Accuri C6 Flow Cytometer System
Originally published online as doi:10.1189/jlb.1005596 on February 14, 2006

Published online before print February 14, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Erratum (v84,p329)
Right arrow All Versions of this Article:
jlb.1005596v1
79/5/963    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, H.-P.
Right arrow Articles by Chaudry, I. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, H.-P.
Right arrow Articles by Chaudry, I. H.
(Journal of Leukocyte Biology. 2006;79:963-970.)
© 2006 by Society for Leukocyte Biology

Tissue-specific expression of estrogen receptors and their role in the regulation of neutrophil infiltration in various organs following trauma-hemorrhage

Huang-Ping Yu*,{dagger}, Tomoharu Shimizu*, Ya-Ching Hsieh*, Takao Suzuki*, Mashkoor A. Choudhry*, Martin G. Schwacha* and Irshad H. Chaudry*,1

* Center for Surgical Research and Department of Surgery, University of Alabama at Birmingham; and
{dagger} Graduate Institute of Clinical Medical Sciences, Chang Gung University, Taoyuan, Taiwan, Republic of China

1Correspondence: Center for Surgical Research, University of Alabama at Birmingham, 1670 University Boulevard, Volker Hall, Room G094, Birmingham, AL 35294-0019. E-mail: Irshad.Chaudry{at}ccc.uab.edu

ABSTRACT

Although 17β-estradiol (E2) administration after trauma-hemorrhage (T-H) reduces tissue neutrophil sequestration in male rodents, it remains unknown which of the estrogen receptor (ER) subtypes mediates this effect and whether the same ER subtype is involved in all the tissues. We hypothesized that the salutary effects of E2 on attenuation of neutrophil accumulation following T-H are tissue and receptor subtype-specific. Male Sprague-Dawley rats underwent sham operation or T-H (mean blood pressure, 40 mmHg for 90 min and then resuscitation). E2 (50 µg/kg), ER-{alpha} agonist propyl pyrazole triol (PPT; 5 µg/kg), ER-β agonist diarylpropiolnitrile (DPN; 5 µg/kg), or vehicle (10% dimethyl sulfoxide) was administered subcutaneously during resuscitation. Twenty-four hours thereafter, tissue myeloperoxidase (MPO) activity (a marker of neutrophil sequestration), cytokine-induced neutrophil chemoattractant (CINC)-1, CINC-3, and intercellular adhesion molecule (ICAM)-1 levels in the liver, intestine, and lung were measured (n=6 rats/group). ER-{alpha} and ER-β mRNA levels in sham-operated rats were also determined. T-H increased MPO activity, CINC-1, CINC-3, and ICAM-1 levels in the liver, intestine, and lung. These parameters were improved significantly in rats receiving E2 after T-H. Administration of the ER-{alpha} agonist PPT but not the ER-β agonist DPN improved the measured parameters in the liver. In contrast, DPN but not PPT significantly improved these parameters in the lung. In the intestine, ER subtype specificity was not observed. ER-{alpha} mRNA expression was highest in the liver, whereas ER-β mRNA expression was greatest in the lung. Thus, the salutary effects of E2 administration on tissue neutrophil sequestration following T-H are receptor subtype and tissue-specific.

Key Words: shock • ICAM-1 • CINC-1 • CINC-3 • propyl pyrazole triol • diarylpropiolnitrile

INTRODUCTION

A large number of studies have demonstrated that the enhanced secretion of proinflammatory cytokines by mast cells, dendritic cells (DC), and macrophages is an important factor in the initiation and perpetuation of inflammation in different tissues [1 ]. These cytokines recruit other immune cells including neutrophils, thereby increasing leukocyte trafficking and tissue permeability [2 ]. Neutrophils can release superoxide anions and proteolytic enzymes, which diffuse across the endothelium and injure parenchymal cells, or alternatively, neutrophils can leave the microcirculation and migrate to and adhere to matrix proteins or other cells [3 ]. Intercellular adhesion molecule (ICAM)-1 is known to play a major role in the firm adhesion of neutrophils to the vascular endothelium. ICAM-1 is constitutively present on the surface of endothelial cells and is markedly up-regulated following trauma-hemorrhagic (T-H) shock [4 ]. In addition to adhesion molecules, chemokines such as cytokine-induced neutrophil chemoattractant (CINC)-1 and CINC-3 are potent chemotactic factors for neutrophils [5 ].

The gonadal steroids, androgen and estrogen, play a major role in the regulation of cardiovascular and immune function following T-H [6 , 7 ]. Immune and cardiac functions are depressed in males following T-H [6 , 8 ]. In contrast, these functions are maintained in proestrus females under those conditions [9 ]. 17β-Estradiol (E2) has been shown to be protective following shock-like states in males [9 ]. Furthermore, estrogen can reduce neutrophil accumulation, and this effect is mediated via the estrogen receptor (ER) [10 ]. Neutrophils play an important role in inflammation in the liver, small intestine, and lung in low-flow states [11 , 12 ]. In addition, liver, small intestine, and lung are critical organs for inflammation following T-H shock [12 ]. Previous studies have shown tissue-specific expressions of subtypes of ER in different tissues [13 ]. Thus, such differences in distribution of ER subtypes in various tissues could contribute to the selective role of ER-{alpha} or -β in different tissues [13 ]. Our recent study has also shown that ER-{alpha} is predominantly responsible for the salutary effect of E2 in attenuating the hepatic injury following T-H [14 ]. As two major subtypes of ERs (ER-{alpha} and ER-β) are known to exist [15 ], the aim of our study was to determine which ER is predominantly responsible for the salutary effect of E2 on the reduction of myeloperoxidase (MPO) activity following T-H shock and whether this effect is related to the different expression of ER subtypes in those tissues.

MATERIALS AND METHODS

T-H procedure
Our previously described, nonheparinized rat model of T-H was used in this study [16 ]. Briefly, male Sprague Dawley rats (275–325 g, Charles River Labs, Wilmington, MA) were fasted overnight before the experiment but were allowed water ad libitum. The rats were anesthetized by isoflurane (Attane, Minrad Inc., Bethlehem, PA) inhalation prior to the induction of soft tissue trauma via 5-cm midline laparotomy. The abdomen was closed in layers, and catheters were placed in femoral arteries and the right femoral vein [polyethylene (PE-50) tubing, Becton Dickinson and Co., Sparks, MD). The wounds were bathed with 1% lidocaine (Elkins-Sinn Inc., Cherry Hill, NJ) throughout the surgical procedure to reduce postoperative pain. Rats were then allowed to awaken and were bled to and maintained at a mean arterial pressure (MAP) of 40 mmHg. This level of hypotension was continued until the animals could not maintain a MAP of 40 mmHg unless additional fluid in the form of Ringer’s lactate (RL) was administered. This time was defined as maximum bleed-out, and the amount of withdrawn blood was noted. Following this, the rats were maintained at a MAP of 40 mmHg until 40% of the maximum bleed-out volume was returned in the form of RL. The animals were then resuscitated with four times the volume of the shed blood over 60 min with RL. Thirty minutes before the end of the resuscitation period, the rats received E2 [50 µg/kg, subcutaneously (s.c.)], ER-{alpha} agonist propyl pyrazole triol (PPT; 5 µg/kg, s.c.), ER-β agonist diarylpropiolnitrile (DPN; 5 µg/kg, s.c.), or an equal volume of the vehicle (~0.2 ml, 10% dimethyl sulfoxide, Sigma Chemical Co., St. Louis, MO). The doses of E2, PPT, and DPN used in this study were the same as those used in our recent study, which examined the effect of these agents on cardioprotection following T-H and resuscitation [17 ]. The catheters were then removed, the vessels ligated, and the skin incisions closed with sutures. Sham-operated animals underwent the same groin dissection, which included the ligation of the femoral artery and vein, but neither hemorrhage nor resuscitation was carried out. The animals were then returned to their cages and were allowed food and water ad libitum. The animals were killed at 24 h after the end of resuscitation. All animal experiments were performed according to the guidelines of the Animal Welfare Act and The Guide for Care and Use of Laboratory Animals from the National Institutes of Health (NIH; Bethesda, MD). The Institutional Animal Care and Use Committee of the University of Alabama at Birmingham approved this project.

Preparation of liver, intestine, and lung samples
Immediately after anesthetizing the rats, the liver, intestine, and lung were exposed. After approximately the first 15-cm proximal segment of intestine, a 3-cm piece of intestine was removed and flushed gently with saline and snap-frozen in liquid nitrogen.

Measurement of MPO activity
MPO activity in homogenates of whole liver, intestine, and lung was determined as described previously [18 , 19 ]. All reagents were purchased from Sigma Chemical Co. Briefly, equal weights (100 mg wet weight) of liver, intestine, and lung from various groups were suspended in 1 ml buffer (0.5% hexadecyltrimethylammonium bromide in 50 mM phosphate buffer, pH 6.0) and sonicated at 30 cycles, twice, for 30 s on ice. Homogenates were cleared by centrifuging at 12,000 revolutions per minute at 4°C, and the supernatants were stored at –80°C. Protein content in the samples was determined using the Bio-Rad (Hercules, CA) assay kit. The samples were incubated with a substrate o-dianisidine hydrochloride. This reaction was carried out in a 96-well plate by adding 290 µl 50 mM phosphate buffer, 3 µl substrate solution (containing 20 mg/ml o-dianisidine hydrochloride), and 3 µl H2O2 (20 mM). Sample (10 µl) was added to each well to start the reaction. Standard MPO (Sigma Chemical Co.) was used in parallel to determine MPO activity in the sample. The reaction was stopped by adding 3 µl sodium azide (30%). Light absorbance at 460 nm was read. MPO activity was determined by using the curve obtained from the standard MPO.

Determination of CINC-1, CINC-3, and ICAM-1 levels
CINC-1, CINC-3, and ICAM-1 levels in the liver, intestine, and lung were determined using enzyme-linked immunosorbent assay kits (R&D Systems, Minneapolis, MN), according to the manufacturer’s instructions and as described previously [20 ]. Briefly, the samples were homogenized in phosphate-buffered saline (1:10 weight:volume, pH 7.4) containing protease inhibitors (Complete Protease Inhibitor Cocktail, Boehringer Mannheim, Germany). The homogenates were centrifuged at 2000 g for 20 min at 4°C, and the supernatant was assayed for CINC-1, CINC-3, and ICAM-1 levels. An aliquot of the supernatant was used to determined protein concentration (DC protein assay, Bio-Rad).

Isolation of RNA
Liver, intestine, and lung RNA from sham-operated rats were isolated using Nucleospin RNA purification kits (BD Biosciences, Palo Alto, CA), following the manufacturer’s instruction. The concentration of RNA was determined by a spectrophotometer (Smart TM 300, Bio-Rad). The isolated RNA was then stored at –80°C until analyzed.

mRNA expression assay
ER-{alpha} and ER-β mRNA expressions in the liver, intestine, and lung were determined by real-time, quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) as described previously [16 ]. TaqMan RT-PCR reagents and protocols were used for all reactions. ER-{alpha}, and ER-β primers were purchased from Applied Biosystems (ABI; Foster City, CA), and amplification of cDNA was performed on an ABI Prism 7900HT sequence detection system. The primer pairs used in RT-PCR are: CTTCTGGAGTGTGCCTGGTT (forward) and CTTCTCCCTGCAGGTTCATC (reverse) for ER-{alpha} and CCTTGAAGGCTCTCGTGTTA (forward) and TAGAAGACGCCATCCAAAGG (reverse) for ER-β. 18 s was used for endogenous control. All the samples were amplified for 1 cycle at 50°C for 2 min and at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and at 60°C for 1 min.

Statistical analysis
Results are presented as mean ± SEM (n=6 rats/group). The data were analyzed using one-way ANOVA and Tukey’s test, and differences were considered significant at a P value of ≤0.05.

RESULTS

Effects of E2 on liver, intestine, and lung MPO activity
There was a significant increase in MPO activity following T-H in the liver, small intestine, and lung (Fig. 1 ). E2 treatment after T-H attenuated the increase in liver, intestine, and lung MPO activity.


Figure 1
View larger version (75K):
[in this window]
[in a new window]

 
Figure 1. Effects of E2 on MPO tissue levels in the liver (A), small intestine (B), and lung (C). Male Sprague-Dawley rats underwent T-H and resuscitation or sham operation, as described in Materials and Methods, and were treated with vehicle (Veh) or E2. At 24 h after the end of resuscitation or sham operation, the animals were killed. Immediately after sacrificing the rats, the liver, intestine, and lung were collected and stored at –80°C until analyzed. Homogenates of whole liver, intestine, and lung were used for the measurement of MPO activity. Data are shown as mean ± SEM of six rats in each group. *, P< 0.05, compared with Sham.

ER-{alpha} and ER-β mRNA expression in the liver, small intestine, and lung
To evaluate different ER mRNA expression in the liver, intestine, and lung, sham-operated rats and T-H rats treated with vehicle were used for measurement of ER-{alpha} and ER-β mRNA expression. Although T-H did not significantly influence the expression of ER-{alpha} and -β in the liver, intestine, and lung, the results, as shown in Fig. 2 , suggest that the expression of ER-{alpha} mRNA is highest in the liver, and the expression of ER-β mRNA is greatest in the lung. ER-{alpha} and -β were found to be equally distributed in the intestine.


Figure 2
View larger version (39K):
[in this window]
[in a new window]

 
Figure 2. ER-{alpha} (A) and ER-β (B) mRNA expression in liver, small intestine, and lung from sham-operated rats or T-H rats treated with vehicle. Data are shown as mean ± SEM of five rats in each group. RQ, Relative quantification.

Effect of ER-{alpha} agonist PPT and ER-β agonist DPN in the liver, small intestine, and lung MPO activity
To determine whether the salutary effects of a E2-induced decrease in MPO activity in the liver, small intestine, and lung in T-H rats are via ER-{alpha} or ER-β, rats were treated with ER-{alpha} agonist PPT or ER-β DPN following T-H. The results indicate that administration of ER-{alpha} agonist PPT prevented the T-H-induced increase in liver MPO activity (Fig. 3A ). In contrast, ER-β DPN treatment prevented the T-H-induced increase in lung MPO activity (Fig. 3C) . However, PPT and DPN treatment prevented the T-H-induced increase in intestinal MPO activity (Fig. 3B) .


Figure 3
View larger version (83K):
[in this window]
[in a new window]

 
Figure 3. Effects of ER-{alpha} agonist PPT and ER-β agonist DPN on MPO tissue levels in the liver (A), small intestine (B), and lung (C) in rats at 24 h after sham operation or T-H and resuscitation. Animals were treated with vehicle, PPT, or DPN. Data are shown as mean ± SEM of six rats in each group. *, P< 0.05, compared with Sham; @, P< 0.05, compared with Sham but no significant difference compared with T-H+Veh.

Effect of ER-{alpha} agonist PPT and ER-β agonist DPN in the liver, small intestine, and lung CINC-1, CINC-3, and ICAM-1 levels
T-H significantly increased CINC-1, CINC-3, and ICAM-1 levels in the liver, small intestine, and lung (Figs. 4 and 5 ). Administration of E2 following T-H prevented the T-H-induced increase in CINC-1, CINC-3, and ICAM-1 levels in liver, small intestine, and lung. In the liver, treatment with PPT, but not DPN, prevented the T-H-induced increase in CINC-1, CINC-3, and ICAM-1 levels (Figs. 4A and 4D and 5A ). However, in the lung, administration with DPN, but not PPT, prevented the T-H-induced increase in CINC-3 and ICAM-1 levels (Figs. 4F and 5C) . PPT and DPN each prevented the T-H-induced increase in CINC-1 levels in the lung; however, it remained higher than shams in PPT-treated T-H rats (Fig. 4C) . Furthermore, treatment with PPT or DPN prevented the T-H-induced increase in CINC-1, CINC-3, and ICAM-1 levels in the small intestine (Figs. 4B and 4E and 5B ).


Figure 4
View larger version (118K):
[in this window]
[in a new window]

 
Figure 4. CINC-1 and CINC-3 levels in the liver (A and D), small intestine (B and E), and lung (C and F) in rats after sham operation or T-H and resuscitation. Animals were treated with vehicle, PPT, DPN, or E2. Data are shown as mean ± SEM of six rats in each group. *, P< 0.05, compared with Sham; #, P< 0.05, compared with T-H+Veh; @, P< 0.05, compared with Sham but no significant difference compared with T-H+Veh.


Figure 5
View larger version (96K):
[in this window]
[in a new window]

 
Figure 5. ICAM-1 levels in the liver (A), small intestine (B), and lung (C) in rats after sham operation or T-H and resuscitation. Animals were treated with vehicle, PPT, DPN, or E2. There were six rats in each group. Data are shown as mean ± SEM of six rats in each group. *, P< 0.05, compared with sham group; @, P< 0.05, compared with Sham but no significant difference compared with T-H+Veh.

DISCUSSION

Our present results indicate that at 24 h following T-H, MPO activity, CINC-1, CINC-3, and ICAM-1 levels in the liver, small intestine, and lung are increased markedly in male rats. Administration of a single dose of E2 during resuscitation following T-H attenuated the increase in those inflammatory markers.

There are two major subtypes of ERs, ER-{alpha} and ER-β [13 , 15 ]. In this study, we attempted to determine which ER plays a predominant role in reduction of MPO activity following T-H in the liver, small intestine, and lung. Our results indicate that treating male rats with ER-{alpha} agonist PPT following T-H prevented the T-H-induced increase in MPO activity in the liver. In contrast, ER-β agonist DPN was found to be more effective in the lung in reducing MPO activity following T-H. Moreover, PPT and DPN were equally effective in preventing the T-H-induced increase in intestine MPO activity. Previous studies have shown that there are differences between the ER subtypes in different tissues [13 ]. Consistent with these findings, we also observed a difference in the distribution of ER-{alpha} and -β in various organs. ER-{alpha} mRNA expression was highest in the liver, whereas ER-β mRNA expression was greatest in the lung. Moreover, our findings suggest that ER-{alpha} and -β were equally expressed in the intestine. Thus, it is likely that the differences between the ER subtypes in tissue distribution may contribute to the selective action of ER agonists in different tissues [13 ] and thereby to the differences observed in response to PPT and DPN in different organs following T-H. Our previous studies have shown a difference in cardiomyocyte ER expression in T-H rats compared with sham rats [16 ]; however, ER expression was not found to be significantly different in liver, intestine, and lung following T-H compared with sham in this study. Although the differences in this and previous studies remain unknown, one possible reason for such different effects of T-H on ER expression is that this study was performed at 24 h after injury, and the previous study was conducted at an earlier time-point (i.e., 2 h). Another possible explanation is that we used isolated cardiomyocytes in the previous study, whereas we used the whole liver, intestine, and lung tissue in the present study. It is also possible that E2 administration alters the level of expression of ER-{alpha} or -β, especially following T-H. The expression of ER-{alpha} and -β was not examined in this study, and so it remains to be determined whether E2 administration altered the expression of ER-{alpha} or -β following T-H.

PPT is a selective agonist for the ER-{alpha} subtype and is the best agonist for ER-{alpha} out of a series of tetrasubstituted pyrazole analogs [21 ]. PPT binds to ER-{alpha} with high affinity, displaying a 410-fold binding selectivity over ER-β [21 ]. DPN, conversely, acts as an agonist on both ER subtypes but has a 70-fold higher relative binding affinity and a 170-fold higher relative estrogenic potency in transcription assays with ER-β than ER-{alpha} [22 ]. Our results provide evidence that following T-H, E2-induced reduction of MPO activity is mediated via ER-{alpha} activation in the liver, via ER-β activation in the lung, and via ER-{alpha} and ER-β in the small intestine. Those findings are consistent with ER mRNA expression in the liver, small intestine, and lung (i.e., ER-{alpha} mRNA expression is highest in the liver, and ER-β mRNA expression is greatest in the lung).

The liver, small intestine, and lung are considered critical organs in the development of delayed organ dysfunction in patients suffering from traumatic injuries and severe blood loss [23 ]. Multiple organ failure or dysfunction secondary to a systemic inflammatory response remains the major cause of mortality and morbidity following trauma [24 , 25 ]. Neutrophils are the principal cells involved in host defense against acute bacterial and fungal infections [26 ], and thus, these cells have a protective effect. However, under conditions such as those described in this study, the infiltration of these cells may cause tissue damage [17 , 27 , 28 ]. Neutrophil movement and migration are mediated by multiple adhesion molecules on the neutrophils and endothelial cell surfaces and chemotactic factors. Initially, neutrophils interact with endothelial selectins, resulting in neutrophils rolling along the endothelial surface. This rolling process appears to allow neutrophils to become activated ("primed") by chemokines and other mediators secreted by the endothelium, resulting in their firm adhesion to endothelial adhesion molecules [29 ]. Among adhesion molecules, ICAM-1 is an important mediator in the firm adhesion of neutrophils to the vascular endothelium and is up-regulated strongly following T-H shock [4 ]. With regard to chemokines, rat CINC-1 and CINC-3 are members of the interleukin (IL)-8 family and are potent chemotactic factors for neutrophils [30 ]. Chemotaxis of neutrophils is an important, functional response to chemokines and is a key event in the recruitment of neutrophils in inflammation. Using CINC antibodies, it was demonstrated that CINC-1 and CINC-3 contribute significantly to the influx of neutrophils in rat inflammation models including lung injury [31 ] and lipopolysaccharide-induced inflammation [32 ]. Our previous studies also indicate that CINC-1 levels correlated with tissue MPO activity, a marker of neutrophil content, following T-H [15 ].

There is now considerable evidence demonstrating a role for estrogen in mediating the production of cytokines [33 34 35 ]. During estrogen deficiency, increases in IL-1, IL-6, and tumor necrosis factor {alpha} (TNF-{alpha}) production have been described in ex vivo cultures of unstimulated monocytes and macrophages [34 ]. Increases in IL-6 and TNF-{alpha} have been demonstrated in the circulation of females after natural or surgically induced menopause [33 ]. Serum IL-6 levels were also found to be lower in postmenopausal women undergoing hormone replacement therapy (HRT) [35 ]. Furthermore, estrogen deficiency is also associated with increases in cell adhesion molecule expression. Serum levels of ICAM-1 correlate inversely with estradiol levels in women [36 ], and studies have shown that postmenopausal women treated with HRT or estrogen alone had reduced ICAM-1 serum levels compared with untreated, postmenopausal women [37 ]. Previous studies have also demonstrated the ability of estrogen to mediate ICAM-1 expression in shock status [28 ]. The cytokines IL-1, IL-6, and TNF-{alpha} are important, early mediators in liver, intestine, and lung inflammation [5 , 28 , 38 ] and are required for expression of adhesion molecules and chemokines [39 ]. The ability of estrogen to mediate expression of inflammatory cytokines as well as adhesion molecules and chemokines suggests a role for estrogen in the regulation of liver, intestine, and lung inflammation. The present study is in agreement with our previous findings [18 ] and indicates that E2 administration following T-H normalized CINC-1, CINC-3, and ICAM-1 levels. Our results also showed that ER-{alpha} agonist PPT can attenuate the increase in liver CINC-1, CINC-3, and ICAM-1 levels following T-H. In contrast, administration of ER-β agonist DPN can prevent the T-H-induced increase in lung CINC-1, CINC-3, and ICAM-1 levels. However, administration of PPT or DPN can attenuate the increase in intestinal CINC-1, CINC-3, and ICAM-1 levels following T-H. E2 has been shown to modulate adhesion molecule expression in response to cytokine treatment in vitro [40 41 42 ]. Human endothelial cells in culture express ICAM-1 at high levels when stimulated with cytokines, and this effect is attenuated by E2 treatment [40 ]. In vitro studies also provide evidence, which indicates that the effect of E2 on adhesion molecules is mediated by inhibition of nuclear factor (NF)-{kappa}B DNA binding, probably by stabilizing and increasing NF-{kappa}B inhibitors [41 , 42 ]. Furthermore, previous studies have shown marked modulation of CINC mRNA and protein expression in the vasculature by estrogen following endoluminal injury [43 ].

Studies have used direct chemokine and/or adhesion molecule blockade to reduce polymorphonuclear neutrophil (PMN) accumulation in tissues following adverse circulatory conditions [44 , 45 ]. Thus, the question that can therefore be raised is whether the reduction in PMN accumulation in the three tissues used in this study by E2 is comparable with the reduction in PMN accumulation by using chemokine and/or adhesion molecule blockade under the same experimental conditions. As direct chemokine or adhesion molecule blockade was not attempted in this model, it remains unknown whether the reduction in PMN accumulation in tissues would be comparable with E2. It also remains to be determined whether the reduction in PMN accumulation by E2 and direct chemokine and/or adhesion molecule would be additive. In addition, it remains to be established whether the modulation in PMN infiltration by E2 following T-H is a direct effect of E2 or it is via modulation of chemokines and adhesion molecules.

It could be argued that the present study used measurement at a single time-point, i.e., at 24 h after treatment, and thus, it remains unclear whether the salutary effects of E2, PPT, or DPN are sustained for periods of time longer than 24 h after treatment. In this regard, our previous studies have shown that if the improvement in organ functions by any pharmacological agent is evident at 2, 5, or 24 h after treatment then those salutary effects are sustained for prolonged intervals and also improve the survival of animals [46 ]. Thus, although a time-point other than 24 h was not examined in this study, based on our previous studies, it would appear that the salutary effects of E2, PPT, or DPN on the measured parameters in different organs would be evident, even if those effects were measured at another time-point following T-H and resuscitation.

It can also be argued that we should have administered PPT or DPN alone in sham groups in these studies to determine if each of those per se has any adverse effects. In this regard, our recent study has shown that administration of PPT or DPN alone in sham groups did not produce any deleterious effects (unpublished data). As PPT or DPN administration in itself did not influence organ function in sham animals, administration of PPT or DPN alone was therefore not carried out in this study.

In summary, our results indicate that E2 attenuates liver, small intestine, and lung injury following T-H. The beneficial effects of E2 on neutrophil accumulation are mediated via different subtypes of ER in liver, small intestine, and lung. Although the precise mechanism of the salutary effects of E2 via different subtypes of ER in different tissues in reducing organ injuries following T-H remains unclear, our study provides evidence that the existence of two ER subtypes provides, at least in part, an explanation for the selective action of estrogen in different target tissues. Furthermore, the findings that selective ER agonists have different responses in different organs may be useful in the treatment of patients with specific organ dysfunction following low flow conditions. In addition, our previous studies have shown that E2-treated male rats and proestrus female rats maintain/improve organ function following T-H [6 , 9 ]. It is therefore possible that the salutary effects of E2 on reduction of neutrophil accumulation, which are observed in males, are also evident in proestrus females under those conditions. We further propose that the salutary effects of E2 on inhibiting neutrophil accumulation will also be observed in ovariectomized females subjected to T-H. Although ER agonists were used in the present study, studies using ER-{alpha} or ER-β knockout mice to evaluate the salutary effects of E2 on reduction of neutrophil accumulation in different tissues will provide additional, mechanistic information and further support for the conclusions derived in this study.

ACKNOWLEDGEMENTS

This investigation was supported by NIH Grant R37 GM39519 (I. H. C.). M. G. S. is supported in part by NIH Grant K02 AI49960.

Received October 21, 2005; revised December 9, 2005; accepted December 19, 2005.

REFERENCES

    1
  1. Fiocchi, C. (1998) Inflammatory bowel disease: etiology and pathogenesis Gastroenterology 115,182-205[CrossRef][Medline]
  2. 2
  3. Vaday, G. G., Franitza, S., Schor, H., Hecht, I., Brill, A., Cahalon, I., Hershkoviz, R., Lider, O. (2001) Combinatorial signals by inflammatory cytokines and chemokines mediate leukocyte interactions with extracellular matrix J. Leukoc. Biol. 69,885-892[Abstract/Free Full Text]
  4. 3
  5. Olanders, K., Sun, Z., Borjesson, A., Dib, M., Andersson, E., Lasson, A., Ohlsson, T., Andersson, R. (2002) The effect of intestinal ischemia and reperfusion injury on ICAM-1 expression, endothelial barrier function, neutrophil tissue influx, and protease inhibitor levels in rats Shock 18,86-92[CrossRef][Medline]
  6. 4
  7. Dayal, S. D., Hasko, G., Lu, Q., Xu, D. Z., Caruso, J. M., Sambol, J. T., Deitch, E. A. (2002) Trauma/hemorrhagic shock mesenteric lymph upregulates adhesion molecule expression and IL-6 production in human umbilical vein endothelial cells Shock 17,491-495[CrossRef][Medline]
  8. 5
  9. Meldrum, D. R., McIntyre, R. C., Sheridan, B. C., Cleveland, J. C., Jr, Fullerton, D. A., Harken, A. H. (1997) L-arginine decreases alveolar macrophage proinflammatory monokine production during acute lung injury by a nitric oxide synthase-dependent mechanism J. Trauma 43,888-893[Medline]
  10. 6
  11. Kher, A., Wang, M., Tsai, B. M., Pitcher, J. M., Greenbaum, E. S., Nagy, R. D., Patel, K. M., Wairiuko, G. M., Markel, T. A., Meldrum, D. R. (2005) Sex differences in the myocardial inflammatory response to acute injury Shock 23,1-10[Medline]
  12. 7
  13. Olsen, N. J., Kovacs, W. J. (1996) Gonadal steroids and immunity Endocr. Rev. 17,369-384[Abstract/Free Full Text]
  14. 8
  15. Ayala, A., Ertel, W., Chaudry, I. H. (1996) Trauma induced suppression of antigen presentation and expression of major histocompatibility class II antigen complex in leukocytes Shock 5,79-90[Medline]
  16. 9
  17. Angele, M. K., Schwacha, M. G., Ayala, A., Chaudry, I. H. (2000) Effect of gender and sex hormones on immune responses following shock Shock 14,81-90[Medline]
  18. 10
  19. Harnish, D. C., Albert, L. M., Leathurby, Y., Eckert, A. M., Ciarletta, A., Kasaian, M., Keith, J. C., Jr (2004) Beneficial effects of estrogen treatment in the HLA-B27 transgenic rat model of inflammatory bowel disease Am. J. Physiol. Gastrointest. Liver Physiol. 286,G118-G125[Abstract/Free Full Text]
  20. 11
  21. Kotake, Y., Yamamoto, M., Matsumoto, M., Morisaki, H., Takeda, J. (2005) Sivelestat, a neutrophil elastase inhibitor, attenuates neutrophil priming after hepatoenteric ischemia in rabbits Shock 23,156-160[CrossRef][Medline]
  22. 12
  23. Xu, D. Z., Lu, Q., Adams, C. A., Issekutz, A. C., Deitch, E. A. (2004) Trauma-hemorrhagic shock-induced up-regulation of endothelial cell adhesion molecules is blunted by mesenteric lymph duct ligation Crit. Care Med. 32,760-765[CrossRef][Medline]
  24. 13
  25. Kuiper, G. G. J. M., Carlsson, B., Grandien, J., Enmark, E., Haggblad, J., Nilsson, S., Gustafsson, J-A. (1997) Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptor {alpha} and β Endocrinology 138,863-870[Abstract/Free Full Text]
  26. 14
  27. Suzuki, T., Shimizu, T., Yu, H. P., Choudhry, M. A., Bland, K. I., Chaudry, I. H. (2005) A selective estrogen receptor-{alpha} agonist reduces hepatic injury following trauma-hemorrhage Shock 23,82(abstr.).[CrossRef]
  28. 15
  29. Samy, T. S. A., Schwacha, M. G., Cioffi, W. G., Bland, K. I., Chaudry, I. H. (2000) Androgen and estrogen receptors in splenic T lymphocytes: effects of flutamide and trauma-hemorrhage Shock 14,465-470[Medline]
  30. 16
  31. Yu, H. P., Yang, S., Choudhry, M. A., Hsieh, Y. C., Bland, K. I., Chaudry, I. H. (2005) Mechanism responsible for the salutary effects of flutamide on cardiac performance following trauma-hemorrhagic shock: upregulation of cardiomyocyte estrogen receptors Surgery 138,85-92[CrossRef][Medline]
  32. 17
  33. Yu, H. P., Shimizu, T., Choudhry, M. A., Hsieh, Y. C., Suzuki, T., Bland, K. I., Chaudry, I. H. (2005) Mechanism of cardioprotection following trauma-hemorrhagic shock by a selective estrogen receptor-β agonist: up-regulation of cardiac heat shock factor-1 and heat shock proteins J. Mol. Cell. Cardiol. 40,185-194[Medline]
  34. 18
  35. Toth, B., Schwacha, M. G., Kuebler, J. F., Bland, K. I., Wang, P., Chaudry, I. H. (2003) Gender dimorphism in neutrophil priming and activation following trauma-hemorrhagic shock Int. J. Mol. Med. 11,357-364[Medline]
  36. 19
  37. Rana, S. N., Li, X., Chaudry, I. H., Bland, K. I., Choudhry, M. A. (2005) Inhibition of IL-18 reduces myeloperoxidase activity and prevents edema in intestine following alcohol and burn injury J. Leukoc. Biol. 77,719-728[Abstract/Free Full Text]
  38. 20
  39. Yu, H. P., Choudhry, M. A., Shimizu, T., Hsieh, Y. C., Schwacha, M. G., Yang, S., Chaudry, I. H. (2006) Mechanism of the salutary effects of flutamide on intestinal myeloperoxidase activity following trauma-hemorrhage: up-regulation of estrogen receptor-β-dependent HO-1 J. Leukoc. Biol. 79,277-284[Abstract/Free Full Text]
  40. 21
  41. Stauffer, S. R., Coletta, C. J., Tedesco, R., Nishiguchi, G., Carlson, K., Sun, J., Katzenellenbogen, B. S., Katzenellenbogen, J. A. (2000) Pyrazole ligands: structure-affinity/activity relationships and estrogen receptor-{alpha}-selective agonists J. Med. Chem. 43,4934-4947[CrossRef][Medline]
  42. 22
  43. Meyers, M. J., Sun, J., Carlson, K. E., Marriner, G. A., Katzenellenbogen, B. S., Katzenellenbogen, J. A. (2001) Estrogen receptor-β potency-selective ligands: structure-activity relationship studies of diarylpropionitriles and their acetylene and polar analogues J. Med. Chem. 44,4230-4251[CrossRef][Medline]
  44. 23
  45. Adams, C. A., Jr, Hauser, C. J., Adams, J. M., Fekete, Z., Xu, D. Z., Sambol, J. T., Deitch, E. A. (2002) Trauma-hemorrhage-induced neutrophil priming is prevented by mesenteric lymph duct ligation Shock 18,513-517[Medline]
  46. 24
  47. Murphy, T. J., Paterson, H. M., Mannick, J. A., Lederer, J. A. (2004) Injury, sepsis, and the regulation of Toll-like receptor responses J. Leukoc. Biol. 75,400-407[Abstract/Free Full Text]
  48. 25
  49. Wu, L. L., Tang, C., Liu, M. S. (2001) Altered phosphorylation and calcium sensitivity of cardiac myofibrillar proteins during sepsis Am. J. Physiol. Regul. Integr. Comp. Physiol. 281,R408-R416[Abstract/Free Full Text]
  50. 26
  51. Malech, H. L., Gallin, J. I. (1987) Current concepts: immunology. Neutrophils in human diseases N. Engl. J. Med. 317,687-694[Medline]
  52. 27
  53. Angle, N., Hoyt, D. B., Coimbra, R., Liu, F., Herdon-Remelius, C., Loomis, W., Junger, W. G. (1998) Hypertonic saline resuscitation diminishes lung injury by suppressing neutrophil activation after hemorrhagic shock Shock 9,164-170[Medline]
  54. 28
  55. Homma, H., Hoy, E., Xu, D. Z., Lu, Q., Feinman, R., Deitch, E. A. (2005) The female intestine is more resistant than the male intestine to gut injury and inflammation when subjected to conditions associated with shock states Am. J. Physiol. Gastrointest. Liver Physiol. 288,G466-G472[Abstract/Free Full Text]
  56. 29
  57. Guo, R. F., Riedemann, N. C., Laudes, I. J., Sarma, V. J., Kunkel, R. G., Dilley, K. A., Paulauskis, J. D., Ward, P. A. (2002) Altered neutrophil trafficking during sepsis J. Immunol. 169,307-314[Abstract/Free Full Text]
  58. 30
  59. Nakagawa, H., Komorita, N., Shibata, F., Ikesue, A., Konishi, K., Fujioka, M., Kato, H. (1994) Identification of cytokine-induced neutrophil chemoattractants (CINC), rat GRO/CINC-2{alpha} and CINC-2β, produced by granulation tissue in culture: purification, complete amino acid sequences and characterization Biochem. J. 301,545-550[Medline]
  60. 31
  61. Shanley, T. P., Schmal, H., Warner, R. L., Schmid, E., Friedl, H. P., Ward, P. A. (1997) Requirement for C-X-C chemokines (macrophage inflammatory protein-2 and cytokine-induced neutrophil chemoattractant) in IgG immune complex-induced lung injury J. Immunol. 158,3439-3448[Abstract]
  62. 32
  63. Iida, M., Watanabe, K., Tsurufuji, M., Takaishi, K., Iizuka, Y., Tsurufuji, S. (1992) Level of neutrophil chemotactic factor CINC/gro, a member of the interleukin-8 family, associated with lipopolysaccharide-induced inflammation in rats Infect. Immun. 60,1268-1272[Abstract/Free Full Text]
  64. 33
  65. Deswal, A., Petersen, N. J., Feldman, A. M., Young, J. B., White, B. G., Mann, D. L. (2001) Cytokines and cytokine receptors in advanced heart failure: an analysis of the cytokine database from the Vesnarinone trial (VEST) Circulation 103,2055-2059[Abstract/Free Full Text]
  66. 34
  67. Jilka, R. L., Hangoc, G., Girasole, G., Passeri, G., Williams, D. C., Abrams, J. S., Boyce, B., Broxmeyer, H., Manolagas, S. C. (1992) Increased osteoclast development after estrogen loss: mediation by interleukin-6 Science 257,88-91[Abstract/Free Full Text]
  68. 35
  69. Scheidt-Nave, C., Bismar, H., Leidig-Bruckner, G., Woitge, H., Seibel, M. J., Ziegler, R., Pfeilschifter, J. (2001) Serum interleukin 6 is a major predictor of bone loss in women specific to the first decade past menopause J. Clin. Endocrinol. Metab. 86,2032-2042[Abstract/Free Full Text]
  70. 36
  71. Bonello, N., Norman, R. J. (2002) Soluble adhesion molecules in serum throughout the menstrual cycle Hum. Reprod. 17,2272-2278[Abstract/Free Full Text]
  72. 37
  73. Stork, S., von Schacky, C., Angerer, P. (2002) The effect of 17β-estradiol on endothelial and inflammatory markers in postmenopausal women: a randomized, controlled trial Atherosclerosis 165,301-307[CrossRef][Medline]
  74. 38
  75. Speyer, C. L., Rancilio, N. J., McClintock, S. D., Crawford, J. D., Gao, H., Sarma, J. V., Ward, P. A. (2005) Regulatory effects of estrogen on acute lung inflammation in mice Am. J. Physiol. Cell Physiol. 288,C881-C890[Abstract/Free Full Text]
  76. 39
  77. Maier, M., Strobele, H., Voges, J., Bauer, C., Marzi, I. (2003) Attenuation of leukocyte adhesion by recombinant TNF-binding protein after hemorrhagic shock in the rat Shock 19,457-461[CrossRef][Medline]
  78. 40
  79. Caulin-Glaser, T., Watson, C. A., Pardi, R., Bender, J. R. (1996) Effects of 17β-estradiol on cytokine-induced endothelial cell adhesion molecule expression J. Clin. Invest. 98,36-42[Medline]
  80. 41
  81. Simoncini, T., Maffei, S., Basta, G., Barsacchi, G., Genazzani, A. R., Liao, J. K., De Caterina, R. (2000) Estrogens and glucocorticoids inhibit endothelial vascular cell adhesion molecule-1 expression by different transcriptional mechanisms Circ. Res. 87,19-25[Abstract/Free Full Text]
  82. 42
  83. Hsu, S. M., Chen, Y. C., Jiang, M. C. (2000) 17β-Estradiol inhibits tumor necrosis factor-{alpha}-induced nuclear factor-{kappa}B activation by increasing nuclear factor-{kappa}B p105 level in MCF-7 breast cancer cells Biochem. Biophys. Res. Commun. 279,47-52[CrossRef][Medline]
  84. 43
  85. Miller, A. P., Feng, W., Xing, D., Weathington, N. M., Blalock, J. E., Chen, Y. F., Oparil, S. (2004) Estrogen modulates inflammatory mediator expression and neutrophil chemotaxis in injured arteries Circulation 110,1664-1669[Abstract/Free Full Text]
  86. 44
  87. Dang, O., Navarro, L., David, M. (2004) Inhibition of lipopolysaccharide-induced interferon regulatory factor 3 activation and protection from septic shock by hydroxystilbenes Shock 21,470-475[CrossRef][Medline]
  88. 45
  89. Mazzon, E., Muia, C., Di Paola, R., Genovese, T., De Sarro, A., Cuzzocrea, S. (2005) Thalidomide treatment reduces colon injury induced by experimental colitis Shock 23,556-564[CrossRef][Medline]
  90. 46
  91. Chaudry, I. H., Samy, T. S. A., Schwacha, M. G., Wang, P., Rue, L. W., III, Bland, K. I. (2003) Endocrine targets in experimental shock J. Trauma 54,S118-S125[Medline]



This article has been cited by other articles:


Home page
Anesth. Analg.Home page
F.-C. Liu, Y.-J. Day, C.-H. Liao, J.-T. Liou, C.-C. Mao, and H.-P. Yu
Hemeoxygenase-1 Upregulation Is Critical for Sirtinol-Mediated Attenuation of Lung Injury After Trauma-Hemorrhage in a Rodent Model
Anesth. Analg., June 1, 2009; 108(6): 1855 - 1861.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Z. F. Ba and I. H. Chaudry
Role of estrogen receptor subtypes in estrogen-induced organ-specific vasorelaxation after trauma-hemorrhage
Am J Physiol Heart Circ Physiol, November 1, 2008; 295(5): H2061 - H2067.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C.-H. Hsieh, M. Frink, Y.-C. Hsieh, W.-H. Kan, J.-T. Hsu, M. G. Schwacha, M. A. Choudhry, and I. H. Chaudry
The Role of MIP-1{alpha} in the Development of Systemic Inflammatory Response and Organ Injury following Trauma Hemorrhage
J. Immunol., August 15, 2008; 181(4): 2806 - 2812.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J.-T. Hsu, W.-H. Kan, C.-H. Hsieh, M. A. Choudhry, M. G. Schwacha, K. I. Bland, and I. H. Chaudry
Mechanism of estrogen-mediated intestinal protection following trauma-hemorrhage: p38 MAPK-dependent upregulation of HO-1
Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2008; 294(6): R1825 - R1831.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. L. Sperry and J. P. Minei
Gender dimorphism following injury: making the connection from bench to bedside
J. Leukoc. Biol., March 1, 2008; 83(3): 499 - 506.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. A. Choudhry and I. H. Chaudry
17{beta}-Estradiol: a novel hormone for improving immune and cardiovascular responses following trauma-hemorrhage
J. Leukoc. Biol., March 1, 2008; 83(3): 518 - 522.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J.-T. Hsu, W.-H. Kan, C.-H. Hsieh, M. A. Choudhry, M. G. Schwacha, K. I. Bland, and I. H. Chaudry
Mechanism of estrogen-mediated attenuation of hepatic injury following trauma-hemorrhage: Akt-dependent HO-1 up-regulation
J. Leukoc. Biol., October 1, 2007; 82(4): 1019 - 1026.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
H.-P. Yu, Y.-C. Hsieh, T. Suzuki, M. A. Choudhry, M. G. Schwacha, K. I. Bland, and I. H. Chaudry
Mechanism of the nongenomic effects of estrogen on intestinal myeloperoxidase activity following trauma-hemorrhage: up-regulation of the PI-3K/Akt pathway
J. Leukoc. Biol., September 1, 2007; 82(3): 774 - 780.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Suzuki, T. Shimizu, H.-P. Yu, Y.-C. Hsieh, M. A. Choudhry, K. I. Bland, and I. H. Chaudry
Estrogen receptor-{alpha} predominantly mediates the salutary effects of 17beta-estradiol on splenic macrophages following trauma-hemorrhage
Am J Physiol Cell Physiol, September 1, 2007; 293(3): C978 - C984.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Suzuki, T. Shimizu, H.-P. Yu, Y.-C. Hsieh, M. A. Choudhry, and I. H. Chaudry
Salutary effects of 17beta-estradiol on T-cell signaling and cytokine production after trauma-hemorrhage are mediated primarily via estrogen receptor-{alpha}
Am J Physiol Cell Physiol, June 1, 2007; 292(6): C2103 - C2111.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. Xing, W. Feng, A. P. Miller, N. M. Weathington, Y.-F. Chen, L. Novak, J. E. Blalock, and S. Oparil
Estrogen modulates TNF-{alpha}-induced inflammatory responses in rat aortic smooth muscle cells through estrogen receptor-beta activation
Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H2607 - H2612.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y.-C. Hsieh, H.-P. Yu, M. Frink, T. Suzuki, M. A. Choudhry, M. G. Schwacha, and I. H. Chaudry
G Protein-Coupled Receptor 30-Dependent Protein Kinase A Pathway Is Critical in Nongenomic Effects of Estrogen in Attenuating Liver Injury after Trauma-Hemorrhage
Am. J. Pathol., April 1, 2007; 170(4): 1210 - 1218.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Frink, A. Lu, B. M. Thobe, Y.-C. Hsieh, M. A. Choudhry, M. G. Schwacha, S. L. Kunkel, and I. H. Chaudry
Monocyte chemoattractant protein-1 influences trauma-hemorrhage-induced distal organ damage via regulation of keratinocyte-derived chemokine production
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2007; 292(3): R1110 - R1116.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. Frink, B. M. Thobe, Y.-C. Hsieh, M. A. Choudhry, M. G. Schwacha, K. I. Bland, and I. H. Chaudry
17beta-Estradiol inhibits keratinocyte-derived chemokine production following trauma-hemorrhage
Am J Physiol Lung Cell Mol Physiol, February 1, 2007; 292(2): L585 - L591.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
T. Suzuki, T. Shimizu, H.-P. Yu, Y.-C. Hsieh, M. A. Choudhry, M. G. Schwacha, and I. H. Chaudry
Tissue compartment-specific role of estrogen receptor subtypes in immune cell cytokine production following trauma-hemorrhage
J Appl Physiol, January 1, 2007; 102(1): 163 - 168.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Erratum (v84,p329)
Right arrow All Versions of this Article:
jlb.1005596v1
79/5/963    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, H.-P.
Right arrow Articles by Chaudry, I. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, H.-P.
Right arrow Articles by Chaudry, I. H.