Journal of Leukocyte Biology Myeloid cells, immune suppression, tumor immunology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.0805438 on December 5, 2005

Published online before print December 5, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0805438v1
79/2/408    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fronhofer, V.
Right arrow Articles by Loegering, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fronhofer, V.
Right arrow Articles by Loegering, D. J.
(Journal of Leukocyte Biology. 2006;79:408-415.)
© 2006 by Society for Leukocyte Biology

Role of PKC isoforms in the Fc{gamma}R-mediated inhibition of LPS-stimulated IL-12 secretion by macrophages

Van Fronhofer*, Michelle R. Lennartz{dagger} and Daniel J. Loegering*,1

* Centers for Cardiovascular Sciences and
{dagger} Cell Biology and Cancer Research, Albany Medical College, New York

1 Correspondence: Center for Cardiovascular Sciences (MC8), Albany Medical College, 47 New Scotland Avenue, Albany, NY 12208-3479. E-mail: loegerd{at}mail.amc.edu


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Ligation of Fc receptors for immunoglobulin G (Fc{gamma}Rs) inhibits lipopolysaccharide (LPS)-stimulated secretion of interleukin (IL)-12 by macrophages. Fc{gamma}R activation of protein kinase C (PKC) contributes to several functions of this receptor including phagocytosis, activation of the reduced nicotinamide adenine dinucleotide phosphate oxidase, and secretion of certain cytokines. Therefore, we tested the hypothesis that PKC mediates the Fc{gamma}R inhibition of IL-12 secretion by macrophages. In murine macrophages, Fc{gamma}R ligation augmented LPS-stimulated activation of PKC-{alpha} and PKC-{delta} but reduced IL-12p40 secretion. Similarly, activation of PKC with phorbol 12-myristate 13-acetate (PMA) depressed LPS-stimulated IL-12p40 secretion, and depletion of PKC augmented LPS-stimulated IL-12p40 secretion. Antisense down-regulation of PKC-{delta} increased LPS-stimulated IL-12p40 secretion and fully prevented the effects of Fc{gamma}R ligation or PMA on IL-12p40 secretion. In contrast, down-regulation of PKC-{epsilon} blocked LPS-stimulated secretion of IL-12p40. Down-regulation of PKC-{alpha} had no effect on LPS-stimulated IL-12p40 secretion. The results suggest a negative role for PKC-{delta} and a positive role for PKC-{epsilon} in the regulation of LPS-stimulated IL-12p40 secretion.

Key Words: cytokines • signal transduction • PKC • Fc{gamma}R • LPS • IL-12 • macrophage


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Interleukin (IL)-12 is a proinflammatory cytokine, which stimulates T cells to secret T helper cell type 1 (Th1) cytokines including interferon-{gamma} (IFN-{gamma}), tumor necrosis factor {alpha} (TNF-{alpha}), macrophage-colony stimulating factor (M-CSF), granulocyte M-CSF, IL-2, IL-3, and IL-8 [1 ]. Macrophages are a major source of IL-12 and can be stimulated to secrete IL-12 by a variety of microorganisms or microbial products including lipopolysaccharide (LPS) from the cell walls of gram-negative bacteria, lipotichoic acid from gram-positive bacteria, and zymosan from yeast. Overproduction of IL-12 has been implicated in the pathophysiology of several Th1 cell-mediated autoimmune and inflammatory diseases including multiple sclerosis, diabetes mellitus, colitis, rheumatoid arthritis, septic shock, and atherosclerosis [2 3 4 5 6 7 8 9 ]. IL-12 deficiency may promote Th2 cell-mediated pathology, contributing to asthma, tuberculosis, human immunodeficiency virus, and tumor growth [10 11 12 ].

IL-12 is a 70-kDa heterodimeric protein composed of p35 and p40 subunits. The p40 subunit is produced primarily by macrophages and is highly inducible, and the p35 subunit is constitutively expressed in many cell types. The p70 heterodimer binds the IL-12 receptor and stimulates T cells. However, the p40 subunit can form a heterodimer with p19 to form IL-23, which has functions that overlap with IL-12 [13 14 15 16 ].

The control of IL-12 secretion is complex and can be influenced by ligation of several receptors including the Fc receptor for immunoglobulin G (IgG; Fc{gamma}R) and complement and scavenger receptors. Costimulation of macrophages with ligands for these receptors and LPS causes a substantial decrease in IL-12 secretion [17 18 19 20 21 ]. Ma and co-workers [22 ] have shown that Fc{gamma}R ligation causes a decrease in LPS-stimulated IL-12 message, indicating that this effect is at the level of transcription. Berger et al. [17 ] demonstrated that in monocytes, ligation of Fc{gamma}R with immune complexes inhibits LPS-stimulated IL-12 secretion by a combination of augmented IL-10, TNF, and prostaglandin production. However, activation of Fc{gamma}R in macrophages from IL-10 null mice also inhibits LPS-stimulated IL-12 secretion, suggesting that the Fc{gamma}R effect can be independent of increased IL-10 production [18 ]. Finally, Fc{gamma}R ligation was able to sufficiently inhibit the proinflammatory effects of LPS to improve survival in mice with endotoxemia [18 ].

How Fc{gamma}R signaling influences LPS-stimulated cytokine secretion by macrophages is not fully known. As protein kinase C (PKC) is activated by Fc{gamma}R ligation and is involved in the signaling for phagocytosis, respiratory burst, and secretion of some cytokines [23 24 25 26 27 ], it is reasonable to postulate that PKC may also be involved in regulating LPS-stimulated secretion of IL-12. Indeed, it has been shown that PKC inhibitors reduce IL-12p40 secretion stimulated by adrenergic receptor agonists in macrophages, and PKC-{epsilon} is necessary for LPS-stimulated IL-12 secretion in dendritic cells (DC) [28 , 29 ]. These studies suggest a positive role for PKC activation in IL-12 secretion.

PKC is a family of serine/threonine kinases with at least 11 different isoforms, which are classified into three subgroups dependent on the cofactors required for activation. The classic PKC isoforms {alpha}, ßI, ßII, and {gamma} require Ca++, diacylglycerol, and phosphatidylserine for activation, and novel isoforms {delta}, {epsilon}, {eta}, and {phi} are Ca++-independent but still require diacylglycerol for activation, and activation of the atypical group {iota}/{lambda}, {zeta}, and µ does not require Ca ++ or diacylglycerol.

The present study examined the role of three PKC isoforms, which we have previously shown to be activated by Fc{gamma}R ligation in macrophages [23 , 25 ] in LPS-stimulated IL-12p40 secretion. The results show that PKC-{epsilon} is required for LPS-stimulated IL-12p40 secretion by peritoneal macrophages. In addition, down-regulation of PKC-{delta} increased LPS-stimulated IL-12p40 secretion and prevented the effects of the Fc{gamma}R, suggesting that PKC-{delta} has a negative effect on IL-12p40 and may mediate the inhibitory effects of the Fc{gamma}R on IL-12p40 production.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Macrophage isolation
Elicited peritoneal macrophages were obtained from male Swiss Webster or C57BL/6 mice 2 or 3 days after an intraperitoneal injection of 2 ml 3% thioglycolate. Macrophages from these strains gave similar results. Cells were washed three times and were resuspended in RPMI media (Cellgro/Mediatech Inc., Herndon, VA) supplemented with 10% bovine calf serum, L-glutamine, sodium pyruvate, nonessential amino acids, and antibiotics. Cells were added to 48-well tissue-culture plates at 5 x 105 cells per well. Nonadherent cells were removed by washing after incubation for 2 h, and the resulting monolayers were 95% macrophages by histological morphology.

Protocol
Macrophages were stimulated with LPS (100 ng/ml, Escherichia coli 0111:B4) for 24 h, and the media were stored at –80°C until assayed for cytokine levels. Macrophages were incubated with PKC inhibitors (Biomol, Plymouth Meeting, PA) for 30 min prior to stimulation with LPS. Ligation of Fc{gamma}R was induced with IgG-coated glass beads (BIgG), which were prepared by coating glass beads (2 um diameter) with poly-l-lysine, albumin, and antialbumin IgG as described previously [30 ]. BIgG were added at the same time as LPS or 1, 3, or 6 h after LPS stimulation. For PKC activation with phorbol 12-myristate 13-acetate (PMA), macrophages were simultaneously stimulated with PMA (5 or 50 ng/ml) and LPS for 24 h. In some experiments, PMA (5 ng/ml) was given 1, 3, or 6 h after LPS stimulation.

PKC depletion with PMA
Macrophages were incubated with PMA (5 or 50 ng/ml) for 24 h, washed, and stimulated with LPS (100 ng/ml) for an additional 24 h, after which the cells were lysed in radio immunoprecipitation assay (RIPA) buffer [50 mM Tris, 150 mM NaCl, 12.7 mM deoxycholic acid, 10 mM Na-pyrophosphate, 25 mM Na-B-glycerophosphate, 1 mM Na orthovanadate, 0.1% sodium dodecyl sulfate (SDS), 0.1% Triton, and protease inhibitors]. Cell lysates were sonicated briefly, and proteins were resolved using 10% SDS-polyacrylamide gel electrophoresis, and loading was normalized for protein. Separated proteins were transferred to nitrocellulose for Western blot analysis. Monoclonal antibodies to PKC-{alpha} and -{delta} were obtained from Transduction Labs (San Diego, CA). Polyclonal antibodies against PKC-ß and -{epsilon} were obtained from Santa Cruz Biotechnology Inc. (CA). Secondary antibody goat anti-rabbit horseradish peroxidase (HRP) was obtained from Santa Cruz Biotechnology Inc., and secondary antibody rabbit anti-mouse HRP was obtained from Jackson Labs (Bar Harbor, ME). Antibody was detected with Supersignal enhanced chemiluminescence reagent (Pierce, Rockford, IL) and quantified by densitometry.

Preparation of membrane fractions
Macrophages were stimulated with LPS or LPS and BIgG for 5, 15, 30, or 60 min. Membrane fractions were prepared essentially as described previously [31 ]. Briefly, cells were washed with phosphate-buffered saline, scraped off the plates in lysis buffer containing 25 mM Tris-HCl (pH 7.4), 2.5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 2.5 mM dithiothreitol, 2 mM Na3VO4, 4 ug/mL leupeptin, 30 ug/mL phenylmethanesulfonyl fluoride, and 250 mM sucrose, and lysed by sonication. Cell lysates were centrifuged at 1000 g (10 min) to remove intact cells and nuclei. The supernatant was centrifuged at 100,000 g (1 h, 4°C). The supernatant containing the cytosol was removed and saved; the pellet (membrane fraction) was dissolved in RIPA buffer.

Down-regulation of PKC with antisense oligonucleotides
Macrophages were treated with deoxyoligonucleotides for 24 h prior to stimulation. Deoxyoligonucleotides were complexed with Oligofectamine (Qiagen, Valencia, CA) according to the manufacturer’s instructions. Antisense sequences for PKC-{alpha} (CAGCCATGGTTCCCCCCAAC), PKC-{delta} (TCAGGCCCTGCAGGATCTCA), and PKC-{epsilon} (GCCAGCTCGATCTTGCGCCC) and scrambled sequences for PKC-{alpha} (CCAGTCACTCGCACCATCGC), PKC{delta} (TCCAGGTCAACGCGGCATTC), and PKC-{epsilon} (GTCCATGCGACGTCCGCTGC) were synthesized by Sigma Genosys (The Woodlands, TX) and phosphorothioated on the first two and last two linkages to prevent degradation. Deoxyoligonucleotides were added to cells at a final concentration of 800 nM per 1 million cells. Levels of PKC protein expression were determined via Western blot.

Cytokine assay
Levels of IL-12p40 and TNF-{alpha} in media were determined using OptEIA enzyme-linked immunosorbent assay (ELISA) sets from BD PharMingen (San Diego, CA). Recombinant murine IL-12p40 and TNF-{alpha} were used for standards.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Fc{gamma}R ligation and activation of PKC with PMA have similar effects on LPS-stimulated IL-12p40 secretion by macrophages
Although normally not included in the signaling pathways for Toll-like receptors (TLR), PKC has been implicated in the regulation of LPS-stimulated secretion of IL-12 [3 , 28 , 32 , 33 ]. Fc{gamma}R ligation, which we have shown to activate PKC, inhibits LPS-stimulated IL-12p40 secretion in macrophages [17 18 19 20 , 22 , 34 ]. To investigate the effects of PKC activation on IL-12p40 secretion, we combined LPS stimulation with Fc{gamma}R ligation or PMA (a nonspecific PKC activator). Ligation of Fc{gamma}R with BIgG at the same time as LPS stimulation caused a dose-dependent inhibition of IL-12p40 secretion. Control beads coated with bovine serum albumin alone (BBSA) did not alter LPS-stimulated IL-12p40 secretion (Fig. 1A ). Neither unstimulated macrophages nor macrophages incubated with BIgG alone secreted detectable levels of IL-12p40 (data not shown).


Figure 1
View larger version (22K):
[in this window]
[in a new window]
  		Figure 1. Ligation of Fc{gamma}R and PMA has similar effects on LPS-stimulated secretion of IL-12p40 by macrophages, which (A) were stimulated with LPS (100 ng/ml) plus BIgG (0, 1, 3, or 10 beads per macrophage). BBSA served as the control. (B) Macrophages were stimulated with LPS (100 ng/ml) plus PMA (0, 5, or 50 ng/ml). For both experiments, the media were collected after 24 h, and IL-12p40 levels were determined by ELISA. Results are the mean ± SEM of four experiments.

 
Treatment of macrophages with PMA at the same time as LPS mimicked the effect of Fc{gamma}R ligation. Indeed, the magnitude of change in IL-12p40 secretion caused by PMA was similar to that caused by Fc{gamma}R ligation (Fig. 1B) . This observation is consistent with the hypothesis that Fc{gamma}R and PMA are activating a similar signaling pathway. To determine if the effects of Fc{gamma}R ligation and PMA were specific to IL-12p40, we measured TNF-{alpha} production. Under identical conditions, BIgG or PMA treatment did not inhibit TNF-{alpha} secretion (Fig. 2A and 2B ).


Figure 2
View larger version (25K):
[in this window]
[in a new window]
  		Figure 2. Ligation of Fc{gamma}R and PMA has little effect on LPS-stimulated TNF-{alpha} secretion. (A) Macrophages were stimulated with LPS (100 ng/ml) plus BIgG (10 beads per macrophage). BBSA served as the control. (B) Macrophages were stimulated with LPS (100 ng/ml) plus PMA (50 ng/ml). For both experiments, the media were collected after 24 h, and TNF-{alpha} levels were determined by ELISA. Results are the mean ± SEM of four experiments.

 
Fc{gamma}R ligation alters LPS-stimulated activation of PKC
We have previously demonstrated that Fc{gamma}R ligation translocates PKC-{alpha}, -{delta}, and -{epsilon} to membranes in RAW 264.7 cells [23 ]. These are the primary PKC isoforms expressed in RAW 264.7 cells. Treatment of mouse peritoneal macrophages with PMA (50 ng/ml for10 min) elicited membrane translocation of PKC-{alpha}, -{delta}, and -{epsilon} (Fig. 3A ). LPS stimulation caused a time-dependent membrane translocation of PKC-{alpha}, -{delta}, and -{epsilon}, which peaked at 15 min (Fig. 3B) . Membrane localization of PKC had returned to baseline levels by 3 h after LPS stimulation (data not shown). PKC membrane localization was measured at 15 min after LPS stimulation in subsequent experiments.


Figure 3
View larger version (21K):
[in this window]
[in a new window]
  		Figure 3. Ligation of Fc{gamma}R alters LPS-stimulated translocation of PKC isoforms to the plasma membrane. (A) Western blots of the membrane fraction from macrophages stimulated with PMA for 10 min. (B) Western blots of the membrane fraction from macrophages stimulated with LPS (100 ng/ml) for the indicated minutes after LPS (MIN. W/LPS). (C) Western blots of the membrane fraction from macrophages that were not treated (NT), stimulated with LPS (100 ng/ml), or stimulated with LPS plus BIgG (three beads per macrophage). (D) Densitometry of blots from the experiment shown in C. Results are the mean ± SEM for three experiments.

 
It is important that when Fc{gamma}R ligation was combined with LPS, the membrane localization of PKC-{alpha} and -{delta} was augmented, and the membrane localization of PKC-{epsilon} was decreased (Fig. 3C and 3D) . These data demonstrate that Fc{gamma}R ligation alters LPS-stimulated PKC activation and taken together with the effects of PMA, support a role for PKC in the Fc{gamma}R-mediated inhibition of IL-12p40 production.

PKC depletion augments LPS-stimulated IL-12p40 secretion
Prolonged treatment with PMA is known to deplete diacylglycerol-sensitive PKC isoforms by proteolytic degradation, which follows activation. PMA was used here to determine the role of PKC in the signaling pathway for LPS-stimulated IL-12p40 secretion, as has been done for other signaling pathways [35 , 36 ]. Incubation of macrophages with 5 or 50 ng/ml PMA for 24 h caused a dose-dependent loss of PKC-{alpha} and -{delta} protein, and the levels of PKC-{epsilon} were less affected (Fig. 4A and 4B ). The blots in Figure 4A were overdeveloped to improve detection of any remaining protein in cells treated with PMA. Loss of PKC-{alpha} and PKC-{delta} correlated with an increase in IL-12p40 secretion of 2.7- and 4.5-fold for the 5 and 50 ng/ml doses of PMA, respectively (Fig. 4C) . These results suggest that PKC-{alpha} and/or PKC -{delta} have a negative effect on LPS-stimulated IL-12p40 secretion. This is also consistent with the observation that Fc{gamma}R-mediated activation of PKC-{alpha} and -{delta} inhibited IL-12 secretion.


Figure 4
View larger version (18K):
[in this window]
[in a new window]
  		Figure 4. Depletion of PKC with PMA pretreatment augments LPS-stimulated IL-12p40 secretion. (A) Western blots of whole cell lysates from macrophages treated with PMA (0, 5, or 50 ng/ml) for 24 h. (B) Densitometry of blots for the experiment shown in A. (C) IL-12 p40 levels secreted by macrophages treated with PMA for 24 h, washed, and then stimulated with LPS (100 ng/ml). Media were collected 24 h after LPS, and IL-12p40 levels were determined by ELISA. Results are the mean ± SEM of four experiments.

 
Selective depletion of PKC with antisense oligonucleotides alters LPS-stimulated cytokine secretion
As prolonged PMA treatment may globally affect cell function, we used antisense oligonucleotides to selectively down-regulate PKC-{alpha}, -{delta}, and -{epsilon}. This treatment blocked protein expression of the targeted isoforms, and there was no effect on the levels of the other PKC isoforms (Fig. 5A ). Scrambled sequences were ineffective. Antisense down-regulated cells were tested for LPS-stimulated secretion of IL-12p40 or TNF-{alpha}. Loss of PKC-{alpha} had no effect on IL-12p40 or TNF-{alpha} secretion (Fig. 5B) . However, down-regulation of PKC-{delta} augmented LPS-stimulated IL-12p40 secretion twofold and decreased TNF-{alpha} production (Fig. 5C) . As this result implicated PKC-{delta} in the inhibition of LPS-stimulated IL-12p40 secretion, and Fc{gamma}R ligation activates PKC-{delta}, we determined if the loss of PKC-{delta} impacted the effects of Fc{gamma}R-mediated signaling on LPS-stimulated IL-12p40 secretion. Indeed, Fc{gamma}R ligation significantly suppressed IL-12p40 secretion in control macrophages but not in PKC-{delta} down-regulated cells (Fig. 5D) . Similar results were seen when PMA was used to activate PKC (Fig. 5D) .


Figure 5
View larger version (28K):
[in this window]
[in a new window]
  		Figure 5. Down-regulation of individual PKC isoforms with antisense oligonucleotides alters LPS-stimulated secretion of IL-12p40 and TNF-{alpha}. (A) Western blot of whole cell lysates from macrophages treated with antisense (AS) oligonucleotides or scrambled sequence (SC) oligonucleotides for 24 h. Additional controls were not treated or were treated with oligofectamine (OF) without oligonucleotides. (B) LPS-stimulated IL-12p40 and TNF-{alpha} secretion by macrophages treated with PKC-{alpha} antisense oligonucleotide. (C) LPS-stimulated IL-12p40 and TNF-{alpha} secretion by macrophages treated with PKC-{delta} antisense oligonucleotide. (D) IL-12p40 secretion by macrophages treated with antisense PKC-{delta} and then stimulated with LPS (100 ng/ml), LPS plus BIgG (three beads per macrophage), or LPS plus PMA (50 ng/ml). (E) LPS-stimulated IL-12p40 and TNF-{alpha} secretion by macrophages treated with PKC-{epsilon} antisense oligonucleotide. Media were collected 24 h after LPS, and cytokine levels were determined by ELISA. Results are the mean ± SEM of three experiments.

 
In contrast to the effects seen with PKC-{delta}, down-regulation of PKC-{epsilon} with antisense oligonucleotides completely blocked the LPS-stimulated secretion of IL-12p40 and TNF-{alpha} (Fig. 5E) . This is consistent with previous work and shows that PKC-{epsilon} is required for the secretion of these cytokines [24 , 28 ]. The role of PKC-{epsilon} in the inhibitory effect of Fc{gamma}R ligation or PMA could not be determined, as IL-12p40 production could not be detected in macrophages with antisense, down-regulated PKC-{epsilon}. These results suggest that PKC-{epsilon} is a positive regulator of IL-12 and that PKC-{delta} negatively regulates IL-12 in response to stimulation with LPS and ligation of Fc{gamma}R. This represents an interesting paradigm, where two novel isoforms of PKC have opposing roles in the regulation of an important cytokine.

Several studies have shown that PKC can have effects on cell function, which are independent of kinase activity [37 , 38 ]. To determine if PKC-{delta} or PKC-{epsilon} kinase activity is required for its role in the control of LPS-stimulated IL-12p40 secretion, the PKC inhibitors GF109203X and Rottlerin were studied. GF109203X, an adenosine 5'-triphosphate-binding site inhibitor, which inhibits classic and the novel isoforms, including PKC-{epsilon} at 30 uM [31 , 35 , 39 ], caused a profound inhibition of LPS-stimulated IL-12p40 secretion (Fig. 6A ). This verifies that PKC activity is required for the secretion of IL-12p40. Rottlerin, an inhibitor of PKC-{delta}, had effects similar to that of depletion of this isoform with antisense by augmenting LPS-stimulated IL-12p40 secretion and preventing the inhibitory effects of the Fc{gamma}R ligation (Fig. 6B and 6C) . Thus, the pharmacological studies are consistent with the molecular depletion studies and support a model in which the Fc{gamma}R-dependent inhibition of LPS-induced IL-12p40 secretion is mediated by PKC-{delta}, and LPS-mediated signaling for IL-12 secretion is dependent on PKC-{epsilon} activity.


Figure 6
View larger version (10K):
[in this window]
[in a new window]
  		Figure 6. Effects of PKC inhibitors on LPS-stimulated IL-12p40. (A) Macrophages were untreated (control) or treated with GF109203X (30 uM; GF) prior to and during stimulation with LPS (100 ng/ml). (B) Macrophages were untreated or treated with Rottlerin (10 uM; Rott) prior to and during stimulation with LPS (100 ng/ml). (C) Macrophages were treated with LPS (100 ng/ml), Rottlerin (10 uM) plus LPS (L/Rot), LPS plus BIgG (three beads/macrophage; L/B), or Rottlerin, LPS, and BIgG (L/B/Rot). Media were collected 24 h after LPS, and IL-12p40 levels were determined by ELISA. Results are the mean ± SEM of four experiments.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
PKC is a family of multifunctional serine/threonine kinases involved with the regulation of a number of macrophage functions including phagocytosis, respiratory burst, and secretion of certain cytokines. Our studies and those of others have shown that different PKC isoforms are involved with Fc{gamma}R-mediated phagocytosis of IgG-opsonized targets, respiratory burst, and TNF-{alpha} secretion. PKC-{epsilon} is required for Fc{gamma}R-mediated phagocytosis and LPS-stimulated TNF-{alpha} secretion, and PKC-{alpha} is required for the respiratory burst [23 24 25 26 27 ]. The study presented here evaluated the role of three primary PKC isoforms expressed in murine macrophages in the LPS-stimulated secretion of IL12p40.

IL-12p40 is half of a heterodimer (IL-12p70), which can influence the development of T cells and skew the immune response toward inflammation. IL-12p40 is highly inducible in response to LPS and represents an important cytokine in the host Th1 response to infection [5 6 7 , 40 , 41 ]. It is important to understand the regulation of IL-12 production in the context of multiple stimuli encountered by the macrophage during the course of an infection. Under these conditions, macrophages may encounter the positive effects of bacterial products acting through TLR as well as the inhibitory effects of Fc{gamma}R signaling if antibodies to the infecting pathogen are present.

The results of our study suggest that activation of PKC-{epsilon} is required for LPS-stimulated IL-12p40 and TNF-{alpha} secretion. Both cytokines were inhibited when PKC-{epsilon} was depleted with antisense and when GF109203X was used at a dose that inhibits PKC-{epsilon} (30 uM). Our results with IL-12p40 are consistent with the study by Aksoy et al. [28 ] using DC, which found that the general PKC inhibitor bisindolylmaleimide inhibited LPS-stimulated IL-12 secretion. In addition, it was found that inhibition of PKC-{epsilon} with specific peptide inhibitors had a similar effect. With regard to LPS-stimulated TNF-{alpha} secretion, our study is consistent with work done in peritoneal macrophages from PKC-{epsilon} null mice, where it was found that TNF-{alpha} production was reduced [24 ]. PKC-{epsilon} null mice were also found to be more susceptible to bacterial infection [24 ]. The positive effects of PKC-{epsilon} on inflammation have led to the conclusion that this PKC isoform is important in host defense [23 , 24 , 28 , 31 , 38 , 39 , 42 ].

In contrast to the positive role of PKC-{epsilon}, we demonstrate here for the first time a negative effect of PKC-{delta} activation on LPS-stimulated IL-12p40 secretion. Depletion of PKC-{delta} with antisense enhanced LPS-stimulated IL-12p40 secretion. Furthermore, the inhibitory effect of Fc{gamma}R ligation or PMA treatment on LPS-stimulated IL-12p40 secretion was prevented in PKC-{delta}-depleted cells and by the PKC-{delta} inhibitor Rottlerin. In contrast, PKC-{delta} had little effect on TNF-{alpha} secretion. It is interesting that PKC-{alpha} seems to have no role in the control of IL-12 production in response to LPS stimulation or Fc{gamma}R ligation. Thus, signaling via different PKC isoforms in response to multiple stimuli determines the amount of IL-12 secreted by macrophages.

Previous studies about the mechanism by which the Fc{gamma}R inhibits IL-12 have focused on changes in IL-12 transcription and IL-10 levels. Gerber and Mosser [18 ] found that Fc{gamma}R ligation suppresses LPS-stimulated IL-12 mRNA levels. Studies by Ma and co-workers [22 ] carried this one step further and showed that Fc{gamma}R ligation blocks the formation of a positive regulatory complex, which binds to the promoter of IL-12p40 at the Ets domain in response to LPS. This complex was found to contain several transcription factors including PU.1, IFN consensus sequence-binding protein (ICSBP), and c-Rel. Fc{gamma}R ligation inhibited the formation of this complex by preventing the translocation of PU.1 and ICSBP to the nucleus [22 ]. We did not measure message, as it has already been shown that the Fc{gamma}R effect is at the message level.

Fc{gamma}R ligation had only a minimal effect on the levels of LPS-stimulated message for several other cytokines [18 , 22 ]. The exception to this was an increase in IL-10 mRNA, which was associated with an increase in IL-10 secretion. IL-10 is well-known to inhibit the secretion of many inflammatory cytokines including IL-12. Indeed, Sutterwala et al. [19 ] found that media from macrophages stimulated with LPS plus Fc{gamma}R ligands inhibited LPS-stimulated IL-12 secretion by fresh macrophages, showing that enough IL-10 is produced to inhibit IL-12 secretion. It was also shown that neutralizing secreted IL-10 with antibodies results in increased IL-12 secretion by macrophages. However, a different approach demonstrated that the Fc{gamma}R effect could be independent of the increase in IL-10, as IL-12 secretion by macrophages from IL-10 null mice was equally inhibited by Fc{gamma}R ligation [18 ]. Therefore, an increase in IL-10 levels caused by Fc{gamma}R ligation may contribute to the inhibition of IL-12 secretion but is not required for the effect.

We have previously shown that ligation of Fc{gamma}R on macrophages activates PKC-{alpha}, -{delta}, and -{epsilon} based on translocation to membranes [23 ]. PKC-{alpha} and -{delta} moved to the plasma membrane, and PKC-{epsilon} moved to the forming phagocytic vacuole. The involvement of PKC-{epsilon} activation in phagocytosis may explain why we observed a decrease in PKC-{epsilon} in our membrane fraction, which did not contain the BIgG and their associated membrane. This may represent a functional separation of the PKC isoforms. PKC-{epsilon} may be involved in phagocytosis and the secretion of IL-12 p40. LPS stimulation may activate PKC-{epsilon} for IL-12p40 secretion by causing its translocation to the plasma membrane. However, when this is associated with Fc{gamma}R ligation, PKC-{epsilon} moves to the phagosome, and its positive role in the secretion of IL-12 is lost. In addition, the negative effects of PKC-{delta} on LPS-stimulated IL-12p40 secretion are no longer opposed by PKC-{epsilon}, and the production of this cytokine is greatly reduced.

The present study has implicated PKC as an important factor in determining the amount of IL-12p40 secreted by macrophages activated with LPS. It also shows that individual PKC isoforms may have differential effects on cytokine secretion. Our results verify that PKC-{epsilon} has a positive effect [28 ] but extend previous work by showing that PKC-{delta} has a negative effect in the regulation of LPS-stimulated IL-12p40 secretion by murine macrophages. These findings suggest that PKC-{delta} and PKC-{epsilon} may be good targets for the development of therapies to treat immune diseases. Studies are underway to determine the downstream signaling effects of individual PKC isoforms on IL-12 secretion.


   ACKNOWLEDGEMENTS
 
This study was supported by a grant from the New York State affiliate of the American Heart Association (0050893T) and the National Institutes of Health Pre/Postdoctoral Training Grant (T32-HL-07194). The authors thank Tara Bayly and Robert Rotundo for their technical assistance and Wendy Hobb for her administrative assistance.

Received August 5, 2005; revised August 24, 2005; accepted October 17, 2005.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kang, B. Y., Kim, E., Kim, T. S. (2005) Regulatory mechanisms and their therapeutic implications of interleukin-12 production in immune cells Cell. Signal. 17,665-673[Medline]
  2. Leonard, J. P., Waldburger, K. E., Goldman, S. J. (1995) Prevention of experimental autoimmune encephalomyelitis by antibodies against interleukin-12 J. Exp. Med. 181,381-386[Abstract/Free Full Text]
  3. Neurath, M. F., Fuss, I., Kelsall, B. L., Stuber, E., Strober, W. (1995) Antibodies to interleukin-12 abrogate established experimental colitis in mice J. Exp. Med. 182,1281-1290[Abstract/Free Full Text]
  4. Nitta, Y., Kawamoto, S., Tashiro, F., Aihara, H., Yoshimoto, T., Nariuchi, H., Tabayashi, K., Miyazaki, J. (2001) IL-12 plays a pathologic role at the inflammatory loci in the development of diabetes in NOD mice J. Autoimmun. 16,97-104[Medline]
  5. Kitching, A. R., Tipping, P. G., Holdsworth, S. R. (1999) IL-12 directs severe renal injury, crescent formation and Th1 responses in murine glomerulonephritis Eur. J. Immunol. 29,1-10[CrossRef][Medline]
  6. Adorini, L., Aloisi, F., Galbiati, F., Gately, M. K., Gregori, S., Penna, G., Ria, F., Smiroldo, S., Trembleau, S. (1997) Targeting IL-12, the key cytokine driving Th1-mediated autoimmune diseases Chem. Immunol. 68,175-197[Medline]
  7. Wysocka, M., Kubin, M., Vieira, L. Q., Ozmen, L., Garotta, G., Scott, P., Trinchieri, G. (1995) Interleukin-12 is required for interferon-{gamma} production and lethality in lipopolysaccharide-induced shock in mice Eur. J. Immunol. 25,672-676[Medline]
  8. Ozmen, L., Pericin, M., Hakimi, J., Chizzonite, R. A., Wysocka, M., Trinchieri, G., Gately, M., Garotta, G. (1994) Interleukin-12, interferon-{gamma}, and tumor necrosis-factor-{alpha} are the key cytokines of the generalized Shwartzman reaction J. Exp. Med. 180,907-915[Abstract/Free Full Text]
  9. Uyemura, K., Demer, L. L., Castle, S. C., Jullien, D., Berliner, J. A., Gately, M. K., Warrier, R. R., Pham, N., Fogelman, A. M., Modlin, R. L. (1996) Cross-regulatory roles of interleukin (IL)-12 and IL-10 in atherosclerosis J. Clin. Invest. 97,2130-2138[Medline]
  10. Gavett, S. H., Ohearn, D. J., Li, X. M., Huang, S. K., Finkelman, F. D., Willskarp, M. (1995) Interleukin-12 inhibits antigen-induced airway hyperresponsiveness, inflammation, and Th2 cytokine expression in mice J. Exp. Med. 182,1527-1536[Abstract/Free Full Text]
  11. Zitvogel, L., Lotze, M. T. (1995) Role of interleukin-12 (IL12) as an anti-tumor agent: experimental biology and clinical application Res. Immunol. 146,628-635[CrossRef][Medline]
  12. Zitvogel, L., Robbins, P. D., Storkus, W. J., Clarke, M. R., Maeurer, M. J., Campbell, R. L., Davis, C. G., Tahara, H., Schreiber, R. D., Lotze, M. T. (1996) Interleukin-12 and B7.1 co-stimulation cooperate in the induction of effective antitumor immunity and therapy of established tumors Eur. J. Immunol. 26,1335-1341[Medline]
  13. Bettelli, E., Kuchroo, V. K. (2005) IL-12- and IL-23-induced T helper cell subsets: birds of the same feather flock together J. Exp. Med. 201,169-171[Abstract/Free Full Text]
  14. Watford, W. T., Hissong, B. D., Bream, J. H., Kanno, Y., Muul, L., O’Shea, J. J. (2004) Signaling by IL-12 and IL-23 and the immunoregulatory roles of STAT4 Immunol. Rev. 202,139-156[CrossRef][Medline]
  15. Lieberman, L. A., Cardillo, F., Owyang, A. M., Rennick, D. M., Cua, D. J., Kastelein, R. A., Hunter, C. A. (2004) IL-23 provides a limited mechanism of resistance to acute toxoplasmosis in the absence of IL-12 J. Immunol. 173,1887-1893[Abstract/Free Full Text]
  16. Langrish, C. L., Chen, Y., Blumenschein, W. M., Mattson, J., Basham, B., Sedgwick, J. D., McClanahan, T., Kastelein, R. A., Cua, D. J. (2005) IL-23 drives a pathogenic T cell population that induces autoimmune inflammation J. Exp. Med. 201,233-240[Abstract/Free Full Text]
  17. Berger, S., Chandra, R., Ballo, H., Hildenbrand, R., Stutte, H. J. (1997) Immune complexes are potent inhibitors of interleukin-12 secretion by human monocytes Eur. J. Immunol. 27,2994-3000[Medline]
  18. Gerber, J. S., Mosser, D. M. (2001) Reversing lipopolysaccharide toxicity by ligating the macrophage Fc {gamma} receptors J. Immunol. 166,6861-6868[Abstract/Free Full Text]
  19. Sutterwala, F. S., Noel, G. J., Salgame, P., Mosser, D. M. (1998) Reversal of proinflammatory responses by ligating the macrophage Fc{gamma} receptor type I J. Exp. Med. 188,217-222[Abstract/Free Full Text]
  20. Sutterwala, F. S., Noel, G. J., Clynes, R., Mosser, D. M. (1997) Selective suppression of interleukin-12 induction after macrophage receptor ligation J. Exp. Med. 185,1977-1985[Abstract/Free Full Text]
  21. Jozefowski, S., Kobzik, L. (2004) Scavenger receptor A mediates H2O2 production and suppression of IL-12 release in murine macrophages J. Leukoc. Biol. 76,1066-1074[Abstract/Free Full Text]
  22. Grazia Cappiello, M., Sutterwala, F. S., Trinchieri, G., Mosser, D. M., Ma, X. (2001) Suppression of IL-12 transcription in macrophages following Fc {gamma} receptor ligation J. Immunol. 166,4498-4506[Abstract/Free Full Text]
  23. Larsen, E. C., DiGennaro, J. A., Saito, N., Mehta, S., Loegering, D. J., Mazurkiewicz, J. E., Lennartz, M. R. (2000) Differential requirement for classic and novel PKC isoforms in respiratory burst and phagocytosis in RAW 264.7 cells J. Immunol. 165,2809-2817[Abstract/Free Full Text]
  24. Castrillo, A., Pennington, D. J., Otto, F., Parker, P. J., Owen, M. J., Bosca, L. (2001) Protein kinase C {epsilon} is required for macrophage activation and defense against bacterial infection J. Exp. Med. 194,1231-1242[Abstract/Free Full Text]
  25. Larsen, E. C., Ueyama, T., Brannock, P. M., Shirai, Y., Saito, N., Larsson, C., Loegering, D., Weber, P. B., Lennartz, M. R. (2002) A role for PKC-{var{epsilon}} in Fc{{gamma}}R-mediated phagocytosis by RAW 264.7 cells J. Cell Biol. 159,939-944[Abstract/Free Full Text]
  26. Asehnoune, K., Strassheim, D., Mitra, S., Kim, J. Y., Abraham, E. (2005) Involvement of PKC {alpha}/ß in TLR4- and TLR2-dependent activation of NF-{kappa} B Cell. Signal. 17,385-394[CrossRef][Medline]
  27. Loegering, D. J., Lennartz, M. R. (2004) Signaling pathways for Fc {gamma} receptor-stimulated tumor necrosis factor-{alpha} secretion and respiratory burst in RAW 264.7 macrophages Inflammation 28,23-31[CrossRef][Medline]
  28. Aksoy, E., Amraoui, Z., Goriely, S., Goldman, M., Willems, F. (2002) Critical role of protein kinase C {epsilon} for lipopolysaccharide-induced IL-12 synthesis in monocyte-derived dendritic cells Eur. J. Immunol. 32,3040-3049[CrossRef][Medline]
  29. Kang, B. Y., Lee, S. W., Kim, T. S. (2003) Stimulation of interleukin-12 production in mouse macrophages via activation of p38 mitogen-activated protein kinase by {alpha}(2)-adrenoceptor agonists Eur. J. Pharmacol. 467,223-231[Medline]
  30. Lennartz, M. R., Lefkowith, J. B., Bromley, F. A., Brown, E. J. (1993) Immunoglobulin G-mediated phagocytosis activates a calcium-independent, phosphatidylethanolamine-specific phospholipase J. Leukoc. Biol. 54,389-398[Abstract]
  31. Thodeti, C. K., Nielsen, C. K., Paruchuri, S., Larsson, C., Sjolander, A. (2001) The {epsilon} isoform of protein kinase C is involved in regulation of the LTD4-induced calcium signal in human intestinal epithelial cells Exp. Cell Res. 262,95-103[CrossRef][Medline]
  32. Meisel, C., Vogt, K., Platzer, C., Randow, F., Liebenthal, C., Volk, H. D. (1996) Differential regulation of monocytic tumor necrosis factor-{alpha} and interleukin-10 expression Eur. J. Immunol. 26,1580-1586[Medline]
  33. Bennasser, Y., Bahraoui, E. (2002) HIV-1 Tat protein induces interleukin-10 in human peripheral blood monocytes: involvement of protein kinase C-ßII and -{delta} FASEB J. 16,546-554[Abstract/Free Full Text]
  34. Sutterwala, F. S., Mosser, D. M. (1999) The taming of IL-12: suppressing the production of proinflammatory cytokines J. Leukoc. Biol. 65,543-551[Abstract]
  35. Valledor, A. F., Xaus, J., Comalada, M., Soler, C., Celada, A. (2000) Protein kinase C {epsilon} is required for the induction of mitogen-activated protein kinase phosphatase-1 in lipopolysaccharide-stimulated macrophages J. Immunol. 164,29-37[Abstract/Free Full Text]
  36. von Knethen, A., Tautenhahn, A., Link, H., Lindemann, D., Brune, B. (2005) Activation-induced depletion of protein kinase C {alpha} provokes desensitization of monocytes/macrophages in sepsis J. Immunol. 174,4960-4965[Abstract/Free Full Text]
  37. Kiss, Z., Petrovics, G., Olah, Z., Lehel, C., Anderson, W. B. (1999) Overexpression of protein kinase C-{epsilon} and its regulatory domains in fibroblasts inhibits phorbol ester-induced phospholipase D activity Arch. Biochem. Biophys. 363,121-128[CrossRef][Medline]
  38. Dubyak, G. R., Kertesy, S. B. (1997) Inhibition of GTP {gamma} S-dependent phospholipase D and Rho membrane association by calphostin is independent of protein kinase C catalytic activity Arch. Biochem. Biophys. 341,129-139[CrossRef][Medline]
  39. Bey, E. A., Xu, B., Bhattacharjee, A., Oldfield, C. M., Zhao, X. X., Li, Q., Subbulakshmi, V., Feldman, G. M., Wientjes, F. B., Cathcart, M. K. (2004) Protein kinase C {delta} is required for P47(phox) phosphorylation and translocation in activated human monocytes J. Immunol. 173,5730-5738[Abstract/Free Full Text]
  40. Hasko, G., Szabo, C. (1999) IL-12 as a therapeutic target for pharmacological modulation in immune-mediated and inflammatory diseases: regulation of T helper 1/T helper 2 responses Br. J. Pharmacol. 127,1295-1304[Medline]
  41. Park, A. Y., Scott, P. (2001) Il-12: keeping cell-mediated immunity alive Scand. J. Immunol. 53,529-532[CrossRef][Medline]
  42. Aksoy, E., Goldman, M., Willems, F. (2004) Protein kinase C {epsilon}: a new target to control inflammation and immune-mediated disorders Int. J. Biochem. Cell Biol. 36,183-188[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
K. Dower, D. K. Ellis, K. Saraf, S. A. Jelinsky, and L.-L. Lin
Innate Immune Responses to TREM-1 Activation: Overlap, Divergence, and Positive and Negative Cross-Talk with Bacterial Lipopolysaccharide
J. Immunol., March 1, 2008; 180(5): 3520 - 3534.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
A. Schwegmann, R. Guler, A. J. Cutler, B. Arendse, W. G. C. Horsnell, A. Flemming, A. H. Kottmann, G. Ryan, W. Hide, M. Leitges, et al.
Protein kinase C {delta} is essential for optimal macrophage-mediated phagosomal containment of Listeria monocytogenes
PNAS, October 9, 2007; 104(41): 16251 - 16256.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. Khurana, L. N. Arneson, R. A. Schoon, C. J. Dick, and P. J. Leibson
Differential Regulation of Human NK Cell-Mediated Cytotoxicity by the Tyrosine Kinase Itk
J. Immunol., March 15, 2007; 178(6): 3575 - 3582.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
A. Shukla, K. M. Lounsbury, T. F. Barrett, J. Gell, M. Rincon, K. J. Butnor, D. J. Taatjes, G. S. Davis, P. Vacek, K. I. Nakayama, et al.
Asbestos-Induced Peribronchiolar Cell Proliferation and Cytokine Production Are Attenuated in Lungs of Protein Kinase C-{delta} Knockout Mice
Am. J. Pathol., January 1, 2007; 170(1): 140 - 151.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
K. S. Masek, J. Fiore, M. Leitges, S.-F. Yan, B. D. Freedman, and C. A. Hunter
Host cell Ca2+ and protein kinase C regulate innate recognition of Toxoplasma gondii
J. Cell Sci., November 1, 2006; 119(21): 4565 - 4573.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X. Zhou, W. Yang, and J. Li
Ca2+- and Protein Kinase C-dependent Signaling Pathway for Nuclear Factor-{kappa}B Activation, Inducible Nitric-oxide Synthase Expression, and Tumor Necrosis Factor-{alpha} Production in Lipopolysaccharide-stimulated Rat Peritoneal Macrophages
J. Biol. Chem., October 20, 2006; 281(42): 31337 - 31347.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0805438v1
79/2/408    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fronhofer, V.
Right arrow Articles by Loegering, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fronhofer, V.
Right arrow Articles by Loegering, D. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS