PeproTech Inc.
Originally published online as doi:10.1189/jlb.0305127 on January 13, 2006

Published online before print January 13, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0305127v1
79/3/555    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sakai, N.
Right arrow Articles by Kaneko, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sakai, N.
Right arrow Articles by Kaneko, S.
(Journal of Leukocyte Biology. 2006;79:555-563.)
© 2006 by Society for Leukocyte Biology

MCP-1/CCR2-dependent loop for fibrogenesis in human peripheral CD14-positive monocytes

Norihiko Sakai*, Takashi Wada*,1, Kengo Furuichi*, Kazuaki Shimizu*, Satoshi Kokubo*, Akinori Hara*, Junya Yamahana*, Toshiya Okumura*, Kouji Matsushima{dagger}, Hitoshi Yokoyama* and Shuichi Kaneko*

* Department of Gastroenterology and Nephrology, Kanazawa University Graduate School of Medical Science, Ishikawa, Japan; and
{dagger} Department of Molecular Preventive Medicine, the University of Tokyo, Japan

1 Correspondence: Department of Gastroenterology and Nephrology, Kanazawa University Graduate School of Medical Science, 13-1 Takara-machi, Kanazawa 920-8641, Japan. E-mail: twada{at}medf.m.kanazawa-u.ac.jp


arrow
ABSTRACT
 
Monocyte/macrophage (Mo) migration to sites of inflammation is a prerequisite cause of organ fibrosis. The recruitment and activation of Mo are regulated by C-C chemokines, especially monocyte chemoattractant protein-1 [(MCP-1)/CC chemokine ligand 2], which interacts with CC chemokine receptor 2 (CCR2). However, the mechanisms leading to fibrosis via MCP-1/CCR2 signaling in Mo remain to be investigated. The effect of MCP-1 on the expression of MCP-1, CCR2, transforming growth factor-ß1 (TGF-ß1), and type I collagen in circulating human CD14-positive Mo was investigated. In addition, the impact of MCP-1-specific or TGF-ß1-specific antisense (AS) phosphorothioate oligodeoxynucleotides (ODN) was examined to explore the involvement of autocrine/paracrine production of MCP-1 and TGF-ß1 by human CD14-positive Mo. Furthermore, specific CCR2 inhibitors were applied to examine the involvement of CCR2 signaling for the promotion of a fibrogenic response. The stimulation of Mo with MCP-1 increased mRNA levels of TGF-ß1 and a pro-{alpha}1 chain of type I collagen (COL1A1) as well as protein synthesis. Similarly, the expression of MCP-1 and CCR2 was enhanced by the stimulation with MCP-1 in dose- and time-dependent manners. This positive loop via MCP-1 was reduced by pretreatment with MCP-1-specific AS-ODN. It was also noted that pretreatment with TGF-ß1-specific AS-ODN partially reduced COL1A1 mRNA levels. Finally, transcripts of these molecules were suppressed by pretreatment with specific CCR2 inhibitors. The present study demonstrated that human peripheral CD14-positive Mo contribute directly to fibrogenesis by a MCP-1/CCR2-dependent amplification loop. These data suggest that fibrogenic processes in Mo regulated by MCP-1/CCR2 may be novel, therapeutic targets for combating organ fibrosis.

Key Words: chemokine • fibrosis • TGF-ß1 • collagen I


arrow
INTRODUCTION
 
Infiltration of monocytes/macrophages (Mo) into inflammatory sites is characteristic of chronic inflammation [1 , 2 ], which eventually leads to tissue fibrosis and the loss of function in various organs. Whereas fibroblasts have been presumed to play a central role in the progression of fibrosis based on their ability to produce various types of collagen, Mo might contribute to fibrosis by regulating the activity of fibroblasts [3 ]. Thus far, various growth factors, including transforming growth factor-ß1 (TGF-ß1), which is secreted by Mo, have been thought to be important for the progression of fibrosis [4 ]. However, whether Mo are capable of producing extracellular matrix (ECM) remains to be examined.

The recruitment and activation of Mo are regulated mainly by monocyte chemoattractant protein-1 (MCP-1)/macrophage chemotactic and activating factor/CC chemokine ligand 2, which is a founding member of the C-C chemokine family [5 ]. The function of chemokine is mediated through seven-transmembrane spanning, guanosine 5'-triphosphate (GTP)-binding, protein-coupled receptors [5 ]. CC chemokine receptor 2 (CCR2), the cognate receptor for MCP-1, is expressed mainly on Mo [6 ]. Further, recent studies reported that the MCP-1/CCR2 signaling pathway is involved in the progression of fibrosis in various human diseases, including lung, heart, and kidney diseases [7 8 9 ], as well as experimental models of lung and kidney fibrosis [10 11 12 13 ]. However, the detailed processes leading to fibrogenesis via the MCP-1/CCR2 signaling pathway in Mo have not been clarified.

In this study, we hypothesized that the MCP-1/CCR2 signaling pathway in Mo may be responsible for fibrogenesis. To evaluate this, the direct involvement of Mo in the progression of fibrogenesis through MCP-1/CCR2 signaling was examined. We now report that Mo are capable of producing TGF-ß1 and type I collagen as well as MCP-1 in an autocrine/paracrine manner in response to MCP-1, which in turn, recruits and activates Mo, further augmenting a cascade of events that culminates in fibrosis.


arrow
MATERIALS AND METHODS
 
CD14-positive monocyte isolation from human blood
Peripheral blood mononuclear cells (PBMCs) were isolated from venous blood drawn from healthy donors (n=12) [14 ]. Briefly, PBMCs were isolated by centrifugation on a Ficoll-Metrizoate density gradient (d=1.077 g/ml; Lymphoprep, Nycomed, Oslo, Norway) and suspended in RPMI-1640 medium (Gibco-BRL Life Technologies, Burlington, Ontario, Canada) containing 2.5% heat-inactivated fetal calf serum (FCS), 100 U/ml penicillin, and 100 µg/ml streptomycin. PBMCs were incubated with anti-CD14 monoclonal antibody coated with microbeads, and CD14-positive Mo were isolated by passing the PBMCs through a magnetic cell separation system (Miltenyi Biotec, Bergisch Gladbach, Germany) with column-type mass spectrometry. These cell suspensions were then aliquotted into plastic tissue-culture plates and incubated for 30 min at 37°C, 5% CO2, to obtain the highly purified cells. More than 99% of the cells were judged to be Mo by morphology, by positive staining for CD14 (LeuM3, Becton Dickinson, San Jose, CA) in a flow cytometric analysis and by nonspecific esterase staining. Cell viability was determined by trypan blue dye exclusion, which showed >95% viability. All reagents used were tested for the presence of detectable levels of lipopolysaccharide (LPS) by Limulus amebocyte lysate assay.

Culture conditions
To examine the effect of MCP-1 on Mo, Mo were incubated with MCP-1 in dose- and time-dependent manners. Briefly, Mo (1x106/ml) were cultured in 12-well, fibronectin-coated plates (Becton Dickinson) in RPMI 1640 supplemented with 2.5% heat-inactivated FCS (Gibco-BRL Life Technologies) at 37°C in a humidified atmosphere with 5% CO2 for 48 h just after the isolation in the presence of increasing concentrations (0–50 ng/ml) of recombinant human MCP-1 (R&D Systems Inc., Minneapolis, MN). In addition, Mo were cultured for an increasing period of time (0–48 h) in RPMI 1640 supplemented with 2.5% heat-inactivated FCS in the presence of recombinant human MCP-1 (10 ng/ml).

Preparation of antisense (AS) phosphorothioate oligodeoxynucleotides (ODN)
To explore the involvement of autocrine production of MCP-1 or TGF-ß1 in Mo, the inhibitory effects of MCP-1-specific or TGF-ß1-specific AS phosphorothioate ODN on the inhibition of MCP-1 or TGF-ß1 production were examined. AS phosphorothioate ODNs were synthesized and highly purified by reverse-phase high-performance liquid chromatography (Greiner Japan, Tokyo). MCP-1-specific AS phosphorothioate ODN (MCP-1-AS-ODN, 5'-ATAACAGCAGGTGACTGG-3') directed against a part of the MCP-1 mRNA coding region and a scrambled control (MCP-1-Scr-ODN, 5'-CAGCTCTGACAGCACTCAGT-3') were used in this study [15 ]. Similarly, TGF-ß1-specific AS phosphorothioate ODN (TGF-ß1-AS-ODN, 5'-CGATAGTCTTGCAG-3') directed against a part of the TGF-ß1 mRNA coding region and a Scr control (TGF-ß1-Scr-ODN, 5'-GTCCCTATACGAAC-3') were also used in this study [16 ].

Incubation of Mo with AS phosphorothioate ODN
Mo (1x106 cells/ml) were preincubated in RPMI 1640 supplemented with 2.5% heat-inactivated FCS by directly adding each of 1 µmol/l phosphorothioate ODN for MCP-1 or TGF-ß1 into culture medium for 24 h. Then, Mo were incubated in the presence of increasing concentrations (0–100 ng/ml) of recombinant human MCP-1 for 48 h.

Treatment of Mo with CCR2 inhibitors
To examine whether CCR2 is responsible for the production of type I collagen, propagermanium (3 µg/ml; Sanwa Kagaku Co., Ltd., Mie, Japan) and RS-504393 (1 µM), inhibitors of the MCP-1/CCR2 signaling pathway, were used [17 , 18 ]. Mo (1x106 cells/ml) were preincubated in RPMI 1640 supplemented with 2.5% heat-inactivated FCS by adding propagermanium or RS-504393 into each culture medium for 30 min. Subsequently, Mo were incubated in the presence of increasing concentrations (0–100 ng/ml) of recombinant human MCP-1 for 48 h.

Analysis of transcripts of CCR2, MCP-1, TGF-ß1, and pro-{alpha}1 chain of type I collagen (COL1A1)
Total RNA was isolated by guanidinium thiocyanate-phenol-chloroform extraction [19 ]. cDNA was reverse-transcripted from 1 µg total RNA by using a SuperScript II RNase H– reverse transcriptase (RT; Invitrogen, Carlsbad, CA). RT was performed using the following parameters: 10 min at 25°C, 30 min at 48°C, and 5 min at 95°C. To determine transcripts of MCP-1, TGF-ß1, and COL1A1, quantitative real-time RT-polymerase chain reaction (real-time PCR) was performed on the ABI Prism 7900HT sequence detection system (Applied Biosystems, Foster City, CA), using 384-well microtiter plates. Real-time PCR were are performed in a total volume of 20 µl, containing 1 µl cDNA sample, TaqMan gene expression assays (Applied Biosystems), and TaqMan universal PCR mater mix (Applied Biosystems), using the universal temperature cycles: 10 min at 94°C, followed by 40, two temperature cycles (15 s at 94°C and 1 min at 60°C). Assay IDs of TaqMan gene expression assays were Hs00234140_m1 for MCP-1, Hs00171257_m1 for TGF-ß1, Hs00164004_m1 for COL1A1, and Hs99999905_m1 for glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The mRNA expression of MCP-1, TGF-ß1, and COL1A1 in each sample was finally described after correction with ß-glucuronidase expression. No PCR product was detected in the real-time PCR procedure without RT, indicating that the contamination of genomic DNA was negligible. Gels of the PCR products, after quantification of MCP-1, TGF-ß1, and COL1A1 by real-time PCR, showed a single band (data not shown). Similarly, to determine CCR2 transcripts, the cDNA products from total RNA were amplified by semiquantitative RT-PCR. Primers for CCR2 (AS 5'-TCTCACTGCCCTATGCCTCT-3'; sense 5'-GGATTGAACAAGGACGCATT-3') were used to detect CCR2 transcripts [20 ]. The amplification profile for CCR2 was described previously [20 ]. Primers for housekeeping gene GAPDH (AS, TCCACCACCCTGTTGCTGTA; sense, TCCTGCACCACCAACTGCTT) were used for PCR controls. Scanner analysis of photographs of the DNA-stained agarose gels was evaluated by the band intensity comparison of GAPDH expression versus CCR2 expression in computer image analysis.

Enzyme-linked immunosorbent assay (ELISA)
To determine the protein levels of TGF-ß1, supernatants of the samples were evaluated using the commercial Quantikine TGF-ß1 ELISA kit in accordance with the protocol specified by the manufacture (R&D Systems Inc.).

Western blot analysis
Western blot analysis was performed as described before [21 ]. Briefly, the cell extracts from each experiment were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes (Nippon Bio-Rad Lab., Tokyo, Japan). After incubation in blocking buffer containing 1% bovine serum albumin (Sigma Chemical Co., St. Louis, MO) and 0.1% Tween 20 (Polysciences Inc., Warrington, PA), membranes were incubated with primary antibody (rabbit anti-human type I collagen polyclonal antibodies, Polysciences Inc.; goat anti-human MCP-1 polyclonal antibodies, Santa Cruz Biotechnology, Inc., CA) overnight at 4°C. Then, membrane-derived protein bands were detected with 3,3' diaminobenzidine substrates (Dako, Glostrup, Denmark). As a positive control, purified human type I collagen (Biodesign International, Saco, ME) was used.

Fluorescent microscopy
To examine the uptake of phosphorothioate ODN, Mo were incubated in the presence of fluorescein isothiocyanate (FITC)-labeled phosphorothioate ODN (1 µmol/l) for 24 h, washed three times with phosphate-buffered saline (PBS), overlaid with PBS-glycerol (1:9), and then analyzed by fluorescence microscopy with an Olympus BH2 microscope in a FITC channel. In addition, the production of type I collagen protein was determined using rabbit anti-human type I collagen antibodies (Polysciences Inc.) as a primary antibody and a FITC-labeled antibody detecting rabbit immunoglobulin G as a second antibody.

Statistics
Statistical significance was determined using paired or unpaired Student’s t-test and Kruskal-Wallis test. P < 0.05 was considered to be statistically significant.


arrow
RESULTS
 
The effect of MCP-1 on the expression of CCR2 and MCP-1
To examine the effect of MCP-1 on the expression of CCR2 and MCP-1 in Mo, CD14-positive Mo were isolated from healthy donors and cultured in RPMI 1640 supplemented with 2.5% heat-inactivated FCS for 48 h with various concentrations of MCP-1. Stimulation with MCP-1 enhanced the expression of CCR2 mRNA (Fig. 1A ). Similarly, the levels of MCP-1 mRNA as well as protein were up-regulated by the stimulation with exogenous MCP-1 (Fig. 1B and 1C) in a dose-dependent manner, suggesting the presence of an autocrine/paracrine amplification loop as a result of the interaction of MCP-1 with CCR2.


Figure 1
View larger version (41K):
[in this window]
[in a new window]
  		Figure 1. Dose-dependent up-regulation of MCP-1 and CCR2 by MCP-1. CD14-positive Mo isolated from healthy donors were cultured in RPMI 1640 supplemented with 2.5% heat-inactivated FCS for 48 h with various concentrations of MCP-1. The stimulation with MCP-1 enhanced CCR2 mRNA (A), MCP-1 mRNA (B), and MCP-1 protein (C) in a dose-dependent manner.

In addition, to determine a time-dependent effect of MCP-1 on the expression of CCR2 and MCP-1, CD14-positive Mo were cultured with 10 ng/ml MCP-1 for 48 h. Enhanced mRNA levels of CCR2 and MCP-1 were observed in a time-dependent manner, which were followed by the up-regulation of MCP-1 protein (Fig. 2A 2B 2C ). It was also noted that more than 99% of the cells were judged to be Mo by morphology as well as positive staining for CD14 (LeuM3) after stimulation with recombinant human MCP-1, using a flow cytometric analysis (data not shown).


Figure 2
View larger version (35K):
[in this window]
[in a new window]
  		Figure 2. Up-regulation of MCP-1 and CCR2 by MCP-1 in a time-dependent manner. CD14-positive Mo isolated from healthy donors were cultured in RPMI 1640 supplemented with 2.5% heat-inactivated FCS and 10 ng/ml MCP-1 for 48 h. The stimulation with MCP-1 enhanced CCR2 mRNA (A), MCP-1 mRNA (B), and MCP-1 protein (C) in a time-dependent manner.

The effect of MCP-1 on the expression of TGF-ß1 and COL1A1
To investigate the impact of MCP-1 on the expression of TGF-ß1 and COL1A1 mRNAs, CD14-positive Mo were cultured under the same conditions as described above for 48 h. The stimulation with MCP-1 enhanced TGF-ß1 and COL1A1 mRNAs in a dose- and time-dependent manner (Fig. 3A and 3B ). In addition to mRNA up-regulation of COL1A1, the up-regulation of type I collagen protein was detected in cell extracts of Mo by Western blot analysis (Fig. 3C) and by fluorescent microscopy (Fig. 3D) . Similarly, the concentration of the TGF-ß1 protein in the supernatant was increased by the stimulation with MCP-1 (Fig. 3E) .


Figure 3
View larger version (39K):
[in this window]
[in a new window]
  		Figure 3. Effect of MCP-1 on the expression of type I collagen and TGF-ß1. CD14-positive Mo isolated from healthy donors were cultured in RPMI 1640 supplemented with 2.5% heat-inactivated FCS for 48 h with various concentrations of MCP-1. Stimulation with MCP-1 enhanced TGF-ß1 and COL1A1 mRNA expression in a dose-dependent manner (A). In addition, CD14-positive Mo were incubated with 10 ng/ml MCP-1 for 48 h. The levels of TGF-ß1 and COL1A1 mRNA were up-regulated in a time-dependent manner by stimulation with MCP-1 (B). The production of type I collagen protein was detected by Western blot analysis (C) and fluorescent microscopy (D). The concentration of TGF-ß1 protein in the supernatant was also increased by the stimulation with MCP-1 (E).

Effect of pretreatment with MCP-1-specific AS-ODN on the expression of MCP-1, TGF-ß1, and COL1A1
MCP-1-AS-ODN was used to determine the contribution of the autocrine loop of MCP-1 leading to the expression of type I collagen in Mo. CD14-positive Mo isolated from healthy donors were incubated with FITC-labeled phosphorothioate ODN (1 µmol/l) for 24 h. MCP-1-AS-ODN and MCP-1-Scr-ODN were each detected predominantly in the cell cytoplasm by fluorescent microscopy (data not shown) as shown previously [15 ]. Pretreatment with MCP-1-AS-ODN reduced protein levels of MCP-1, as compared with those pretreated with MCP-1-Scr-ODN (Fig. 4A ). In contrast, MCP-1 mRNA levels did not differ between these two groups (Fig. 4B) . It was reported previously that the MCP-1-AS-ODN, used in this study, suppressed the secretion of MCP-1 protein but not MCP-1 mRNA levels, suggesting that a translational arrest of MCP-1 was induced by MCP-1-AS-ODN [15 ]. In addition, pretreatment with MCP-1-AS-ODN reduced the expression of TGF-ß1, as compared with those pretreated with MCP-1-Scr-ODN (Fig. 4C and see Fig. 6A ). It was also noted that the levels of type I collagen mRNA were suppressed by pretreatment with MCP-1-AS-ODN (Fig. 4C) , suggesting that up-regulated expression of TGF-ß1 and type I collagen was partially dependent on endogenous MCP-1.


Figure 4
View larger version (48K):
[in this window]
[in a new window]
  		Figure 4. Effect of pretreatment with MCP-1-AS-ODN on the expression of MCP-1, TGF-ß1, and type I collagen. Pretreatment with MCP-1-AS-ODN reduced protein levels of MCP-1, as compared with those pretreated with MCP-1-Scr-ODN (A). In contrast, MCP-1 mRNA levels did not differ between these two groups (B). n.s., Not significant. In addition, pretreatment with MCP-1-AS-ODN reduced the expression of TGF-ß1, as compared with those pretreated with MCP-1-Scr-ODN (C). It was also noted that the levels of type I collagen mRNA were suppressed by pretreatment with MCP-1-AS-ODN (C).


Figure 6
View larger version (28K):
[in this window]
[in a new window]
  		Figure 6. Effect of pretreatment with AS-ODN on the production of TGF-ß1 protein. Pretreatment with MCP-1-AS-ODN reduced protein levels of TGF-ß1, as compared with those pretreated with MCP-1-Scr-ODN (A). In addition, pretreatment with TGF-ß1-AS-ODN suppressed the endogenous production of TGF-ß1 protein by the stimulation with MCP-1.

Reduction of COL1A1 transcripts by TGF-ß1-specific AS-ODN
Similarly, TGF-ß1-AS-ODN was used to examine the effects of TGF-ß1 on the expression of COL1A1 mRNA in Mo. It was reported previously that the TGF-ß1-AS-ODN used in this study suppressed the secretion of TGF-ß1 protein but not TGF-ß1 mRNA levels, suggesting that a translational arrest of TGF-ß1 was induced by TGF-ß1-AS-ODN [16 ]. Pretreatment with TGF-ß1-AS-ODN reduced the levels of TGF-ß1 protein and COL1A1 mRNA, as compared with those pretreated with TGF-ß1-Scr-ODN (Figs. 5A and 6B ). In contrast, TGF-ß1 mRNA levels did not differ between these two groups (Fig. 5B) . These results suggest the presence of the amplifying loop for type I collagen expression via endogenous production of TGF-ß1 induced by the stimulation with MCP-1 in Mo.


Figure 5
View larger version (22K):
[in this window]
[in a new window]
  		Figure 5. TGF-ß1-AS-ODN reduced type I collagen mRNA expression. Pretreatment with TGF-ß1-AS-ODN reduced the levels of COL1A1 mRNA, as compared with those pretreated with TGF-ß1-Scr-ODN (A). However, there was no difference in TGF-ß1 mRNA levels (B).

CCR2 inhibitors reduce the expression of MCP-1, TGF-ß1, and COL1A1
Finally, to determine whether the MCP-1-induced up-regulation of COL1A1 is dependent on CCR2, propagermanium and RS-504393, which are inhibitors of the MCP-1/CCR2 signaling pathway, were used in this study [11 , 17 , 18 ]. The up-regulated mRNA expression of COL1A1 was reduced by pretreatment with propagermanium or RS-504393, which was associated with reduced expression of MCP-1 mRNA and TGF-ß1 mRNA as well as TGF-ß1 protein (Figs. 7 and 8A and 8B ). These findings strongly suggest that the MCP-1-dependent amplification loop for fibrogenic response in Mo was regulated by CCR2 signaling.


Figure 7
View larger version (33K):
[in this window]
[in a new window]
  		Figure 7. The up-regulation of type I collagen and MCP-1 by the stimulation with MCP-1 was CCR2-dependent. MCP-1-induced up-regulation of COL1A1 (A) and MCP-1 (B) mRNA was reduced by pretreatment with propagermanium or RS-504393. *, P < 0.05.


Figure 8
View larger version (29K):
[in this window]
[in a new window]
  		Figure 8. The up-regulation of TGF-ß1 by the stimulation with MCP-1 was CCR2-dependent. MCP-1-induced up-regulation of TGF-ß1 mRNA (A) as well as protein (B) was inhibited by pretreatment with propagermanium or RS-504393. *, P < 0.05.


arrow
DISCUSSION
 
The present study demonstrated that MCP-1-stimulated blood Mo contribute directly to the fibrogenesis through the production of type I collagen. This idea is based on the findings that the mRNA expression of COL1A1 as well as protein was up-regulated in a dose- and time-dependent manner by stimulation with MCP-1; stimulation with MCP-1 augmented the expression of MCP-1 and CCR2; treatment with MCP-1- or TGF-ß1-specific AS-ODN reduced MCP-1-induced COL1A1 transcripts; and transcripts of COL1A1 were suppressed by pretreatment with CCR2 inhibitors (propagermanium and RS-504393). These findings suggest that peripheral Mo might be involved in the development of fibrogenesis by the autocrine/paracrine production of MCP-1 and TGF-ß1 through a MCP-1/CCR2-dependent amplification loop as illustrated in Figure 9 . Therefore, we propose that the MCP-1/CCR2-dependent loop may be an appealing, therapeutic target for progressive fibrosis.


Figure 9
View larger version (13K):
[in this window]
[in a new window]
  		Figure 9. Scheme for the MCP-1/CCR2 amplification loop for type I collagen synthesis. This study suggests that peripheral CD14-positive Mo are involved directly in the fibrogenesis through the production of type I collagen via the autocrine/paracrine production of MCP-1 and TGF-ß1 through the MCP-1/CCR2-dependent amplification loop. TGFR, Transforming growth factor receptor.

Progressive organ fibrosis is characterized pathologically by the presence of infiltrating Mo and accumulation of ECM, including type I collagen. Thus far, Mo are thought to be involved in the development of fibrosis by secreting various cytokines and growth factors including TGF-ß1 [4 , 22 ]. In support of this notion, we have reported that the blockade of the MCP-1/CCR2 signaling pathway using antibodies neutralizing MCP-1 and CCR2 antagonists reduces renal fibrosis in various kidney disease models, which was similar to inhibitory effects obtained from CCR2-deficient mice [11 12 13 ]. In fact, the MCP-1/CCR2 signaling pathway is commonly involved in the pathogenesis of progressive fibrosis as a result of various etiologies in human renal diseases [2 ]. Furthermore, in this regard, the MCP-1/CCR2 signaling pathway is also involved in the progression of fibrosis in other organs including lung, heart, and vasculature [7 , 8 , 23 ]. From these points of view, the MCP-1/CCR2 signaling pathway may be the underlying cause of fibrosis in various organs. Therefore, our results suggest that Mo might contribute directly to the pathogenesis of progressive fibrosis through the MCP-1/CCR2-dependent amplification loop in various diseases.

Recently, it has been suggested that peripheral blood fibrocytes, which differentiate from a CD14-positive cell population, have been claimed to participate in tissue fibrosis [24 ]. However, it usually takes 14–21 days for fibrocytes to differentiate from CD14-positive cells in medium supplemented with 20% FCS. Furthermore, fibrocytes do not express CD14 any more [24 ]. In this study, CD14-positive Mo, incubated with medium, supplemented with 2.5% FCS, were investigated only 48 h after stimulation with MCP-1. Therefore, the cells used in this study are classical peripheral Mo rather than peripheral fibrocytes.

The function of chemokine is mediated through seven-transmembrane spanning, GTP-binding, protein-coupled receptors [5 ]. However, the mechanism of signal transduction via CCR2 mediated by MCP-1 has not been investigated fully. A recent report demonstrated that MCP-1 stimulates the mitogen-activated protein kinase (MAPK) family including extracellular signal-regulated kinases, c-Jun NH2-terminal kinase/stress-activated protein kinase, and p38 MAPK in the Mono Mac6 cell line [25 ]. Of note, the expression of MCP-1, TGF-ß1, and type I collagen is also regulated by the MAPK family in vitro [26 27 28 ]. In this study, therefore, the activation of the MAPK family might be involved in a MCP-1/CCR2-dependent amplification loop for fibrogenesis in human Mo. In addition, it was reported that TGF-ß1 induces the expression of MCP-1 via the activation of transcriptional factor activated protein-1 (AP-1) in an ectoblastic cell line [29 ]. Therefore, endogenous TGF-ß1-dependent expression of MCP-1 and type I collagen observed in this study may be induced by the activation of AP-1 following MAPK activation. However, it was also reported that treatment of macrophages with TGF-ß1 inhibited the induction of MCP-1 by LPS, thereby suggesting that TGF-ß1 functions as an inhibitor of MCP-1 expression [30 ]. Further studies will be required to elucidate the precise signal transduction of the MCP-1/CCR2-dependent amplification loop.

It is important that the stimulation with MCP-1 augments the gene expression of type I collagen via endogenous production of TGF-ß1 in the lung fibroblast [31 ], as was observed in this study using Mo. Conversely, MCP-1 has shown to be involved in the production of matrix metalloproteinase-1, which has enzymatic activity as interstitial collagenase in vitro [32 ]. It is interesting that the expression of the tissue inhibitor of metalloproteinase-1 is also up-regulated by the stimulation with MCP-1 [32 ]. Therefore, MCP-1 might be involved in the pathogenesis of two different conditions toward fibrotic or antifibrotic events. Further studies will be required to investigate distinct roles of MCP-1/CCR2 in the pathogenesis of fibrogenesis.

In summary, these data suggest that peripheral Mo are directly involved in the fibrogenesis via a MCP-1/CCR2-dependent amplification loop, which may provide a novel, therapeutic target for diminishing fibrosis, resulting in end-stage organ failure.


arrow
ACKNOWLEDGEMENTS
 
T. W. is a recipient of a Grant-in-Aid from the Ministry of Education, Science, Sport and Culture in Japan. This work is supported in part by a Grant-in-Aid from the Ministry of Health, Labor and Welfare of Japan. We thank Drs. Hiroyuki Hashimoto and Yoshiro Ishiwata for providing us with propagermanium and RS-504393. We also thank Drs. Joost J. Oppenheim and Teizo Yoshimura [National Cancer Institute-Frederick Cancer Research and Development Center (FCRDC)] for their critical reviews of this article.

Received March 5, 2005; accepted October 19, 2005.


arrow
REFERENCES
 
    1
  1. Mukaida, N., Harada, A., Matsushima, K. (1998) Interleukin-8 (IL-8) and monocyte chemotactic and activating factor (MCAF/MCP-1), chemokines essentially involved in inflammatory and immune reactions Cytokine Growth Factor Rev. 9,9-23[CrossRef][Medline]
    2. 2
  2. Wada, T., Matsushima, K., Yokoyama, H. (2003) Chemokines as therapeutic targets for renal diseases Curr. Medicinal Chem. Anti-Inflammatory & Anti-Allergy Agents 2,175-190[CrossRef]
    3. 3
  3. Hinglais, N., Heudes, D., Nicoletti, A., Mandet, C., Laurent, M., Bariety, J., Michel, J. B. (1994) Colocalization of myocardial fibrosis and inflammatory cells in rats Lab. Invest. 70,286-294[Medline]
    4. 4
  4. Border, W. A., Noble, N. A. (1994) Transforming growth factor ß in tissue fibrosis N. Engl. J. Med. 331,1286-1292[Free Full Text]
    5. 5
  5. Luster, A. D. (1998) Chemokines—chemotactic cytokines that mediate inflammation N. Engl. J. Med. 338,436-445[Free Full Text]
    6. 6
  6. Segerer, S., Nelson, P. J., Schlöndorff, D. (2000) Chemokines, chemokine receptors, and renal disease: from basic science to pathophysiologic and therapeutic studies J. Am. Soc. Nephrol. 11,152-176[Abstract/Free Full Text]
    7. 7
  7. Suga, M., Iyonaga, K., Ichiyasu, H., Saita, N., Yamasaki, H., Ando, M. (1999) Clinical significance of MCP-1 levels in BALF and serum in patients with interstitial lung diseases Eur. Respir. J. 14,376-382[Abstract]
    8. 8
  8. Lehmann, M. H., Kuhnert, H., Muller, S., Sigusch, H. H. (1998) Monocyte chemoattractant protein 1 (MCP-1) gene expression in dilated cardiomyopathy Cytokine 10,739-746[CrossRef][Medline]
    9. 9
  9. Wada, T., Furuichi, K., Segawa, C., Shimizu, M., Sakai, N., Takeda, S., Takasawa, K., Kida, H., Kobayashi, K., Mukaida, N., Ohmoto, Y., Matsushima, K., Yokoyama, H. (1999) MIP-1{alpha} and MCP-1 contribute to crescents and interstitial lesions in human crescentic glomerulonephritis Kidney Int. 56,995-1003[CrossRef][Medline]
    10. 10
  10. Moore, B. B., Paine, R. I. I. I., Christensen, P. J., Moore, T. A., Sitterding, S., Ngan, R., Wilke, C. A., Kuziel, W. A., Toews, G. B. (2001) Protection from pulmonary fibrosis in the absence of CCR2 signaling J. Immunol. 167,4368-4377[Abstract/Free Full Text]
    11. 11
  11. Kitagawa, K., Wada, T., Furuichi, K., Hashimoto, H., Ishiwata, Y., Asano, M., Takeya, M., Kuziel, W. A., Matsushima, K., Mukaida, N., Yokoyama, H. (2004) Blockade of CCR2 ameliorates progressive fibrosis in kidney Am. J. Pathol. 165,237-246[Abstract/Free Full Text]
    12. 12
  12. Wada, T., Furuichi, K., Sakai, N., Iwata, Y., Kitagawa, K., Ishida, Y., Kondo, T., Hashimoto, H., Ishiwata, Y., Mukaida, N., Tomosugi, N., Matsushima, K., Egashira, S., Yokoyama, H. (2004) Gene therapy via blockade of monocyte chemoattractant protein-1 for renal fibrosis J. Am. Soc. Nephrol. 15,940-948[Abstract/Free Full Text]
    13. 13
  13. Wada, T., Yokoyama, H., Furuichi, K., Kobayashi, K., Harada, K., Naruto, M., Su, S. B., Akiyama, M., Mukaida, N., Matsushima, K. (1996) Intervention of crescentic glomerulonephritis by antibodies to monocyte chemotactic and activating factor (MCAF/MCP-1) FASEB J. 10,1418-1425[Abstract]
    14. 14
  14. Hashimoto, S., Suzuki, T., Dong, H. Y., Nagai, S., Yamazaki, N., Matsushima, K. (1999) Serial analysis of gene expression in human monocyte-derived dendritic cells Blood 94,845-852[Abstract/Free Full Text]
    15. 15
  15. Maus, U. A., Herold, S., Schlingensiepen, K. H., Schlingensiepen, R., Dormayr, T., Rosseau, S., Maus, R., Seeger, W., Lohmeyer, J. (2000) Antisense oligomers for selective suppression of MCP-1 synthesis in human pulmonary endothelial cells Antisense Nucleic Acid Drug Dev. 10,185-193[Medline]
    16. 16
  16. Jachimczak, P., Hessdörfer, B., Schulte, K. F., Wismeth, C., Brysch, W., Schlingensiepen, K. H., Bauer, A., Blesch, A., Bogdahn, U. (1996) Transforming growth factor-ß-mediated autocrine growth regulation of gliomas as detected with phosphorothioate antisense oligonucleotides Int. J. Cancer 65,332-337[CrossRef][Medline]
    17. 17
  17. Yokochi, S., Hashimoto, H., Ishiwata, Y., Shimokawa, H., Haino, M., Terashima, Y., Matsushima, K. (2001) An anti-inflammatory drug, propagermanium, may target GPI-anchored proteins associated with an MCP-1 receptor, CCR2 J. Interferon Cytokine Res. 21,389-398[CrossRef][Medline]
    18. 18
  18. Mirzadegan, T., Diehl, F., Ebi, B., Bhakta, S., Polsky, I., McCarley, D., Mulkins, M., Weatherhead, G. S., Lapierre, J. M., Dankwardt, J., Morgans, D., Wilhelm, R., Jarnagin, K. (2000) Identification of the binding site for a novel class of CCR2b chemokine receptor antagonists J. Biol. Chem. 275,25562-25571[Abstract/Free Full Text]
    19. 19
  19. Chomczynski, P., Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction Anal. Biochem. 162,156-159[Medline]
    20. 20
  20. Weber, K. S. C., Nelson, P. J., Gröne, H. J., Weber, C. (1999) Expression of CCR2 by endothelial cells implicartions for MCP-1-mediated wound injury repair and in vivo inflammatory activation of endothelium Arterioscler. Thromb. Vasc. Biol. 19,2085-2093[Abstract/Free Full Text]
    21. 21
  21. Wada, T., Furuichi, K., Sakai, N., Hisada, Y., Kobayashi, K., Mukaida, N., Tomosugi, N., Matsushima, K., Yokoyama, H. (2001) Involvement of p38 mitogen-activated protein kinase followed by chemokine expression in crescentic glomerulonephritis Am. J. Kidney Dis. 38,1169-1177[Medline]
    22. 22
  22. Schneider, A., Panzer, U., Zahner, G., Wenzel, U., Wolf, G., Thaiss, F., Helmchen, U., Stahl, R. A. K. (1999) Monocyte chemoattractant protein-1 mediates collagen deposition in experimental glomerulonephritis by transforming growth factor-ß Kidney Int. 56,135-144[CrossRef][Medline]
    23. 23
  23. Takeya, M., Yoshimura, T., Leonard, E. J., Takahashi, K. (1993) Detection of monocyte chemoattractant protein-1 in human atherosclerotic lesions by an anti-monocyte chemoattractant protein-1 monoclonal antibody Hum. Pathol. 24,534-539[CrossRef][Medline]
    24. 24
  24. Abe, R., Donnelly, S. C., Peng, T., Bucala, R., Metz, C. N. (2001) Peripheral blood fibrocytes: differentiation pathway and migration to wound sites J. Immunol. 166,7556-7562[Abstract/Free Full Text]
    25. 25
  25. Cambien, B., Pomeranz, M., Millet, M. A., Rossi, B., Schmid-Alliana, A. (2001) Signal transduction involved in MCP-1-mediated monocytic transendothelial migration Blood 97,359-366[Abstract/Free Full Text]
    26. 26
  26. Rovin, B. H., Wilmer, W. A., Danne, M., Dickerson, J. A., Dixon, C. L., Lu, L. (1999) The mitogen-activated protein kinase p38 is necessary for interleukin 1ß-induced monocyte chemoattractant protein 1 expression by human mesangial cells Cytokine 11,118-126[CrossRef][Medline]
    27. 27
  27. Weigert, C., Sauer, U., Brodbeck, K., Pfeiffer, A., Haring, H. U., Schleicher, E. D. (2000) AP-1 proteins mediate hyperglycemia-induced activation of the human TGF-ß1 promoter in mesangial cells J. Am. Soc. Nephrol. 11,2007-2016[Abstract/Free Full Text]
    28. 28
  28. Sato, M., Shegogue, D., Gore, E. A., Smith, E. A., McDermott, P. J., Trojanowska, M. (2002) Role of p38MAPK in transforming growth factor ß stimulation of collagen production by scleroderma and healthy dermal fibroblasts J. Invest. Dermatol. 118,704-711[CrossRef][Medline]
    29. 29
  29. Takeshita, A., Chen, Y., Watanabe, A., Kitano, S., Hanazawa, S. (1995) TGF-ß induces expression of monocyte chemoattractant JE/monocyte chemoattractant protein 1 via transcriptional factor AP-1 induced by protein kinase in osteoblastic cells J. Immunol. 155,419-426[Abstract]
    30. 30
  30. Kitamura, M. (1997) Identification of an inhibitor targeting macrophage production of monocyte chemoattractant protein-1 as TGF-ß1 J. Immunol. 159,1404-1411[Abstract]
    31. 31
  31. Gharaee-Kermani, M., Denholm, E. M., Phan, S. H. (1996) Costimulation of fibroblast collagen and transforming growth factor ß1 gene expression by monocyte chemoattractant proten-1 via specific receptors J. Biol. Chem. 271,17779-17784[Abstract/Free Full Text]
    32. 32
  32. Yamamoto, T., Eckes, B., Mauch, C., Hartmann, K., Krieg, T. (2000) Monocyte chemoattractant protein-1 enhances gene expression and synthesis of matrix metalloproteinase-1 in human fibroblasts by an autocrine IL-1{alpha} loop J. Immunol. 164,6174-6179[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Toxicol PatholHome page
Y. Mori, T. Izawa, S. Takenaka, M. Kuwamura, and J. Yamate
Participation of Functionally Different Macrophage Populations and Monocyte Chemoattractant Protein-1 in Early Stages of Thioacetamide-induced Rat Hepatic Injury
Toxicol Pathol, June 1, 2009; 37(4): 463 - 473.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
C. Mitchell, D. Couton, J.-P. Couty, M. Anson, A.-M. Crain, V. Bizet, L. Renia, S. Pol, V. Mallet, and H. Gilgenkrantz
Dual Role of CCR2 in the Constitution and the Resolution of Liver Fibrosis in Mice
Am. J. Pathol., May 1, 2009; 174(5): 1766 - 1775.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
N. G. Frangogiannis, O. Dewald, Y. Xia, G. Ren, S. Haudek, T. Leucker, D. Kraemer, G. Taffet, B. J. Rollins, and M. L. Entman
Critical Role of Monocyte Chemoattractant Protein-1/CC Chemokine Ligand 2 in the Pathogenesis of Ischemic Cardiomyopathy
Circulation, February 6, 2007; 115(5): 584 - 592.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0305127v1
79/3/555    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sakai, N.
Right arrow Articles by Kaneko, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sakai, N.
Right arrow Articles by Kaneko, S.