science pharmaceutical expo biotech jobs
Originally published online as doi:10.1189/jlb.0605326 on October 4, 2005

Published online before print October 4, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0605326v1
78/5/1175    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gupta, S.
Right arrow Articles by Elsner, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gupta, S.
Right arrow Articles by Elsner, J.
(Journal of Leukocyte Biology. 2005;78:1175-1184.)
© 2005 by Society for Leukocyte Biology

Cloning, expression, and functional characterization of cynomolgus monkey (Macaca fascicularis) CC chemokine receptor 1

Shipra Gupta*,{dagger}, Sandra Schulz-Maronde*,{dagger}, Christian Kutzleb{dagger}, Rudolf Richter{dagger}, Wolf-Georg Forssmann{ddagger}, Alexander Kapp*, Ulf Forssmann{dagger},1 and Jörn Elsner*,{dagger},§

* Departments of Dermatology and Allergology and
{ddagger} Pharmacology and Toxicology and
{dagger} IPF PharmaCeuticals GmbH, An-Institut, Hannover Medical School, Germany; and
§ Department of Dermatology and Allergology, Fachklinik Bad Bentheim, Germany

1Correspondence: IPF PharmaCeuticals GmbH, An-Institut of Hannover Medical School, Feodor-Lynen-Strasse 31, 30625 Hannover, Germany. E-mail: u.forssmann{at}ipf-pharmaceuticals.de


arrow
ABSTRACT
 
The CC chemokine receptor 1 (CCR1) has emerged as a relevant factor contributing to inflammatory diseases such as allergic asthma. Commonly used animal models of allergic airway inflammation, especially murine models, have certain limitations. The elaborate, nonhuman, primate models of asthma display the highest comparability with the situation in humans. These models play an important role in the understanding of the pathogenesis of asthma. To improve the understanding in cynomolgus monkey models, we identified and characterized CCR1 in this nonhuman primate. Initially, we cloned the cynomolgus monkey CCR1 (cCCR1) gene, and the sequence analysis revealed high homology at the nucleotide (92%) and amino acid (88.4%) levels with its human counterpart. Human embryonic kidney 293 cells were stably transfected with cCCR1 and used in functional assays. Among those CCR1 ligands tested, CCL14(9-74) was most potent in the induction of intracellular Ca2+ fluxes as observed for human CCR1 (hCCR1). Complete cross-desensitization could be achieved between CCL14(9-74) and CCL15. However, CCL3 could not fully abrogate the response to the potent ligand CCL14(9-74). Competition-binding studies with radiolabeled CCL3 concordantly showed that CCL14(9-74) has a higher affinity to cCCR1 than hCCL3. Moreover, differential tissue-specific expression of cCCR1 was investigated by real-time quantitative polymerase chain reaction, displaying the highest levels in spleen. This study adds basic information needed for the evaluation of the role of CCR1 in the pathophysiology of asthma using the highly relevant cynomolgus monkey model and in addition, aids in the preclinical evaluation of potential novel drugs targeting CCR1.

Key Words: G protein-coupled receptor • asthma • animal model • gene • signal transduction


arrow
INTRODUCTION
 
Chemokines are small chemotactic peptides, which represent the largest subfamily of cytokines. They attract and activate leukocytes, resulting in a pivotal role in autoimmune, inflammatory, viral, and allergic diseases [1 , 2 ]. Chemokines exert their effect on cell migration through the activation of seven transmembrane domain G protein-coupled receptors present on the surface of leukocytes [3 ]. Chemokines are divided into four subclasses on the basis of the arrangement of the amino terminal cysteine residues: CXC chemokine ligand (CXCL), CC chemokine ligand (CCL), XCL, and CX3CL. The subclasses differ partially in their biological activities to stimulate different types of leukocytes. It is generally accepted that CCLs act on CC chemokine receptors (CCRs) and CXCLs, on CXC chemokine receptors (CXCRs), although there are a few exceptions [3 ]. Until now, 10 CCRs and six CXCRs have been described [4 ].

The first human CCR, hCCR1, was discovered in 1993 and has been well described [5 , 6 ]. CCR1 binds and signals in response to a variety of chemokines, namely CCL3, CCL5, CCL7, CCL8, CCL13, CCL14, CCL15, and CCL23 [7 8 9 10 ]. This receptor is expressed ubiquitously on leukocytes, as it has been detected on neutrophils, monocytes, eosinophils, basophils, dendritic cells, and certain lymphocyte subtypes [11 , 12 ]. Recent publications indicate that CCR1 is not only involved in several physiological processes such as hematopoiesis [11 , 13 ] but also in the pathogenesis of various diseases including asthma [14 ], pulmonary infections [15 ], acute pancreatitis [16 ], multiple sclerosis [17 ], rheumatoid arthritis [18 ], wound healing [19 ], and organ transplantation [20 ].

Among the chemokine receptors studied, CCR3 plays a major role in allergic diseases [21 ] and has been well studied in the cynomolgus monkey [22 ]. Recently, there has been strong evidence of the importance of CCR1 in allergic inflammation. It appears that CCR1-mediated signaling [23 ] and its involvement in the airway remodeling responses contribute to the pathology of allergic airway diseases [24 ]. Thus, CCR1 seems to play a significant role with other specific chemokine receptors in inflammatory and especially allergic diseases.

The nonhuman, primate models established for asthma, until now, are cynomolgus monkey models inducing asthma by inhalation of Ascaris suum [25 ] or house dust mite [26 ] and a rhesus monkey model dependent on house dust mite inhalation [27 ]. Of these models, the best studied is the A. suum cynomolgus monkey model. These animal models of asthma have proven to be extremely valuable in demonstrating the characteristics of allergic asthma and also in the preclinical evaluation of potential drug candidates.

As yet, no study delineates cynomolgus monkey CCR1 (cCCR1) and its functional characteristics. In this study, we report the cloning of cCCR1 and the deduction of its nucleotide and amino acid sequence. cCCR1 was transfected in human embryonic kidney (HEK)293 cells, which were used to study the efficacy and potency of various hCCR1 ligands. Further, the activity of hCCR1 ligands on cCCR1 and hCCR1 was compared. In addition, we performed competition-binding studies and assessed the differences in affinities of various ligands for cCCR1. Moreover, the differential expression of cCCR1 in different tissues of cynomolgus monkey was analyzed. Thus, this study identifies cCCR1 as a functional homologue of hCCR1 and facilitates the in vivo investigations in cynomolgus monkey asthma models.


arrow
MATERIALS AND METHODS
 
Chemokines
hCCL3 was purchased from ImmunoTools (Friesoythe, Germany); murine CCL3 (mCCL3), from Peprotech (Rocky Hill, NJ); and hCCL14, CCL14(9-74), and CCL15(27-92), produced in-house using N-(9-fluorenyl)-methoxycarbonyl chemistry as described [28 ].

RNA extraction and preparation of cDNA
Spleen and blood samples of three different monkeys were purchased from Covance (Münster, Germany). The RNA was isolated from blood using the PAXgene blood RNA validation kit (Pre-Analytix, Hilden, Germany) according to the manufacturer’s protocol. RNA was isolated from the spleen using the RNeasy mini kit (Qiagen, Hilden, Germany) and the manufacturer’s protocol. All samples were DNase-treated using DNaseI (Gibco, Eggenstein, Germany) prior to cDNA synthesis. cDNA was generated using the SuperScript first-strand synthesis system for reverse transcriptase-polymerase chain reaction (RT-PCR; Invitrogen, Karlsruhe, Germany). oligo (dT) and random hexamers (both from Invitrogen) were used to prime first-strand synthesis.

Cloning of cCCR1
As the hCCR1 gene is intronless, it was hypothesized that the cCCR1 should also lack introns. The PCR was then performed on the cynomolgus cDNA using primers designed from the 5' and 3' untranslated regions of the hCCR1 gene. The 5' primer CCTTGGAACCAGAGAGAAGCC (5'–3') contained the sequence 3–24 bp upstream of the ATG initiation codon. The 3' primer GCTGTGACTCCATGCTGTGCC (5'–3') contained the sequence 96–116 bp downstream of the termination codon. PCR was performed using FailSafe PCR buffer K and the Failsafe PCR enzyme mix of the FailSafe PCR premix selection kit (Epicentre Technologies, Madison, WI) for 35 cycles: 94°C for 20 s, 60°C for 1 min, and 72°C for 1.30 min, with an initial denaturation in the first cycle at 94°C for 2 min and a final extension at 72°C for 7 min in a Perkin-Elmer Life Sciences model Gene Amp PCR System 2400 DNA thermal cycler (Perkin-Elmer, Jügesheim, Germany). The resultant PCR products were subcloned into expression vector pcDNA3.1 TOPO using the pcDNA3.1/V5-His TOPO-TA expression kit (Invitrogen). The consensus sequence was obtained by DNA sequencing of four independent clones from each of the three different individuals. The sequencing was performed using the ABI PRISMTM 310 genetic analyzer (Applied Biosystems, Darmstadt, Germany) and analyzed on the Vector NTI software (Invitrogen) to determine the consensus sequence.

Cell lines and transfection of cCCR1 in HEK293
The cCCR1 containing pcDNA3.1 TOPO vectors was isolated and prepared by Endo-Free plasmid maxi kit (Qiagen) and transfected in HEK293 using the Effectane transfection reagent (Qiagen) with the manufacturer’s protocol. The positive clones were selected by their ability to survive under G418 selection. Among the positive clones selected, one representative clone was chosen for further analysis based on its ability to respond to hCCL3 and CCL14(9-74) in calcium mobilization assays. Stably transfected murine pre-B 300.19 cells expressing hCCR1 were obtained from Bernhard Moser (Theodor Kocher Institute, University of Berne, Switzerland).

Functional assays for ligand-induced intracellular calcium mobilization
The increase in intracellular calcium on stimulation with ligands in the HEK293 cell lines was performed on a fluorescence image plate reader (FLIPR) system (Molecular Devices, Munich, Germany) at a laser intensity of 0.4 W. The cells were loaded with 5 µM Fluo-4 (Molecular Probes, Karlsruhe, Germany) for 20 min at 37°C, shielded from light, and resuspended. The loading medium consisted of 5 µM Fluo-4 AM (Molecular Probes) in 1 ml Hanks’ buffered salt solution (HBSS)/20 mM HEPES (pH 7.4), containing 0.1% bovine serum albumin (BSA). Cells were washed twice with HBSS/20 mM HEPES (pH 7.4) containing 0.1% BSA, resuspended in washing buffer (1.6x106 cells/ml), and seeded in 96-well black plates (Costar, Bethesda, MD; 2.5x106 cells/well), and the plate was then centrifuged for 2 min. The cells were placed in the FLIPR system, and changes in cellular fluorescence were recorded after addition of the various chemokine samples (50 µl; diluted and concentration-adjusted in HBSS/20 mM HEPES buffer). Wherever mentioned, a second stimulus was applied after an interval of 90 s. The data are expressed as an original plot or as effective concentration 50% (EC50) values, which were calculated using the nonlinear regression analysis in Prism 3.03 (GraphPad Software Inc., San Diego, CA). In the comparative studies, the data are expressed as percentages of the maximal fluorescence intensity units (FIU).

Pertussis toxin (PTX) treatment
PTX (Sigma-Aldrich, Munich, Germany) treatment was performed by incubation of 1 x 106 cells/ml for 120 min at 37°C, with and without 2 µg/ml PTX as described elsewhere [29 ]. The cells were then washed and resuspended in test medium prior to the measurement of intracellular calcium release induced by CCR1 ligands in FLIPR. Viability of cells after PTX treatment was more than 95%, as assessed by trypan blue staining and counting in a hemocytometer.

Chemokine receptor-binding assays
125I-hCCL3 was purchased from Perkin-Elmer Life Sciences with a specific activity of ~2200 Ci/mM. Cells (1.4–1.5x106) in a final volume of 25 µl were incubated with 0.1 nM 125I-CCL3 in RPMI 1640, 25 mM HEPES, 0.1% BSA, 0.05% NaN3, pH 7.4, and varying concentrations of unlabeled chemokines for 90 min as described earlier [30 ]. The same buffer additionally containing 0.5 M NaCl was added, and the samples were mixed and layered on silicone oil. The cells were pelleted through oil by centrifugation (10,000 g for 5 min) and counted in a 1470 Wizard {gamma}-counter (Wallac, Freiburg, Germany). Data are presented with subtraction of nonspecific binding. Curve fitting and subsequent data analysis were carried out using the Prism 3.03 software, and inhibitory concentration 50% (IC50) values were obtained by nonlinear regression analysis (GraphPad Software Inc.).

Quantitative PCR analysis
The cDNA from spleen and blood was prepared as described above, and the cDNA of all other tissues was purchased from BioCat GmbH (Heidelberg, Germany). The quantitative PCR was performed on a LightCycler (Roche Molecular Biochemicals, Mannheim, Germany) using Lightcycler® FastStart DNA MasterPLUSSYBR Green I (Roche Molecular Biochemicals) as described previously [31 ]. cCCR1 and ß-actin were amplified in a touchdown PCR program (target temperature, 68°C; secondary target temperature, 58°C; step size, 0.5; step delay, 1). In brief, after an initial denaturation step at 95°C for 10 min, amplification was performed using 35 cycles of denaturation (95°C for 10 s), annealing (63–56°C for 10 s: touchdown), and extension (72°C for 16 s). For the quantification of target efficiency, adjusted relative quantification was performed. The following primers were used for PCR amplification: cCCR1 sense: 5'-GACTATGGGGATGCAAC-3' and cCCR1 antisense: 5'-CCTCAAGGCAAACACG-3'; ß-actin sense: 5'-GAGCGGGAAATCGTGCGTGACATT-3' and ß-actin antisense: 5'-GAAGGTAGTTTCGTGGATGCC-3'. For quantitative analysis, standard curves for cCCR1 and ß-actin were created covering a range of six orders of magnitude by dilution series (dilutions from these standard curves were used as calibrators in further experiments). These standard curves describing the PCR efficiencies of the target (cCCR1 and the reference gene ß-actin) allow an efficiency-corrected quantification using the Relative Quantification software (Roche Molecular Biochemicals). The calibrator-normalized relative quantification results in a target concentration expressed relative to the concentration of the reference gene in the same sample material. The graphs were plotted using Prism 3.03 software.

Statistics
The number of experiments is stated in the legends of the figures as n. Unless otherwise stated, the data in the text and figures are expressed as mean ± SEM, as determined by Prism 3.03 software analysis.


arrow
RESULTS
 
Cloning and sequencing of CCR1 from Macaca fascicularis (cynomolgus monkey)
Based on the recent observations about the significant role of CCR1 in allergic inflammation and the importance of cynomolgus monkey models for the preclinical evaluation of novel drug candidates, we cloned the cCCR1 in pcDNA3.1/V5-His TOPO vector using primers designed from the 5'- and 3'- untranslated regions of the hCCR1 gene. The sequence of the cCCR1 gene contains an open-reading frame of 1065 nucleotides (Fig. 1A ) encoding a protein of 355 amino acids in length (Fig. 1B) . In continuation with this, the consensus sequence was derived by sequencing four different clones from each of the three different individuals. The analysis of the cCCR1 sequence revealed a nucleotide polymorphism of G or A at position 439. In two of the three monkeys, a G was present as in the rhesus, but one monkey had G and A. Change of G to A leads to a conserved amino acid change of isoleucine to valine (Fig. 1A) . Thus, throughout this report, we will consider G at position 439 and the amino acid isoleucine, respectively. Other nucleotide polymorphisms seen were A or G at position 630 and C or T at 996. However, both of these are silent changes (Fig. 1A) . Therefore, the sequence analysis revealed that the cCCR1 sequence is genetically distinct from the previously reported GenBank sequences but resembled primate CCR1 sequences.



View larger version (89K):
[in this window]
[in a new window]
 
Figure 1. Nucleotide sequence of cCCR1 with polymorphisms and amino acid alignment. (A) Nucleotide sequence of cCCR1. The consensus nucleotide sequence derived by sequencing clones from three different individuals is depicted. The nucleotide bases indicated in bold and in a rectangle mark the bases where cCCR1 differs from its closest homologue, the rhesus monkey CCR1. The bold, underlined bases indicate the positions where polymorphism exists within the cynomolgus species. (B) Amino acid sequence alignment of CCR1 from various species. Amino acid alignment of the predicted CCR1 sequences for cynomolgus monkey, rhesus monkey (Accession Number AF017282), humans (Accession Number NM_001295), marmoset monkey (Accession Number AF127528), rat (Accession Number NM_020542), and mouse (Accession Number NM_009912) was done using the AlignX tool of the VectorNTI software. The shaded region indicates a minimum of four identical residues.

The predicted amino acid sequence of cCCR1 and amino acid alignment with CCR1 of other primate and nonprimate species are depicted in Figure 1B . The data indicate that the cynomolgus monkey amino acid sequence differs from the rhesus at four distinct positions. These amino acids include position 5, aspartic acid for asparagine in rhesus; position 9, asparagine for aspartic acid of rhesus; position 185, similar to hCCR1 leucine in exchange for isoleucine in rhesus; and position 355, where the ultimate C-terminal amino acid is leucine for phenylalanine (Fig. 1B) . A further, comparative homology of cCCR1 at the nucleotide and amino acid levels with the CCR1 gene of other primate and nonprimate species, namely humans, rhesus monkey, marmoset monkey, rat, and mouse, is depicted in Table 1 . The homology of cCCR1 to rhesus CCR1 is 99% and 98.9% and to hCCR1, 92% and 88.4%, at the nucleotide and amino acid level, respectively (Table 1) .


View this table:
[in this window]
[in a new window]
 
Table 1. Sequence Homology of cCCR1 at the Nucleotide and Amino Acid Level with Other Species

Expression of inhibitory G (Gi) protein-coupled cCCR1 in HEK293
To assess the function of the cCCR1 cloned in the expression vector pcDNA3.1/V5-His TOPO, we transfected this newly found receptor into wild-type HEK293 cells for further characterization. Positive clones were picked by their ability to grow under G418 selection. The stably transfected clones were further screened by their response to various hCCR1 ligands by measuring intracellular calcium mobilization using the FLIPR. A stable clone was used for further investigations.

To investigate the potency and the efficacy of different hCCR1 ligands on the cCCR1 cell line, we analyzed ligand-induced intracellular calcium mobilization by FLIPR. For each ligand tested, EC50 values were calculated from the plotted dose-response curves (Fig. 2A ). The rank order of potency observed for the CCR1 ligands was CCL14(9-74; EC50=12.66 nM) > CCL15 (EC50=13.91 nM) > CCL3 (EC50=113.8 nM) > CCL14 (EC50=392.6 nM). CCL14(9-74) was also the most effective compound at the concentrations tested (Fig. 2A) . For further assays, hereafter, CCL14(9-74) was chosen, as it is the most potent and effective cCCR1 ligand.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 2. Potency and efficacy of hCCR1 ligands on the PTX-sensitive cCCR1 cell line. (A) The cCCR1-expressing cells were used to study the dose-dependent response of various hCCR1 ligands by measuring intracellular calcium mobilization using the FLIPR. EC50 values, expressed in nM concentration, were calculated from the dose-response curves. All values are the mean ± SEM for nine independent experiments. (B) The cCCR1-expressing, stable HEK293 cell line was preincubated for 2 h with (dotted line) and without (solid line) 2 µg/ml PTX. The cell viability was greater than 95%, as assessed by trypan blue staining. Thereafter, the cells were stimulated with the most potent cCCR1 ligand CCL14(9-74). One representative experiment out of three is shown.

To investigate whether the transfected cCCR1 is a Gi protein-coupled receptor, we preincubated the cCCR1 cell line with PTX prior to stimulation with the CCR1 agonist CCL14(9-74). Subsequently, intracellular calcium flux was examined by the FLIPR assay. As seen in Figure 2B , the cCCR1 activity was abolished completely by PTX pretreatment. The wild-type HEK293 cell line, however, did not respond to stimulation (data not shown), indicating the specificity of the ligand binding to CCR1. Thus, the cCCR1 is functionally expressed as a Giprotein-coupled receptor in the HEK293 cell line.

Comparison of the effects of hCCR1 ligands on cCCR1 and hCCR1
To further analyze the effect of the differences of amino acids noted between human and cCCR1 amino acid sequences, we made a comparison of the efficacy and potency of CCL3, CCL14(9-74), and CCL15 on stable human and cCCR1-expressing cell lines. Calcium flux was measured on activation by these ligands at different concentrations.

The comparative analysis revealed that CCL14(9-74) is not only the most potent ligand on cCCR1 but also the most efficacious (Fig. 3 ). The efficacy of CCL14(9-74) was comparable with CCL15 on hCCR1. In summary, on both species tested for CCR1, hCCL14(9-74) and hCCL15 show a higher potency and efficacy than hCCL3.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 3. Comparison of CCL3, CCL14(9-74), and CCL15 activity on cCCR1- and hCCR1-transfected cell lines. A comparison of the efficacies and potencies regarding the mobilization of intracellular calcium induced by human ligands was performed on cCCR1 and hCCR1. The mean value ± SEM of five independent experiments under identical conditions is shown.

Homologous desensitization of cCCR1 with different CCR1 ligands
To study homologous desensitization of cCCR1 by hCCR1 ligands, calcium release in cCCR1 cell lines was monitored in response to sequential stimulation at equimolar concentrations (100 nM). It is interesting that CCL3 was not able to fully desensitize the cells to sequential CCL14(9-74) stimulation (Fig. 4 ). In contrast, CCL3 was able to fully desensitize CCL15 at equal doses. Conversely, stimulation of cCCR1 with CCL14(9-74) or CCL15 resulted in full desensitization of one and the other and also of CCL3 (Fig. 4) . These data indicate that hCCL14(9-74) and CCL15 are more potent than hCCL3 in desensitizing cCCR1 to its ligands based on a higher affinity.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 4. Cross-desensitization of hCCR1 ligands on cCCR1. Cross-desensitization experiments with hCCR1 ligands were performed using the cCCR1 cell line. Cells were sequentially stimulated vice versa at 90-s intervals with CCL3, CCL14(9-74), and CCL15, and intracellular calcium fluxes were recorded by FLIPR. The results are representative of four independent experiments for each of the ligands studied in pairs under identical conditions.

cCCR1 is specific for CCR1 ligands
To examine the specificity of cCCR1 for CCR1 ligands, cCCR1 cell lines were prestimulated with human ligands, which do not signal via CCR1 but are rather selective for other hCCRs. For this purpose, cCCR1-transfected cells were first stimulated with CCL2 (CCR2 ligand), CCL11 (CCR3 ligand), or CCL4 (CCR5 ligand) at 100 nM, and after an interval of 90 s, the cells were stimulated with CCL14(9-74) at 100 nM or 10 nM, and intracellular calcium flux was recorded (Fig. 4) . The cCCR1 showed no response to these human non-CCR1 ligands, and none of these ligands was able to affect the response to CCL14(9-74); Fig. 5 . These data indicate that the cloned cCCR1 is specific for CCR1 ligands.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 5. Responsiveness of cCCR1 to various CC chemokines specific for other CCRs. cCCR1-expressing cells were stimulated with the indicated human CC chemokines at 100 nM or buffer. After a 90-s interval, cells were stimulated sequentially with CCL14(9-74) at 100 nM (upper row) or 10 nM (lower row), and intracellular calcium fluxes were recorded by FLIPR. The tracings are representative of three to four separate experiments, which were performed under identical conditions.

Competition binding of different CCR1 ligands on cCCR1-expressing HEK293 cells
To analyze the affinity of different CCR1 ligands to cCCR1, competition-binding studies were performed with 125I-labeled CCL3. The IC50 of different ligands, as determined from their competition with 125I-hCCL3 for cCCR1, was 37 nM for CCL3, 41.5 nM for mCCL3, and 12.4 nM for CCL14(9-74); Fig. 6 . The affinity of CCL14(9-74) for cCCR1 was approximately three times higher than of CCL3/mCCL3. These results correlate well with the studies about calcium mobilization, in which CCL14(9-74) is the most potent and efficacious ligand tested.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 6. Competition binding of CCR1 ligands on HEK293 cells expressing cCCR1. Increasing concentrations of unlabeled hCCL3 ({triangleup}), mCCL3 ({circ}), or CCL14(9-74); ({square}) were used to compete against 0.1 nM 125I-labeled hCCL3. All values are averages of triplicate determinations with SEM. The results are representatives of four independent experiments performed under identical conditions. Binding (100%) stands for the binding of 125I-hCCL3 on cCCR1 HEK cells without any competing ligand in each experiment. The binding of the fixed concentration of 125I-labeled hCCL3 with no competing ligand on untransfected HEK293 cells is given ({blacksquare}).

Real-time PCR analysis of cCCR1 mRNA expression in tissues of cynomolgus monkey
To gain insight into the receptor expression profile of cCCR1, RT-PCR analysis was performed. For this purpose, quantification of cCCR1 mRNA expression was carried out in different tissues of a healthy cynomolgus monkey.

The real-time quantitative RT-PCR assay and melting curve analysis revealed a specific denaturation profile of cCCR1 cDNA in cynomolgus monkey tissues. A differential expression profile of cCCR1 was seen amongst the tissues. The highest level of expression was seen in spleen; moderate expression, in liver and blood; comparatively lower expression, in kidney; and the lowest but detectable expression, in skin, ileum, and lung (Fig. 7 ). Agarose gel electrophoresis of the probes obtained from the LightCyclerTM confirmed the predicted size of CCR1 in the different tissues (not shown). In summary, the cynomolgus monkey tissue-expression profile showed a broad variation in the expression of CCR1 in different tissues in a nonpathological condition.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 7. Differential expression of cCCR1 in cynomolgus monkey tissues as analyzed by real-time quantitative RT-PCR assay. The total RNA was isolated from different tissues, and a first-strand cDNA synthesis was prepared for quantitative real-time LightCycler® PCR, as described in Materials and Methods. The standard curve plot of cCCR1 and ß-actin expression allows calculation of the template (cCCR1) concentrations in the unknown, tissue-specific samples using LightCyclerTM software. The cCCR1 mRNA expression is calculated by the ratio of concentration of cCCR1 cDNA and ß-actin cDNA expression in all tissues. The mean value ± SEM of four independent experiments under identical conditions is shown.


arrow
DISCUSSION
 
In this study, we identified the undisclosed cCCR1 gene, a nonhuman, primate homologue of hCCR1. Our results demonstrate that cCCR1 exhibits similar functional activities to those of hCCR1. Thus, cynomolgus monkey models may serve for the evaluation of the role of CCR1 in human diseases and assessing potential therapeutic interventions.

In this report, we disclose the sequence of cCCR1 and report it to be unique to the cynomolgus monkey with relatedness to CCR1 sequences of other primate and nonprimate species. Although the sequence of rhesus monkey CCR1 (Gen Bank Accession No. AF017282) has been deposited in the database, no such sequence exists for cCCR1. Moreover, no report is available about the functional characterization of macaque CCR1 (rhesus and cynomolgus monkey). The consensus sequence of cCCR1, derived from three different monkeys, has a homology of 98.9% (amino acid level), resulting in a difference of four amino acids with rhesus CCR1. The two nonconserved differences are located in the N-terminal domain, which plays an important role in ligand docking [32 ]. For CCR3, which plays a pivotal role in mediating allergic inflammation, no such nonconserved differences were observed in the sequence of rhesus and cynomolgus monkey, which has therefore been commonly characterized as the macaque CCR3 [22 ]. Comparison of cCCR1 with the hCCR1 (NM_001295) reveals a homology of 88.4% (amino acid level) or a difference of 41 amino acids. Approximately 45% of the nonconserved amino acids are located within the N terminus and the extracellular loops. In humans, the proposed mechanism of CCR1 actions envisages the receptor N terminus to be the ligand-docking site [32 ] and the second extracellular loop in determining the agonist character [33 ]. These facts could contribute to the slight differences in the receptor ligand interactions observed between human and cCCR1.

The potency and efficacy of different hCCR1 ligands were tested on the cCCR1 cell line. Among the human ligands tested, CCL14(9-74) induced robust calcium fluxes and exhibits the highest efficacy and potency. This is consistent with similar comparisons of ligands observed for hCCR1 [34 ]. It is unexpected that CCL3 was even less efficacious than the modest CCR1 ligand CCL14(1-74). This is rather surprising, as there are reports showing that human and rhesus monkey CCL3 are 100% conserved with their human homologues [35 , 36 ], and another report suggests that the amino acid sequence of rhesus monkey CCL3 is only 89% identical to the human sequence [37 ]. However, no report directly notifies the sequence homology of CCL3 in the cynomolgus monkey.

In the desensitization experiments using all combinations of hCCR1 ligands tested in pairs, CCL3 was unable to completely desensitize CCL14(9-74) at equimolar concentrations. However, vice versa and all other ligand-paired combinations were able to desensitize each other. These data correlate well to the former observations that CCL14(9-74) is a highly efficient activator of hCCR1 [34 ]. Complete CCR1-mediated cross-desensitization between CCL15 and CCL3 has been observed in human monocytes, indicating that they are equipotent on these cells in the human system as for cCCR1 [38 ].

Furthermore, the efficacy of CCL3, CCL14(9-74), and CCL15 on cCCR1 and hCCR1 was compared. In both species, CCL14(9-74) and CCL15 are the most efficient ligands of CCR1. As expected, the potency of these ligands was slightly higher on hCCR1 compared with cCCR1. This provides clear evidence of the conservation of ligands in between humans and the cynomolgus monkey, although CCL14(9-74) and CCL15 are well described for humans, and no data are available for the cynomolgus monkey [7 ]. As the functional activities of hCCR1 ligands are comparable for humans and the cynomolgus monkey, it reinforces the use of this primate model in the preclinical evaluation of CCR1 antagonists.

In the competition-binding studies using radiolabeled CCL3, CCL14(9-74) had high binding affinity compared with CCL3 and mCCL3. These observations correlate with results regarding efficacy, potency, and desensitization, in which CCL14(9-74) is the superior ligand on cCCR1. Previously, it has also been shown that CCL14(9-74) has a higher binding affinity on hCCR1 than CCL3 [34 ]. Moreover, mCCL3 has a binding affinity comparable with hCCL3 on cCCR1. This similarity of human and mCCL3 binding affinities was also observed for hCCR1 [5 ], confirming specificity in binding across species. Hence, these data demonstrate the similarity of the CCR1 ligand interaction among humans and the cynomolgus monkey, designating cCCR1 as the functional counterpart of hCCR1.

The tissue expression profile of cCCR1 was assessed by real-time quantitative PCR in a healthy cynomolgus monkey. The high expression in blood is attributed to the presence of CCR1 on various blood leukocytes as in humans. The high expression in solid organs might reflect the presence of specific resident macrophages in tissues. In human tissue, CCR1 was detected in liver, lung, and kidney, although the expression in the kidney was lower than that in liver and lung [39 ]. However, in the cynomolgus monkey, the expression in the lung was lower in comparison with liver and kidney, in contrast to human tissues. As cynomolgus monkeys are kept under standard laboratory conditions, the discrepancy of CCR1 expression in the lung might reflect the exposure of humans to external irritants, such as aeroallergens, resulting in an increased occurrence of macrophages in the lung. Thus, the expression of CCR1 in solid organs seems to have a similar expression profile among primates, suggesting an important role of CCR1 in tissue homeostasis.

Cynomolgus monkeys exhibit naturally occurring and reproducible airway sensitivity to allergen challenge as humans do [25 ]. Thus, cynomolgus monkey asthma models are most relevant to study the pathophysiology of human asthma and for the preclinical development of novel drug candidates. Several reports indicate that CCR1-dependent leukocyte recruitment might play a pivotal role in inflammatory diseases, especially asthma [21 , 23 ]. In this study, we elucidate the nucleotide and amino acid sequence of the formerly undisclosed cCCR1 gene to be highly homologous to hCCR1. The results from functional studies describe cCCR1 as possessing properties akin to hCCR1 with respect to signaling and binding affinity of various ligands. Moreover, there is a broad similarity in the CCR1 tissue expression profile between the two related species. Thus, this study adds basic information needed for the evaluation of the role of CCR1 in human diseases using highly relevant, nonhuman, primate models and moreover, aids in the preclinical evaluation of potential novel drugs targeting CCR1.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by a grant from the Deutsche Forschungsgemeinschaft (SFB 587/B2). The nucleotide and protein sequence for the cCCR1 has been deposited in the GenBank database under GenBank Accession Number DQ008589. We thank Martin Wendland for helping to establish the transfected cell lines; Rahul Purwar for real-time quantitative PCR data analysis; and Birgit Eilers, Rainer Schreeb, and Uta Küttler for their expert technical assistance.

Received June 17, 2005; revised July 7, 2005; accepted July 11, 2005.


arrow
REFERENCES
 
    1
  1. Gerard, C., Rollins, B. J. (2001) Chemokines and disease Nat. Immunol. 2,108-115[CrossRef][Medline]
  2. 2
  3. Luster, A. D. (1998) Chemokines–chemotactic cytokines that mediate inflammation N. Engl. J. Med. 338,436-445[Free Full Text]
  4. 3
  5. Baggiolini, M. (1998) Chemokines and leukocyte traffic Nature 392,565-568[CrossRef][Medline]
  6. 4
  7. Murphy, P. M. (2002) International Union of Pharmacology. XXX. Update on chemokine receptor nomenclature Pharmacol. Rev. 54,227-229[Abstract/Free Full Text]
  8. 5
  9. Neote, K., DiGregorio, D., Mak, J. Y., Horuk, R., Schall, T. J. (1993) Molecular cloning, functional expression, and signaling characteristics of a C-C chemokine receptor Cell 72,415-425[CrossRef][Medline]
  10. 6
  11. Gao, J. L., Kuhns, D. B., Tiffany, H. L., McDermott, D., Li, X., Francke, U., Murphy, P. H. (1993) Structure and functional expression of the human macrophage inflammatory 1{alpha}/RANTES receptor J. Exp. Med. 177,1421-1427[Abstract/Free Full Text]
  12. 7
  13. Forssmann, U., Magert, H. J., Adermann, K., Escher, S. E., Forssmann, W. G. (2001) Hemofiltrate CC chemokines with unique biochemical properties: HCC-1/CCL14a and HCC-2/CCL15 J. Leukoc. Biol. 70,357-366[Abstract/Free Full Text]
  14. 8
  15. Gong, X., Gong, W., Kuhns, D. B., Ben Baruch, A., Howard, O. M., Wang, J. M. (1997) Monocyte chemotactic protein-2 (MCP-2) uses CCR1 and CCR2B as its functional receptors J. Biol. Chem. 272,11682-11685[Abstract/Free Full Text]
  16. 9
  17. Sarau, H. M., Rush, J. A., Foley, J. J., Brawner, M. E., Schmidt, D. B., White, J. R., Barnette, M. S. (1997) Characterization of functional chemokine receptors (CCR1 and CCR2) on EoL-3 cells: a model system to examine the role of chemokines in cell function J. Pharmacol. Exp. Ther. 283,411-418[Abstract/Free Full Text]
  18. 10
  19. Youn, B. S., Zhang, S. M., Lee, E. K., Park, D. H., Broxmeyer, H. E., Murphy, P. M., Locati, M., Pease, J. E., Kim, K. K., Antol, K., Kwon, B. S. (1997) Molecular cloning of leukotactin-1: a novel human ß-chemokine, a chemoattractant for neutrophils, monocytes, and lymphocytes, and a potent agonist at CC chemokine receptors 1 and 3 J. Immunol. 159,5201-5205[Abstract]
  20. 11
  21. Gao, J. L., Wynn, T. A., Chang, Y., Lee, E. J., Broxmeyer, H. E., Cooper, S., Tiffany, H. L., Westphal, H., Kwon-Chung, J., Murphy, P. M. (1997) Impaired host defense, hematopoiesis, granulomatous inflammation and type 1-type 2 cytokine balance in mice lacking CC chemokine receptor 1 J. Exp. Med. 185,1959-1968[Abstract/Free Full Text]
  22. 12
  23. Su, S. B., Mukaida, N., Wang, J., Nomura, H., Matsushima, K. (1996) Preparation of specific polyclonal antibodies to a C-C chemokine receptor, CCR1, and determination of CCR1 expression on various types of leukocytes J. Leukoc. Biol. 60,658-666[Abstract]
  24. 13
  25. Broxmeyer, H. E., Cooper, S., Hangoc, G., Gao, J. L., Murphy, P. M. (1999) Dominant myelopoietic effector functions mediated by chemokine receptor CCR1 J. Exp. Med. 189,1987-1992[Abstract/Free Full Text]
  26. 14
  27. Phillips, R. M., Stubbs, V. E., Henson, M. R., Williams, T. J., Pease, J. E., Sabroe, I. (2003) Variations in eosinophil chemokine responses: an investigation of CCR1 and CCR3 function, expression in atopy, and identification of a functional CCR1 promoter J. Immunol. 170,6190-6201[Abstract/Free Full Text]
  28. 15
  29. Domachowske, J. B., Bonville, C. A., Gao, J. L., Murphy, P. M., Easton, A. J., Rosenberg, H. F. (2000) The chemokine macrophage-inflammatory protein-1 {alpha} and its receptor CCR1 control pulmonary inflammation and antiviral host defense in paramyxovirus infection J. Immunol. 165,2677-2682[Abstract/Free Full Text]
  30. 16
  31. Gerard, C., Frossard, J. L., Bhatia, M., Saluja, A., Gerard, N. P., Lu, B., Steer, M. (1997) Targeted disruption of the ß-chemokine receptor CCR1 protects against pancreatitis-associated lung injury J. Clin. Invest. 100,2022-2027[Medline]
  32. 17
  33. Liang, M., Mallari, C., Rosser, M., Ng, H. P., May, K., Monahan, S., Bauman, J. G., Islam, I., Ghannam, A., Buckman, B., Shaw, K., Wei, G. P., Xu, W., Zhao, Z., Ho, E., Shen, J., Oanh, H., Subramanyam, B., Vergona, R., Taub, D., Dunning, L., Harvey, S., Snider, R. M., Hesselgesser, J., Morrissey, M. M., Perez, H. D. (2000) Identification and characterization of a potent, selective, and orally active antagonist of the CC chemokine receptor-1 J. Biol. Chem. 275,19000-19008[Abstract/Free Full Text]
  34. 18
  35. Haringman, J. J., Kraan, M. C., Smeets, T. J., Zwinderman, K. H., Tak, P. P. (2003) Chemokine blockade and chronic inflammatory disease: proof of concept in patients with rheumatoid arthritis Ann. Rheum. Dis. 62,715-721[Abstract/Free Full Text]
  36. 19
  37. Kaesler, S., Bugnon, P., Gao, J. L., Murphy, P. M., Goppelt, A., Werner, S. (2004) The chemokine receptor CCR1 is strongly up-regulated after skin injury but dispensable for wound healing Wound Repair Regen 12,193-204[CrossRef][Medline]
  38. 20
  39. Horuk, R., Clayberger, C., Krensky, A. M., Wang, Z., Grone, H. J., Weber, C., Weber, K. S., Nelson, P. J., May, K., Rosser, M., Dunning, L., Liang, M., Buckman, B., Ghannam, A., Ng, H. P., Islam, I., Bauman, J. G., Wei, G. P., Monahan, S., Xu, W., Snider, R. M., Morrissey, M. M., Hesselgesser, J., Perez, H. D. (2001) A non-peptide functional antagonist of the CCR1 chemokine receptor is effective in rat heart transplant rejection J. Biol. Chem. 276,4199-4204[Abstract/Free Full Text]
  40. 21
  41. Elsner, J., Escher, S. E., Forssmann, U. (2004) Chemokine receptor antagonists: a novel therapeutic approach in allergic diseases Allergy 59,1243-1258[CrossRef][Medline]
  42. 22
  43. Zhang, L., Soares, M. P., Guan, Y., Matheravidathu, S., Wnek, R., Johnson, K. E., Meisher, A., Iliff, S. A., Mudgett, J. S., Springer, M. S., Daugherty, B. L. (2002) Functional expression and characterization of macaque C-C chemokine receptor 3 (CCR3) and generation of potent antagonistic anti-macaque CCR3 monoclonal antibodies J. Biol. Chem. 277,33799-33810[Abstract/Free Full Text]
  44. 23
  45. Ma, B., Zhu, Z., Homer, R. J., Gerard, C., Strieter, R., Elias, J. A. (2004) The C10/CCL6 chemokine and CCR1 play critical roles in the pathogenesis of IL-13-induced inflammation and remodeling J. Immunol. 172,1872-1881[Abstract/Free Full Text]
  46. 24
  47. Blease, K., Mehrad, B., Standiford, T. J., Lukacs, N. W., Kunkel, S. L., Chensue, S. W., Lu, B., Gerard, C. J., Hogaboam, C. M. (2000) Airway remodeling is absent in CCR1–/– mice during chronic fungal allergic airway disease J. Immunol. 165,1564-1572[Abstract/Free Full Text]
  48. 25
  49. Gundel, R. H., Wegner, C. D., Letts, L. G. (1992) Antigen-induced acute and late-phase responses in primates Am. Rev. Respir. Dis. 146,369-373[Medline]
  50. 26
  51. Van Scott, M. R., Hooker, J. L., Ehrmann, D., Shibata, Y., Kukoly, C., Salleng, K., Westergaard, G., Sandrasagra, A., Nyce, J. (2004) Dust mite-induced asthma in cynomolgus monkeys J. Appl. Physiol. 96,1433-1444[Abstract/Free Full Text]
  52. 27
  53. Schelegle, E. S., Gershwin, L. J., Miller, L. A., Fanucchi, M. V., Van Winkle, L. S., Gerriets, J. P., Walby, W. F., Omlor, A. M., Buckpitt, A. R., Tarkington, B. K., Wong, V. J., Joad, J. P., Pinkerton, K. B., Wu, R., Evans, M. J., Hyde, D. M., Plopper, C. G. (2001) Allergic asthma induced in rhesus monkeys by house dust mite (Dermatophagoides farinae) Am. J. Pathol. 158,333-341[Abstract/Free Full Text]
  54. 28
  55. Forssmann, U., Hartung, I., Balder, R., Fuchs, B., Escher, S. E., Spodsberg, N., Dulkys, Y., Walden, M., Heitland, A., Braun, A., Forssmann, W. G., Elsner, J. (2004) n-Nonanoyl-CC chemokine ligand 14, a potent CC chemokine ligand 14 analogue that prevents the recruitment of eosinophils in allergic airway inflammation J. Immunol. 173,3456-3466[Abstract/Free Full Text]
  56. 29
  57. Elsner, J., Mack, M., Bruhl, H., Dulkys, Y., Kimmig, D., Simmons, G., Clapham, P. R., Schlondorff, D., Kapp, A., Wells, T. N., Proudfoot, A. E. (2000) Differential activation of CC chemokine receptors by AOP-RANTES J. Biol. Chem. 275,7787-7794[Abstract/Free Full Text]
  58. 30
  59. Sabroe, I., Peck, M. J., Van Keulen, B. J., Jorritsma, A., Simmons, G., Clapham, P. R., Williams, T. J., Pease, J. E. (2000) A small molecule antagonist of chemokine receptors CCR1 and CCR3. Potent inhibition of eosinophil function and CCR3-mediated HIV-1 entry J. Biol. Chem. 275,25985-25992[Abstract/Free Full Text]
  60. 31
  61. Dulkys, Y., Kluthe, C., Buschermohle, T., Barg, I., Knoss, S., Kapp, A., Proudfoot, A. E., Elsner, J. (2001) IL-3 induces down-regulation of CCR3 protein and mRNA in human eosinophils J. Immunol. 167,3443-3453[Abstract/Free Full Text]
  62. 32
  63. Pease, J. E., Wang, J., Ponath, P. D., Murphy, P. M. (1998) The N-terminal extracellular segments of the chemokine receptors CCR1 and CCR3 are determinants for MIP-1{alpha} and eotaxin binding, respectively, but a second domain is essential for efficient receptor activation J. Biol. Chem. 273,19972-19976[Abstract/Free Full Text]
  64. 33
  65. Zoffmann, S., Chollet, A., Galzi, J. L. (2002) Identification of the extracellular loop 2 as the point of interaction between the N terminus of the chemokine MIP-1{alpha} and its CCR1 receptor Mol. Pharmacol. 62,729-736[Abstract/Free Full Text]
  66. 34
  67. Detheux, M., Standker, L., Vakili, J., Munch, J., Forssmann, U., Adermann, K., Pohlmann, S., Vassart, G., Kirchhoff, F., Parmentier, M., Forssmann, W. G. (2000) Natural proteolytic processing of hemofiltrate CC chemokine 1 generates a potent CC chemokine receptor (CCR)1 and CCR5 agonist with anti-HIV properties J. Exp. Med. 192,1501-1508[Abstract/Free Full Text]
  68. 35
  69. Steinberger, P., Andris-Widhopf, J., Buhler, B., Torbett, B. E., Barbas, C. F., III (2000) Functional deletion of the CCR5 receptor by intracellular immunization produces cells that are refractory to CCR5-dependent HIV-1 infection and cell fusion Proc. Natl. Acad. Sci. USA 97,805-810[Abstract/Free Full Text]
  70. 36
  71. Gauduin, M. C., Glickman, R. L., Means, R., Johnson, R. P. (1998) Inhibition of simian immunodeficiency virus (SIV) replication by CD8(+) T lymphocytes from macaques immunized with live attenuated SIV J. Virol. 72,6315-6324[Abstract/Free Full Text]
  72. 37
  73. Basu, S., Schaefer, T. M., Ghosh, M., Fuller, C. L., Reinhart, T. A. (2002) Molecular cloning and sequencing of 25 different rhesus macaque chemokine cDNAs reveals evolutionary conservation among C, CC, CXC, and CX3C families of chemokines Cytokine 18,140-148[CrossRef][Medline]
  74. 38
  75. Pardigol, A., Forssmann, U., Zucht, H. D., Loetscher, P., Schulz-Knappe, P., Baggiolini, M., Forssmann, W. G., Magert, H. J. (1998) HCC-2, a human chemokine: gene structure, expression pattern, and biological activity Proc. Natl. Acad. Sci. USA 95,6308-6313[Abstract/Free Full Text]
  76. 39
  77. Combadiere, C., Ahuja, S. K., Murphy, P. M. (1995) Cloning, chromosomal localization, and RNA expression of a human ß chemokine receptor-like gene DNA Cell Biol 14,673-680[Medline]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
S. Gupta, B. Fuchs, S. Schulz-Maronde, A. Heitland, S. E. Escher, M. Mack, H.-C. Tillmann, A. Braun, W.-G. Forssmann, J. Elsner, et al.
Intravascular inactivation of CCR5 by n-Nonanoyl-CC chemokine ligand 14 and inhibition of allergic airway inflammation
J. Leukoc. Biol., March 1, 2008; 83(3): 765 - 773.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0605326v1
78/5/1175    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gupta, S.
Right arrow Articles by Elsner, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gupta, S.
Right arrow Articles by Elsner, J.