGCATTGCCTCTGAA, TTGTTGTAGAGAAACTGTTTAAAGCTGTAC.
Statistical analysis
All values are reported as means ± SEM. Kinetic changes of each parameter were analyzed by one-way ANOVA, comparing the values recorded at the individual time-points with that at Time 0 (in intact animals). Differences between treated and control animals were analyzed by Students t-test. Differences were considered statistically significant at P
0.05.
|
|
|---|
![]() View larger version (14K): [in a new window] |
Figure 1. Vascular permeability changes and levels of gelatinases during zymosan peritonitis in Balb/c mice. Animals were i.p.-injected with 1 mg zymosan, and the kinetics of (A) vascular permeability and production of (B) gelatinase A/MMP-2 and (C) gelatinase B/MMP-9 (activity assay) in the peritoneal exudate were monitored. The presence of pro (zymogen)- and active MMP-9 was also analyzed by zymography (D). All results are shown as means ± SEM in groups of five to six mice. Mean values not sharing letters are statistically, significantly different according to ANOVA (P 0.05). O.D., Optical density.
|
Vascular permeability in mice deprived of gelatinase activity
In Balb/c mice pretreated with gelatinase inhibitor, zymosan-induced vasopermeability was elevated as compared with animals that received negative control peptide, but the difference was on a border of statistical significance (P=0.059; Fig. 2A
). In MMP-9/ mice (KO), vasopermeability was increased significantly (P=0.023) as compared with WT animals (Fig. 2B)
. When inhibitor was administrated into KO/WT mice, it did not change the pattern observed in inhibitor-untreated KO and WT animals, as vasopermeability was still elevated significantly in KO versus WT mice (P=0.02; Fig. 2C
).
![]() View larger version (11K): [in a new window] |
Figure 2. Vascular permeability changes during zymosan peritonitis in mice deprived of gelatinase B. Animals were i.p.-injected with 1 mg zymosan, and the degree of vascular permeability was estimated after 30 min; some mice were left untreated (Intact). (A) Balb/c mice pretreated with gelatinase inhibitor (INH) or control peptide (CTR); (B) MMP-9/-deficient mice (KO) and their control counterparts (WT); (C) KO mice and their WT controls pretreated with gelatinase inhibitor or control peptide. All results are shown as means ± SEM in groups of five to six mice. Some differences between WT versus KO groups are statistically significant at P 0.05 (*).
|
![]() View larger version (10K): [in a new window] |
Figure 3. Mast cell and macrophage numbers in the peritoneal cavity of intact MMP-9/-deficient mice (KO) and their control counterparts (WT). Peritoneal lavages were used for specific mast cell counting (A) and quantification of c-kit receptor expression (B) by RT-PCR. Macrophage numbers were estimated after staining with anti-Mac-3 antibody (C) on cytospin preparations. All results are shown as means ± SEM in groups of five to six mice.
|
and LTC4 were similar in KO (MMP-9/) and WT mice (Fig. 4
4B
and 4C
, respectively), and levels of PGE2 were significantly higher in KO animals (Fig. 4D)
. There was no difference in the content of the above mediators between inhibitor-treated Balb/c mice and their controls (data not shown).
![]() View larger version (11K): [in a new window] |
Figure 4. Content of vasoactive mediators in the peritoneal exudate of zymosan-injected MMP-9/-deficient mice (KO) and their control counterparts (WT). Animals were i.p.-injected with 1 mg zymosan, and contents of (A) histamine, (B) TNF- , (C) LTC4, and (D) PGE2 were monitored in the peritoneal exudate 30 min after induction of inflammation. All results are shown as means ± SEM in groups of five to six mice. Some differences between KO versus WT groups are statistically significant at P 0.05 (*).
|
![]() View larger version (8K): [in a new window] |
Figure 5. COX involvement in increased vascular permeability in MMP-9/-deficient mice (KO) and their control counterparts (WT). At 30 min post-zymosan injection, vascular permeability was assessed in mice pretreated with indomethacin (IND; nonselective COX inhibitor) or NS-398 (COX-2-selective inhibitor) (A). In addition, peritoneal cells were isolated from intact mice, and RNA encoding COX-1 was quantified (B). Results are shown as means ± SEM in groups of five to six mice. Mean values not sharing letters are statistically, significantly different according to ANOVA (P<0.05). Some differences between KO versus WT groups are statistically significant at P 0.05 (*).
|
Vascular permeability in MMP-9/ mice (KO) and their controls (WT) deprived of mast cells or macrophages
Removal of peritoneal macrophages in KO mice significantly reduced zymosan-induced vasopermeability in those animals as compared with KO mice with normal peritoneal leukocyte population, and the degree of vascular permeability was the same in KO and WT mice deprived of peritoneal macrophages (Fig. 6A
). In contrast, elimination of peritoneal mast cells did not change the pattern recorded in mice with a normal population of peritoneal leukocytes, as the vasopermeability was higher in KO than in WT animals (Fig. 6A)
.
![]() View larger version (14K): [in a new window] |
Figure 6. Impact of peritoneal cell depletion on vascular permeability changes and levels of PGE2 during zymosan peritonitis in MMP-9/-deficient mice (KO) and their control counterparts (WT). Mice were i.p.-injected with 1 mg zymosan, and after 30 min, vascular permeability (A) and PGE2 (B) levels were estimated. Before induction of peritonitis, some mice were depleted of peritoneal macrophages (Møx) or mast cells (MCx). Mice with normal peritoneal cell populations (). All results are shown as means ± SEM in groups of five to six mice. Mean values not sharing letters are statistically significantly different according to ANOVA (P 0.05). Some differences between WT versus KO groups are statistically, significant at P 0.05 (*).
|
|
|
|---|
, PGE2) [3
, 11
]. The mediators interact with vascular endothelium, leading to a formation of gaps between the endothelial cells. Also, a barrier of basement membranes must be overcome to allow vascular leakage. Here, we aimed to verify if the endopeptidase MMP-9, known to degrade components of basement membranes, is involved in the process of vascular permeability changes during the early stage of acute peritonitis. We have shown before that in the model of acute zymosan peritonitis induced in Balb/c mice, the peak of increased vascular permeability occurs as early as 30 min after stimulation [21 ]. Now, we are showing that the increased vasopermeability is accompanied by a production/release of gelatinase B (already at 15 min of inflammation) as zymogen and an active form, and levels of gelatinase A do not change significantly after zymosan injection. Furthermore, we performed studies on Balb/c mice i.p.-injected with recombinant mouse pro-MMP-9, as described before [1 ], and we observed an insignificant tendency to increase in vascular permeability (data not shown). Thus, to verify if there is a functional link between the presence of gelatinase B and its participation in the process of vascular permeability, some Balb/c mice were treated with an inhibitor of gelatinases and also gelatinase B-deficient mice (MMP-9/, KO), and their controls were used; the degree of the vasopermeability was evaluated. It turned out that in both groups of mice deprived of MMP-9, an increase of the process was detected. However, in inhibitor mice (Balb/c or C57Bl/6), this was a nonsignificant trend. As the inhibitor suppresses MMP-9 and -2 to exclude a possibility of a potential, antagonistic role for MMP-2 in the effects of MMP-9, some KO and WT mice were pretreated with inhibitor (thus, KO mice were lacking any gelatinase activity). However, no changes in the pattern observed in inhibitor-untreated KO and WT animals were observed. This indicates that there is no antagonistic role for MMP-2 in the effects of MMP-9 on vascular permeability during zymosan peritonitis, as concomitant inhibition of MMP-2 (achieved with the inhibitor) with the lack of MMP-9 in KO mice did not decrease vascular permeability to the level observed in WT mice. In this light, the effects observed in KO mice are most probably related directly to genetic deficiency in MMP-9.
Subsequent evaluation of some vasoactive mediator levels (in all cases, measured 30 min post-zymosan application) revealed strongly lowered levels of histamine in KO mice as compared with WT mice. It was reported before that mast cell precursors are able to produce MMP-9, which may be essential for mast cell migration into tissues; however, the studies were performed in an in vitro system [33
]. Moreover, it was shown that activation of the c-kit receptor, present on mast cells by the stem cell factor, led to a significant decrease in MMP-9 production of cultured mast cells [33
]. Thus, one could expect that the lack of MMP-9 will disable transmigration of mast cell precursors from the peripheral blood into local tissues (here, peritoneum), where they differentiate to their mature phenotypes. However, our evaluation of mast cell numbers in peritoneum (counting of cells after specific staining) and expression of the c-kit receptor (quantitative PCR), in intact or zymosan-stimulated mice (at 30 min of peritonitis; not shown), showed a lack of differences between KO and WT mice. At the present stage, we do not have an explanation for the decreased production/release of histamine detected in KO mice. It might be that although immature mast cells arrive normally to the tissues, some of their properties are changed. Nevertheless, levels of preformed TNF-
, which are released from mast cells at this stage of inflammation [34
], were unchanged in KO animals. It should also be underlined that despite low levels of histamine, which plays a significant role in vascular leakage in this model [3
, 21
], the vasopermeability was elevated significantly in MMP-9-deprived mice. The further search for mediators responsible for this process excluded LTC4, the first produced cysteinyl-LT, which plays the most important role in vasopermeability in zymosan peritonitis [3
, 4
], as well as vasoactive TNF-
, which is released immediately from mast cells [34
]. Finally, we found that the levels of PGE2 were threefold higher in KO than in WT mice. As aside from mast cells, peritoneal macrophages also contribute significantly to PG production at this stage of zymosan peritonitis [3
], we excluded a possibility that this is a result of the higher numbers of the leukocytes in peritoneum. Moreover, when peritoneal macrophages isolated form KO mice were stimulated in vitro with zymosan, they produced higher amounts of PGE2, and their viability and adherence were the same as in the cells of WT origin (data not shown). Furthermore, we showed that PGE2 was of COX-1 origin, as only indomethacin, and not the selective COX-2 inhibitor NS-398, attenuated vasopermeability in KO mice. We have also detected that intact KO mice are characterized by significantly higher expression of COX-1 (in terms of RNA and protein) than their control counterparts. We hypothesize that this can be associated with MMP-9 deficiency, and COX-1 products might consist of some compensatory mechanism for the lack of gelatinase B. Existing studies about the relation between COX and gelatinase B are focused on an association between COX-2 and MMP-9, as they are common nuclear factor-
B-regulated gene products (e.g., ref. [35
]), and selective COX-2 inhibitors reduce, at least partially, MMP-9 expression/release (e.g., ref. [36
]).
We also identified a cellular source responsible for the increased vascular permeability in KO mice, as depletion of peritoneal macrophages, but not mast cells, decreased it to the levels detected in WT mice. However, the production of PGE2 was not decreased in KO mice deprived of peritoneal macrophages, which indicates that the increased expression of PGE2 is not restricted to macrophages and is more general. Among other possible cellular sources of PGE2 in this particular microenvironment, the cells of peritoneal lining, endothelial and/or mesothelial cells, might be additional sources of this eicosanoid [37 , 38 ]. We also cannot exclude a possibility that some other COX-1-dependent mediators released by peritoneal macrophages comediate increased vasopermeability recorded in KO mice.
Finally, the presence of all above mediators was also investigated in inhibitor and control Balb/c mice, but no differences were detected between the two groups. Lack of impact of gelatinase inhibition on vascular permeability might indicate that MMP-9 does not participate in this process; however, it should be underlined that as specific MMP-9 inhibitors are not available, the applied product inhibits both gelatinases, and therefore, the results might be ambiguous as a result of the concomitant MMP-2 inhibition.
We conclude that genetic deficiency in gelatinase B might lead to development of a compensatory mechanism involving the COX pathway, and thus, studies about processes dependent, not only on gelatinase B but also on PGs of COX-1 origin, might be influenced by alterations in the gelatinase B load.
Received January 7, 2006; revised March 4, 2006; accepted March 21, 2006.
|
|
|---|
B by suppressing activation of I
B
kinase in human non-small cell lung carcinoma: correlation with suppression of cyclin D1, COX-2, and matrix metalloproteinase-9 Cancer Res. 64,5004-5012This article has been cited by other articles:
![]() |
E. Kolaczkowska, W. Grzybek, N. van Rooijen, H. Piccard, B. Plytycz, B. Arnold, and G. Opdenakker Neutrophil elastase activity compensates for a genetic lack of matrix metalloproteinase-9 (MMP-9) in leukocyte infiltration in a model of experimental peritonitis J. Leukoc. Biol., March 1, 2009; 85(3): 374 - 381. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Reichel, M. Rehberg, P. Bihari, C. M. Moser, S. Linder, A. Khandoga, and F. Krombach Gelatinases mediate neutrophil recruitment in vivo: evidence for stimulus specificity and a critical role in collagen IV remodeling J. Leukoc. Biol., April 1, 2008; 83(4): 864 - 874. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Albaiceta, A. Gutierrez-Fernandez, D. Parra, A. Astudillo, E. Garcia-Prieto, F. Taboada, and A. Fueyo Lack of matrix metalloproteinase-9 worsens ventilator-induced lung injury Am J Physiol Lung Cell Mol Physiol, March 1, 2008; 294(3): L535 - L543. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||