Pepro Tech
Originally published online as doi:10.1189/jlb.0205102 on June 16, 2005

Published online before print June 16, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.0205102v1
78/3/716    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, K.
Right arrow Articles by Braley-Mullen, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, K.
Right arrow Articles by Braley-Mullen, H.
(Journal of Leukocyte Biology. 2005;78:716-724.)
© 2005 by Society for Leukocyte Biology

Chemokine expression during development of fibrosis versus resolution in a murine model of granulomatous experimental autoimmune thyroiditis

Kemin Chen*,1, Yongzhong Wei*, Adam Alter*, Gordon C. Sharp* and Helen Braley-Mullen*,{dagger},{ddagger}

* Departments of Internal Medicine and
{dagger} Molecular Microbiology & Immunology, University of Missouri School of Medicine, and
{ddagger} VA Research Service, Columbia

1Correspondence: Division of Immunology & Rheumatology, Department of Medicine, University of Missouri, M306 Medical Sciences, One Hospital Dr., Columbia, MO 65212. E-mail: Chenk{at}health.missouri.edu


arrow
ABSTRACT
 
Severe granulomatous experimental autoimmune thyroiditis (G-EAT) in DBA/1 or CBA/J wild type (WT) mice at day 19 progresses to fibrosis by day 35, but severe G-EAT in DBA/1 interferon (IFN)-{gamma}–/– mice or less-severe G-EAT at day 19 in WT mice resolves by day 35. To study the role of chemokines in autoimmune diseases and fibrosis, profiles of chemokines and chemokine receptors were analyzed in DBA/1 WT versus IFN-{gamma}–/– and CBA/J thyroids, which have distinct outcomes of autoimmune inflammation. Gene expression of CXC chemokine ligand 1 (CXCL1) and CXC chemokine receptor 2 (CXCR2) paralleled neutrophil infiltration and thyrocyte destruction in DBA/1 WT or CBA/J thyroids, and gene expression of CC chemokine ligand 11 (CCL11), CCL8, and CC chemokine receptor 3 paralleled eosinophil infiltration in IFN-{gamma}–/– thyroids. Gene and protein expression of CXCL10, CXCL9, and CXCR3 was significantly lower in IFN-{gamma}–/– compared with DBA/1 WT thyroids. Moreover, immunostaining showed that CXCL10 was expressed by thyrocytes and inflammatory cells, and strong expression of CXCL10 by thyrocytes was as early as day 7. High expression of CCL2 was only observed in severely destroyed DBA/1 WT or CBA/J thyroids, which would develop fibrosis. Thus, the differential expression of chemokines may direct distinct cellular populations in DBA/1 WT versus IFN-{gamma}–/– thyroids. Up-regulation of CXCL10 by thyrocytes suggests its role in regulating the recruitment of specific subsets of activated lymphocytes to the thyroid during autoimmune inflammation. The early expression of CXCL1, CXCL10, and CCL2 may suggest their involvement in the initiation and perpetuation of disease in severe G-EAT thyroids, which progress to fibrosis.

Key Words: chemokine receptors • autoimmune inflammation • collagen • autoimmune diseases • resolution


arrow
INTRODUCTION
 
Entry of immune cells into and their retention and activation within tissues are prerequisite steps for host immune responses [1 ]. Chemokines are important regulators of leukocyte trafficking and also play a central role in inflammation [2 3 4 ]. Recent studies have demonstrated the importance of chemokines in autoimmune diseases and fibrosis [1 , 3 4 5 6 7 8 9 10 11 12 13 ], but the precise mechanisms by which chemokines regulate autoimmune diseases and fibrosis require further clarification.

Granulomatous experimental autoimmune thyroiditis (G-EAT) is characterized by infiltration of the thyroid by numerous inflammatory cells [14 , 15 ]. G-EAT induced in DBA/1 wild-type (WT) and interferon (IFN)-{gamma}–/– mice evolves to two distinct outcomes: resolution in IFN-{gamma}–/– thyroids but sustained inflammation and fibrosis in WT thyroids [16 ]. Therefore, this is an excellent model to study the opposing mechanisms involved in autoimmunity and fibrosis.

IFN-{gamma} is a pleiotropic cytokine that is involved in many inflammatory responses. Resolution of G-EAT inflammation in IFN-{gamma}–/– thyroids is associated with regulation of pro- and antiapoptotic molecules, as well as regulation of cytokines [16 , 17 ]. IFN-{gamma} can also modulate chemokine secretion including IFN-inducible protein 10 (IP-10)/CXC chemokine ligand 10 (CXCL10), monokine induced by IFN- {gamma} (Mig)/CXCL9, and IFN-inducible T cell-{alpha} chemoattractant/CXCL11 [4 ], suggesting that IFN-{gamma} may play an important role in controlling leukocyte migration [1 , 11 , 18 ]. IFN-{gamma} affects homing of inflammatory T cells to the pancreatic islets, the central nervous system, and the thyroid via regulation of chemokines [1 , 11 , 18 ]. CXCL10 is highly expressed in T helper cell type 1 inflammatory diseases [11 , 19 , 20 ], and expression of certain chemokines, e.g., monocyte chemoattractant protein-1 (MCP-1)/CC chemokine ligand 2 (CCL2) and CC chemokine receptor 1 (CCR1), contributes to development of fibrosis [6 , 8 , 21 , 22 ].

To determine if resolution of inflammation and reduction of fibrosis in IFN-{gamma}–/– thyroids [16 ] may be related to modulation of expression of chemokines, we characterized the expression of chemokines and their respective receptors during autoimmune inflammation and thyroid fibrosis in DBA/1 WT versus IFN-{gamma}–/– thyroids. G-EAT can also be induced in CBA/J mice, and lesions resolve when G-EAT is less severe (3+) but progress to fibrosis when G-EAT is very severe (5+) [15 , 16 ]. To determine whether alteration of chemokine expression in WT versus IFN-{gamma}–/– thyroids is a general mechanism involved in resolution versus fibrosis of G-EAT, expression of chemokines was also examined in CBA/J thyroids with different disease outcomes. Many chemokines were expressed in thyroids of WT and IFN-{gamma}–/– mice, and differential expression of chemokines controlled the types of inflammatory cells infiltrating the thyroid. CXCL9, CXCL10, and its receptor CXCR3 were significantly reduced in IFN-{gamma}–/– thyroids compared with DBA/1 WT thyroids. However, this difference was not distinct in CBA/J thyroids, which would progress to fibrosis or resolve, suggesting that the observed differences in expression of CXCL10, CXCL9, and CXCR3 between DBA/1 WT versus IFN-{gamma}–/– thyroids are a result of regulation of these chemokines by IFN-{gamma}, and their expression is apparently not indicative of whether lesions will progress to fibrosis or resolve. Expression of CCL2 protein was consistently high in WT DBA/1 or CBA/J thyroids, which would progress to fibrosis, but reduced in DBA/1 IFN-{gamma}–/– thyroids or CBA/J thyroids, in which G-EAT lesions eventually resolved, suggesting CCL2 may be involved in development of fibrosis.


arrow
MATERIALS AND METHODS
 
Mice
The original breeding stocks of DBA/1 and IFN-{gamma}–/– DBA/1 mice were obtained from the Jackson Laboratory (Bar Harbor, ME). Both strains have since been maintained through homozygous breeding in our colonies at the University of Missouri-Columbia. CBA/J mice were obtained through Clarence Reeder at the National Institutes of Health (NIH; Bethesda, MD). Male and female mice were used, and mice were 7- to 14-weeks old when used as donors or recipients.

Induction of G-EAT
G-EAT was induced as described previously [16 ]. Briefly, donor CBA/J, DBA/1 WT, or DBA/1 IFN-{gamma}–/– mice were immunized twice with 150 µg mouse thyroglobulin (MTg) and 15 ug lipopolysaccharide (LPS; Escherichia coli 0111:B4, Sigma Chemical Co., St. Louis, MO) intravenously at 10-day intervals. Seven days after the second injection of MTg and LPS, donor spleen cells were cultured with 25 µg/ml MTg together with 5 ng/ml interleukin (IL)-12 (PeproTech, Rocky Hill, NJ) for 72 h and then transferred to irradiated (500 Rad), syngeneic CBA/J, DBA/1 WT, or IFN-{gamma}–/– recipient mice. DBA/1 WT donor cells were transferred to WT recipients and IFN-{gamma}–/– donor cells to IFN-{gamma}–/– recipients. Recipient thyroids were generally evaluated 19–21 days later, the time of maximal severity of G-EAT in this adoptive transfer model [16 ], and in some experiments, from 10 to 45 days following cell transfer.

Evaluation of G-EAT histopathology
Thyroids were removed from four to five mice/group at days 10, 19, or 35–45 after cell transfer, and one lobe of each thyroid was fixed in formalin. For histologic analysis, tissues were embedded in paraffin, sectioned (7 µm), and stained with hematoxylin and eosin (H&E). Thyroids were scored quantitatively for G-EAT severity, using a scale of 1–5+, according to previously established criteria [14 ]. 1+ Thyroiditis is defined as an infiltrate of at least 125 cells in one or several foci, 2+ is 10–20 foci of cellular infiltration involving up to 25% of the gland, 3+ indicates that 25–50% of the gland is infiltrated, 4+ indicates that >50% of the gland is destroyed, and 5+ indicates virtually complete destruction of the gland, with few or no remaining follicles. Thyroid lesions were also evaluated qualitatively. In general, thyroids with 1–2+ severity have infiltrates consisting mainly of lymphocytes with few neutrophils. The more severely destroyed thyroids (4–5+) had extensive granulomatous changes with thyroid epithelial cell proliferation, multinucleated giant cells, large numbers of histiocytes, and numerous lymphocytes and neutrophils with microabscess formation and necrosis, as well as collagen deposition and fibrosis. The granulomatous inflammation in thyroids graded 4–5+ characteristically extended beyond the thyroid to involve the adjacent connective tissue and muscle.

Reverse transcriptase-polymerase chain reaction (RT-PCR) amplification
RT-PCR was performed as described previously [16 ] using specific primers. Briefly, individual thyroid lobes obtained from recipient mice were snap-frozen in liquid nitrogen and stored at –70°C until used. Blood was excluded as much as possible during thyroid removal, and thyroids were trimmed to remove nonthyroid tissue prior to freezing. Tissues were homogenized in 1 ml TRIzol (Invitrogen, Carlsbad, CA), and RNA was isolated and reverse-transcribed [16 ]. To determine the relative initial amounts of target cDNA, each cDNA sample was serially diluted 1:5 and 1:25 and amplified with specific primers. Hypoxanthine phosphoribosyltransferase (HPRT) was used as a housekeeping gene to verify that the same amount of RNA was amplified. To compare relative levels of mRNA transcripts between different groups, samples were reverse-transcribed and amplified at the same time using aliquots of reagent from the same master mix. The PCR products were analyzed using a digital imaging system (Life Sciences, St. Louis, MO). Samples within the linear relationship between input cDNA and final PCR products (usually 1/25 cDNA dilution) were collected, and the densitometric units for each cytokine band were normalized to those for the corresponding HPRT band. CCL2 primers used in this study have been described previously [23 ]. Other primer sequences were as follows: CXCL1 sense, TCGCTTCTCTGTGCAGCGCT, CXCL1 antisense, GTGGTTGCAACTTAGTGGTCTC. CXCR2 sense, TCTGGCATGCCCTCTATTCTG, CXCR2 antisense, AAGGTAACCTCCTTCACGTAT. CCR3 sense, TGGGCAACATGATGGTTGTG, CCR3 antisense, GCTGTCTTGAGACTCATGGA. CXCL10 sense, CCCGGGAATTCATACCATGAACCCAAGTGCTGCC, CXCL10 antisense, GTCACGATGAATTCCTTAAGGAGCCCTTTTAGACCT. CXCL9 sense, TGAAGTCCGCTGTTCTTTTCCT, CXCL9 antisense, TTATGTAGTCTTCCTTGAAACGACG. CXCR3 sense, GAACGTCAAGTGCTAGATGCCTGG, CXCR3 antisense, GTAGACGCAGAGCAGTGCG. CCR2 sense, GGTCATGATCCCTATGTGG, CCR2 antisense, CTGGGCACCTGATTTAAAGG. CCR1 sense, AGCCTACCCCACAACTACAGAA, CCR1 antisense, CTTGTAGGGGAAATGAGGGCTA. CCL21 sense, AGTGATGGAGGGGGACAGGAC, CCL21 antisense, CTATCCTCTTGAGGGCTGTG. CXCL13 sense, TCTCTCCAGGCCACGGTATTCT, CXCL13 antisense, ACCATTTGGCACGAGGATACAC. CCL5 sense, ATAACGCGTATGCATCACCATATGGCTCGGAC, CCL5 antisense, CCAGATCTAGCTCATCTCCAAATAG. CCL8 sense, ACATCACCTGCTTGGTCTGGAAAAC, CCL8 antisense, ACTAAAGCTGAAGATCCCCCTTCG.

Immunohistochemistry
Infiltration of neutrophils and macrophages in G-EAT thyroids was detected on frozen sections using rat monoclonal antibodies against neutrophils (RB6-8C5, provided by Dr. Robert Coffman, DNAX, Palo Alto, CA) or macrophages (F4/80, ATCC HB-198, American Type Culture Collection, Manassas, VA). Expression of chemokines and chemokine receptors was also detected on frozen thyroid sections. After fixation in acetone for 10 min at 4°C, sections were blocked in 1% bovine serum albumin for 30 min, washed with phosphate-buffered saline (PBS), and incubated with rat anti-CXCL10 (PeproTech), rabbit anti-CXCL9 (R&D Systems, Minneapolis, MN), rabbit anti-CCL11, goat anti-CCL2, goat anti-CCR3, or goat anti-CXCR3 (all from Santa Cruz Biotechnology, CA) for 30 min. Following incubation with a secondary biotinylated goat anti-rabbit antibody (1/500, Jackson ImmunoResearch, West Grove, PA), goat anti-rat antibody (1/500, Caltag Laboratories, Burlingame, CA), or rabbit anti-goat antibody (1/500, Jackson ImmunoResearch), endogenous peroxidase was quenched with 0.3% hydrogen peroxide in 0.1 M PBS for 30 min, and immunoreactivity was demonstrated using a Vector ABC peroxidase kit (Vector Laboratories, Burlingame, CA) with 3,3-diaminobenzidine tetrahydrochloride (Sigma Chemical Co., St. Louis, MO) or VIP (Vector Laboratories) as the chromogen. Sections were counterstained with hematoxylin. The intensity of immunostaining was graded semiquantitatively. Negative controls used nonimmune rat, rabbit, or goat immunoglobulin at a protein concentration equivalent to the respective primary antibodies. These controls were always negative.


arrow
RESULTS
 
Distinct outcomes (resolution or fibrosis) and characteristic features of infiltrating inflammatory cells in thyroids of DBA/1 WT and IFN-{gamma}–/– mice
Our earlier observation indicated that development of fibrosis was associated with the severity of G-EAT [15 , 16 , 24 ], as G-EAT lesions with 5+ severity scores at day 19 in DBA/1 or CBA/J mice progressed to fibrosis by day 35, and lesions with 3+ severity scores at day 19 resolved by day 35 [15 ]. However, severe G-EAT in DBA/1 IFN-{gamma}–/– thyroids at days 19–21 consistently resolved almost completely by day 35 with 0–1+ residual inflammation [16 ].

G-EAT severity in WT and IFN-{gamma}–/– DBA/1 recipients reached maximal severity (4–5+) 19 days after cell transfer with destruction of thyroid epithelial cells (TEC), numerous large epithelioid histiocytes, CD4+ and CD8+ T lymphocytes, and multinucleated giant cells [15 , 16 ]. However, necrosis and numerous polymorphonuclear neutrophils (PMNs) were present in WT thyroids (Fig. 1A ), and there were few PMNs in IFN-{gamma}–/– thyroids (Fig. 1B) . Eosinophils with typical pink granule staining were not present in WT thyroids (Fig. 1C) but were present in IFN-{gamma}–/– thyroids (Fig. 1D) . Expression of CCR3, a chemokine receptor predominantly expressed on eosinophils [4 ], was minimal in WT thyroids (Fig. 1E) but high in IFN-{gamma}–/– thyroids (Fig. 1F) . Macrophages are another important population of infiltrating cells in G-EAT thyroids, and similar numbers of macrophages infiltrated WT and IFN-{gamma}–/– thyroids (Fig. 1G and 1H) . Thus, although WT and IFN-{gamma}–/– thyroids had similar G-EAT severity scores 19–21 days after cell transfer, there were differences in the cellular components with numerous PMNs in WT thyroids but an accumulation of eosinophils in IFN-{gamma}–/– thyroids.



View larger version (123K):
[in this window]
[in a new window]
 
Figure 1. Characteristics of infiltrating inflammatory cells in WT versus IFN-{gamma}–/– thyroids. Many PMNs accumulated in WT thyroids (A), and few were present in IFN-{gamma}–/– thyroids (B). There were no eosinophils (EOS) in WT thyroids (C), but many eosinophils in IFN-{gamma}–/– thyroids (D). Few CCR3+ cells were present in WT thyroids (E), but numerous CCR3+ cells were present in IFN-{gamma}–/– thyroids (F). Similar numbers of macrophages were present in WT (G) and IFN-{gamma}–/– thyroids (H). PMNs were identified with RB6-8C5, and eosinophils were identified by the pink granules on H&E-stained slides and macrophages by F4/80. (A, C, E, G) 4–5+ G-EAT in WT thyroids at day 19; (B, D, F, H) 4–5+ G-EAT in IFN-{gamma}–/– thyroids at day 19. Original magnification, A, B, G, and H: 400x; C–F: 1000x.

There is a relationship between chemokines and the predominant subclasses of infiltrating cells in WT and IFN-{gamma}–/– thyroids
Chemokines are important for the recruitment of specific leukocyte populations during inflammation [2 3 4 ]. To test which chemokines may play a role in attracting different cell populations to WT versus IFN-{gamma}–/– thyroids, expression of chemokines that direct PMNs and eosinophils was detected by RT-PCR. Keratinocyte-derived chemokine/growth-related oncogene-{alpha}/CXCL1, a potent chemokine for PMNs [4 , 25 ], was up-regulated at day 10 (not shown) in WT thyroids and further increased at day 19 but declined at day 36 (Fig. 2A ). CXCR2, the receptor for CXCL1 expressed selectively on PMNs [4 , 25 ], was also up-regulated at day 19 in WT thyroids (Fig. 2A) following PMN infiltration, and declined when most PMNs had been cleared from WT thyroids at day 36. Although levels of CXCL1 and CXCR2 were significantly lower in IFN-{gamma}–/– thyroids at day 19 (Fig. 2A) , levels of eotaxin/CCL11 and its receptor CCR3 were higher in IFN-{gamma}–/– than in WT thyroids (Fig. 2B) . It is possible that other chemokines known to be eosinophil chemoattractants (e.g., RANTES/CCL5 and MCP-2/CCL8) [26 , 27 ] may also be implicated in recruitment of eosinophils to IFN-{gamma}–/– thyroids. As shown in Figure 2C , expression of CCL5 and CCL8 was up-regulated, and CCL5 expression levels were comparable in WT and IFN-{gamma}–/– thyroids at days 19 and 36. However, compared with WT thyroids, expression of CCL8 was higher in IFN-{gamma}–/– thyroids at day 19 when eosinphil infiltration was maximal. None of these chemokines were detectable in normal thyroids (Fig. 2A 2B 2C) . Immunostaining showed that there was no or weak expression of CCL11 and CCR3 in DBA/1 WT thyroids during the course of G-EAT (Table 1 ), correlating with the minimal infiltration of eosinophils in WT thyroids (Fig. 1C) . In contrast, expression of CCL11 and CCR3 was up-regulated at day 10, reached its highest expression at day 19, and declined at days 35–45 in IFN-{gamma}–/– thyroids (Table 1) , correlating with the time course and degree of eosinophil infiltration in IFN-{gamma}–/– thyroids (Fig. 1D and Table 1 ). Therefore, CCL11 and CCL8 may play an important role in recruitment of eosinophils to IFN-{gamma}–/– thyroids, and CCR3 may be selectively expressed by infiltrating eosinophils. In conclusion, higher expression of CXCL1 and CXCR2 in WT mice but higher expression of CCL11, CCL8, and CCR3 in IFN-{gamma}–/– mice (Fig. 2 , A and B, Table 1 ) may explain the differences in cellular infiltration in these two strains: numerous PMNs (Fig. 1A) but few eosinophils (Fig. 1C) in WT thyroids and many eosinophils (Fig. 1D) but few PMNs (Fig. 1B) in IFN-{gamma}–/– thyroids. Therefore, chemokines may play an important role in recruitment of different subsets of inflammatory cells in WT versus IFN-{gamma}–/– thyroids.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 2. Expression of CXCL1, CXCR2, CCL11, CCR3, CCL5, and CCL8 mRNA in thyroids of DBA/1 WT versus IFN-{gamma}–/– thyroids and comparison of expression of CXCL1, CCL11, and CCR3 in CBA/J thyroids with distinct disease outcomes. (A) CXCL1 and CXCR2 mRNA levels in thyroids of DBA/1 WT and IFN-{gamma}–/– mice 19 or 36 days after cell transfer. (B) Levels of CCL11 and CCR3 mRNA in thyroids of DBA/1 WT and IFN-{gamma}–/– mice 19 or 36 days after cell transfer. (C) Levels of CCL5 and CCL8 mRNA in thyroids of DBA/1 WT and IFN-{gamma}–/– mice 19 or 36 days after cell transfer. RANTES, Regulated on activation, normal T expressed and secreted. (D) Comparison of CXCL1, CCL11, and CCR3 in CBA/J thyroids with 4–5+ or 3+ severity at day 19. Bars represent means of data for thyroids of five individual mice ± SD. Results are expressed as the mean ratio of chemokine densitometric U/HPRT ± SD (x100) and are representative of three (A–C) or of two (D) independent experiments. A significant difference among groups is indicated (*, P<0.05; **P < 0.01). (A–C) N+/+ and N–/– represent normal DBA/1 WT and normal IFN-{gamma}–/– thyroids. G-EAT severity was 4–5+ at day 19 in WT and IFN-{gamma}–/– thyroids. WT thyroids had 4–5+ severity scores and fibrosis at day 36, but G-EAT was resolving with a score of 0–3+ in IFN-{gamma}–/– thyroids at day 36. (D) Fibrosis indicates the thyroids with 4–5+ severity scores at day 19, which would develop fibrosis by day 45, and resolution represents thyroids with 3+ severity scores at day 19, which will resolve by day 45.


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of Detection of Chemokine and Chemokine Receptors in DBA/1 WT Versus IFN-{gamma}–/– Thyroids by Immunostaining

Levels of CXCL1 were significantly higher in thyroids of CBA/J mice with 4–5+ G-EAT severity scores than in thyroids with 3+ severity scores at day 19, but CXCL1 was undetectable at day 45 in fibrotic or resolved thyroids (Fig. 2D) . Levels of CXCL1 corresponded to the numbers of PMNs in severe G-EAT (4–5+) and in less severe G-EAT (3+) thyroids of CBA/J mice [15 ]. Comparable low levels of CCL11 and CCR3 were expressed at day 19 in CBA/J thyroids with 3+ or 4–5+ severity scores and declined thereafter (Fig. 2D) .

Different expression levels of IFN-{gamma} inducing chemokines in DBA/1 WT versus IFN-{gamma}–/– thyroids
As IFN-{gamma} regulates several chemokines that may be involved in the pathogenesis of inflammation and autoimmune diseases [9 , 28 29 30 31 32 ], expression of IP-10 (CXCL10), Mig (CXCL9), and their receptor CXCR3 was examined. RT-PCR showed that gene expression of CXCL10, CXCL9, and CXCR3 was high in DBA/1 WT thyroids and was markedly reduced in IFN-{gamma}–/– compared with WT thyroids (Fig. 3A ). Expression of CXCL10 and CXCR3 mRNA was higher at day 19 in CBA/J thyroids with 4–5+ severity, which would progress to fibrosis, than in those with 3+ severity, which would resolve, and expression of CXCL9 was similar in both groups (Fig. 3B) . These results suggest that the reduced expression of CXCL9, CXCL10, and CXCR3 in IFN-{gamma}–/– thyroids is a result of deficiency of IFN-{gamma} and is unlikely a general phenomenon associated with resolution or fibrosis of G-EAT.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 3. Expression of CXCL10, CXCL9, and CXCR3 mRNA in DBA/1 WT versus IFN-{gamma}–/– thyroids or in CBA/J thyroids with distinct disease outcomes. (A and B) CXCL10, CXCL9, and CXCR3 mRNA levels in DBA/1 WT and IFN-{gamma}–/– thyroids with 4–5+ severity scores 19 days after cell transfer (A) or in CBA/J thyroids with 4–5+ severity scores at day 19, which would develop fibrosis, or with 3+ severity scores, which would resolve at day 45 (B). Bars are means of data for thyroids of five individual mice ± SD. Results are expressed as the mean ratio of chemokine densitometric U/HPRT ± SD (x100) and are representative of three (A) or two (B) independent experiments. A significant difference between groups is indicated (*, P<0.05, or **, P<0.01).

Immunostaining was used to examine the kinetics and pattern of chemokine expression in G-EAT thyroids and confirmed that the protein expression of CXCL10 (Fig. 4A and 4B ), CXCL9 (Fig. 4C and 4D) , and CXCR3 (Fig. 4E and 4F) at days 19–21 correlated with expression of their transcripts, being reduced in IFN-{gamma}–/– compared with WT thyroids (Table 1 and Fig. 4A 4B 4C 4D 4E 4F ), although G-EAT severity (4–5+) at day 19 was comparable in both groups. At day 35, CXCR3+ cells were still present in WT thyroids, which maintained 4–5+ severity and became fibrotic, but CXCR3 was not detected in IFN-{gamma}–/– thyroids, which had resolved (Table 1 and Fig. 4 , G and H).



View larger version (123K):
[in this window]
[in a new window]
 
Figure 4. Higher expression of CXCL10, CXCL9, and CXCR3 protein in DBA/1 WT thyroids compared with IFN-{gamma}–/– thyroids. (A–H) Representative areas of photomicrographs demonstrating CXCL10 (A, B: dark brown), CXCL9 (C, D: brown), and CXCR3 (E–H: red) at day 19 (A–F) and day 35 (G, H) in DBA/1 WT (A, C, E, G) and IFN-{gamma}–/– thyroids (B, D, F, H). G-EAT severity was 4–5+ at day 19 in WT and IFN-{gamma}–/– thyroids. WT thyroids had 4–5+ severity scores and fibrosis at day 35, but lesions resolved at day 35 in IFN-{gamma}–/– thyroids (0+). Original magnification, A–H: x400.

As summarized in Table 1 , CXCL10 and CXCL9 were up-regulated at day 10, further increased at days 19–21, but were weak or undetectable at days 35–45 in WT thyroids. However, the expression pattern of CXCL10 and CXCL9 was different. CXCL10 was strongly localized in TEC as well as infiltrating cells in WT thyroids at day 19 (Fig. 4A) , and CXCL9 staining was largely confined to infiltrating inflammatory cells (Fig. 4C) . Expression of CXCL10 by TEC was strong from day 7 to day 19 in WT thyroids (Table 1 and data not shown). The fact that CXCL10 was undetectable in normal thyroids (Table 1) but was highly expressed by TEC in WT thyroids at day 7 (not shown) when inflammatory cells began infiltrating the thyroid suggests that CXCL10 expression by TEC was triggered by inflammation. These data suggest a potential role of TEC through the production of CXCL10 in regulating the recruitment of specific subsets of activated lymphocytes to the thyroid during autoimmune inflammation.

Expression of the profibrotic chemokines in thyroids that develop fibrosis versus those in which G-EAT lesions resolve
As MCP-1/CCL2 is recognized as a profibrotic chemokine [6 , 33 34 35 ], and CCR2 and CCR1 have been associated with autoimmune disease and/or development of fibrosis [5 , 8 , 21 , 22 , 35 ], their expression was analyzed in WT versus IFN-{gamma}–/– thyroids. CCL2 mRNA was not detectable in normal thyroids but was up-regulated in WT and IFN-{gamma}–/– thyroids at day 19. Levels of CCL2 in WT thyroids were significantly higher than in IFN-{gamma}–/– thyroids from day 19 to day 39 (Fig. 5A ). Expression of CCR2, the receptor for CCL2, was comparable in WT and IFN-{gamma}–/– thyroids from day 19 to day 39 (Fig. 5B) . Expression of CCR1 mRNA was also comparable in WT and IFN-{gamma}–/– thyroids at day 19 (Fig. 5B) but was higher in WT than in IFN-{gamma}–/– thyroids at days 28 and 39 (Fig. 5B) .



View larger version (14K):
[in this window]
[in a new window]
 
Figure 5. Levels of CCL2, CCR2, and CCR1 mRNA in DBA/1 WT versus IFN-{gamma}–/– thyroids. Expression of CCL2 (A) and CCR2 and CCR1 (B) mRNA in WT versus IFN-{gamma}–/– thyroids at days 19, 28, and 39 after cell transfer. Bars are means of data for thyroids of five individual mice ± SD. G-EAT severity was 4–5+ in DBA/1 WT thyroids at days 19, 28, and 39, G-EAT severity was 4–5+ at day 19, and lesions were resolving at day 28 (2–3+) and day 39 (2–0+) in DBA/1 IFN-{gamma}–/– thyroids. Results are expressed as the mean ratio of chemokine densitometric U/HPRT ± SD (x100) and are representative of three independent experiments. A significant difference was indicated (*, P<0.05).

Consistent with the gene expression (Fig. 5A) , levels of CCL2 protein were also higher in DBA/1 WT than in IFN-{gamma}–/– thyroids at days 10, 19, and 35 (Fig. 6A 6B 6C 6D , and Table 1 ). CCL2 protein was induced as early as day 7 in WT thyroids when inflammatory cells began infiltrating the thyroid (not shown) and was highest at day 19 (Fig. 6A and Table 1 ) when collagen deposition began (Fig. 6 E). CCL2 was still present in WT thyroids at day 35 (Fig. 6B and Table 1 ) when expression of collagen was stronger (Fig. 6F) . Many inflammatory cells, including macrophages and collagen-producing myofibroblasts, were immunopositive for CCL2 (not shown), and CCL2 was strongly expressed in areas of PMN infiltration in WT thyroids (Fig. 6A) . CCL2 was also induced at day 19 in IFN-{gamma}–/– thyroids (Fig. 6C) when there was minimal deposition of collagen (Fig. 6G) , but CCL2 was undetectable at day 35 when lesions were resolving (Fig. 6D and Table 1 ), and there was no (Fig. 6H) or minimal collagen deposition (not shown).



View larger version (133K):
[in this window]
[in a new window]
 
Figure 6. Protein expression of CCL2 and collagen in thyroids of DBA/1 WT versus IFN-{gamma}–/– mice or CBA/J mice in which G-EAT would progress to fibrosis or undergo resolution. (A–D and I–L) Representative areas of photomicrographs demonstrating CCL2 immunostaining (red color) of DBA/1 WT (A, B) and IFN-{gamma}–/– thyroids (C, D) or CBA/J thyroids (I–L) at day 19 (A, C, I, K) and day 35 (B, D, J, L). (E–H and M–P) Masson’s trichrome staining was used to demonstrate collagen deposition (blue color) of DBA/1 WT (E, F), IFN-{gamma}–/– (G, H), or CBA/J thyroids (M–P) at day 19 (E, G, M, O) and day 35 (F, H, N, P). Thyroids from WT DBA/1 or CBA/J mice with 5+ severity scores at day 19 with destruction of nearly all thyroid follicles showed deposition of collagen (E and M), which was stronger at day 35 (F, N). Collagen deposition was minimal at day 19 in IFN-{gamma}–/– thyroids with 5+ severity scores (G) or in CBA/J thyroids with 4+ severity scores (O) but was negative at day 35 in IFN-{gamma}–/– thyroids (H) or CBA/J thyroids (P), which resolved (1+ severity). Original magnification, A–P: x400.

CCL2 protein expression was higher at days 19 (Fig. 6I) and 35 (Fig. 6J) in CBA/J thyroids, which would progress to fibrosis (Fig. 6M and 6N) , than in CBA/J thyroids (Fig. 6K and 6L) , which would resolve (Fig. 6O and 6P) , although there were no differences in CCL2 mRNA expression between these two groups (data not shown).


arrow
DISCUSSION
 
Chemokines and their receptors are important for recruitment of specific leukocyte subpopulations to sites of tissue damage during inflammatory responses [2 3 4 ]. Influx of various inflammatory cells results in extensive inflammation in thyroids of DBA/1 WT or IFN-{gamma}–/– mice at day 19. Lesions resolve in IFN-{gamma}–/– thyroids but progress to fibrosis in WT thyroids by day 35 [16 ]. Deficiency of IFN-{gamma} reduces proinflammatory cytokines and promotes apoptosis of inflammatory cells, contributing to early resolution in IFN-{gamma}–/– thyroids [16 , 17 ]. The current study suggests that chemokines may also play a role in the inflammatory process in G-EAT.

Different chemokine expression patterns in WT versus IFN-{gamma}–/– thyroids may determine what specific inflammatory cells infiltrate the thyroids. CXCL1 expression was correlated with its receptor CXCR2 expression and PMN infiltration in DBA/1 WT thyroids (Figs. 1A and 2A) , and expression of CCL11 and CCL8 (Fig. 2B and 2C) correlated with CCR3 expression (Fig. 1F) and eosinophil infiltration in IFN-{gamma}–/– thyroids (Fig. 1D) . As CXCR2 and CCR3 are expressed selectively by PMNs and eosinophils, respectively [4 , 25 ], higher expression of CXCL1 in DBA/1 WT mice and higher expression of CCL11 and CCL8 in IFN-{gamma}–/– mice may explain the differences in cellular infiltration in these two strains: many PMNs in WT thyroids and many eosinophils but few PMNs in IFN-{gamma}–/– thyroids (Fig. 1) . CXCL1 was induced in WT thyroids as early as day 10. Early induction of CXCL1 was also detected in thyroid-derived leukocytes from human thyroid autoimmune diseases, suggesting that it may be an important chemokine involved in autoimmune thyroiditis [36 ]. Moreover, CXCL1 was predominant in WT DBA/1 or CBA/J thyroids, only when there was PMN infiltration, suggesting that it may be a potent chemokine directing PMNs to the thyroid. Studies have demonstrated the critical role of PMN infiltration in tissue damage, wound healing, and development of fibrosis [1 , 10 , 23 , 25 , 37 , 38 ]. Extensive PMN accumulation results in necrosis and may be associated with thyroid destruction [23 ]. In contrast, eosinophils in IFN-{gamma}–/– thyroids may not play a pathologic role, as inhibiting migration of eosinophils by anti-IL-5 antibody has no effect on G-EAT resolution in IFN-{gamma}–/– thyroids (unpublished data). Therefore, the differential expression of CXCL1 in WT thyroids and CCL11 and CCL8 in IFN-{gamma}–/– thyroids may be important in controlling the outcome of the autoimmune response. The role of CXCL2 and PMNs in G-EAT is under investigation using CXCR2–/– mice.

CXCR3, expressed predominantly on activated or memory T cells [39 , 40 ], was highly expressed by inflammatory cells at days 19 and 35 in thyroids of DBA/1 WT mice with severe G-EAT (Fig. 4 , E and G, and Table 1 ). CXCR3 was also expressed by infiltrating inflammatory cells in thyroids of patients with Graves’ disease [32 , 41 ] and has been associated with disease severity in several autoimmune diseases [32 , 39 40 41 42 43 ]. Levels of CXCR3 were low in IFN-{gamma}–/– thyroids, which eventually resolve, consistent with the finding that reduction [44 ] or deficiency [43 ] of CXCR3 reduces inflammation in other autoimmune disease models. Thus, the nature of the CD4 T cells may be different in WT versus IFN-{gamma}–/– thyroids, although there are similar numbers of CD4 T cells [16 ].

CXCL10 and CXCL9 are regulated by IFN-{gamma} and serve as CXCR3 ligands. Levels of CXCL10 and CXCL9 are in accordance with the numbers of CXCR3+ cells in DBA/1 WT versus IFN-{gamma}–/– thyroids, suggesting a functional relationship. An increase in CXCL10 and CXCL9 was found in thyroids of patients with Hashimoto’s thyroiditis and Graves’ disease [30 , 32 , 41 ]. Besides attracting CXCR3+ T cells, CXCL10 plays a role in promoting the function of effector cells through IFN-{gamma} release [45 , 46 ]. Blockade of CXCL10 resulted in reduced autoimmune destruction in autoimmune disease models [20 , 31 ]. There was reduced CXCL10 expression (Figs. 3A and 4B) and decreased apoptotic destruction of TEC in IFN-{gamma}–/– mice [17 ], suggesting that the CXCL10 pathway may play an important role in destructive tissue inflammation [19 , 20 , 31 ]. Moreover, CXCL10 was expressed by TEC during development of G-EAT (Fig. 4A and Table 1 ), and strong expression of CXCL10 by TEC was seen as early as day 7, when inflammatory cells began infiltrating thyroids (not shown). Increased CXCL10 mRNA expression was also found in patients with recent onset of Graves’ disease [32 ], and increased circulating CXCL10 was associated with aggressive autoimmune thyroiditis and hypothyroidism [19 ]. Other tissue cells such as pancreatic islet ß cells also can produce CXCL10 and CXCL9 upon autoimmune stimulation [43 ]. In addition, other chemokines (e.g., CXCL1, CCL4, CXCL9, and CXCL11) can be expressed by TEC of autoimmune thyroid diseases [11 , 28 , 34 ]. Thus, tissue cells such as TEC, in response to inflammation such as IFN-{gamma} stimulation [30 ], may function to modulate the autoimmune process in its initial phase. The above-cited experiments [19 , 30 , 32 , 43 ] and other evidence [11 , 19 , 47 , 48 ] support this notion. CXCL10 and CXCL9 were expressed in inflammatory diseases with an outcome of fibrosis [9 , 10 , 49 , 50 ]; however, experiments using CXCL10 or CXCR3 knockout mice showed that these chemokines were not involved in development of fibrosis [51 52 53 54 ]. This evidence, together with the fact that expression of CXCL10 mRNA was slightly higher at day 19 in CBA/J thyroids with 4–5+ severity, which would progress to fibrosis, than in those with 3+ severity, which would resolve, and that expression of CXCL9 mRNA was comparable in both groups, seems unlikely that CXCL10 and CXCL9 regulate the outcome (fibrosis vs. resolution) of G-EAT. Homeostatic chemokines such as CXCL13 and CCL21 have been shown to be expressed in human thyroids with autoimmune thyroid disease [13 , 55 ]. Gene expression of CXCL13 and CCL21 and the receptor for CCL21, CCR7, were also up-regulated in WT and IFN-{gamma}–/– thyroids at day 19, but their expression showed no differences between these two strains (data not shown), suggesting they may not be important in the outcome of G-EAT.

Certain chemokines have been implicated in the development of fibrosis [5 6 7 8 9 10 , 50 ]. CCL2 can regulate profibrotic cytokine generation [e.g., transforming growth factor (TGF)-ß1] and matrix deposition and is involved in chronic inflammatory/fibroproliferative diseases [6 , 33 34 35 ]. CCL2 mRNA was highly expressed in DBA/1 WT thyroids in which fibrosis developed [23 ], and inhibition of TGF-ß reduced thyroid fibrosis with reduction of CCL2 gene expression [16 , 23 ]. The current study showed that gene and protein expression of CCL2 was reduced in DBA/1 IFN-{gamma}–/– compared with WT thyroids. Although CCL2 gene expression was comparable in CBA/J thyroids, which would resolve or would progress to fibrosis, CCL2 protein expression was consistently lower in CBA/J thyroids, which would resolve. Our preliminary data showed that G-EAT can resolve in CCR2–/– mice (unpublished data). Together, these data suggest that CCL2 may contribute to development of fibrosis in G-EAT. CCL3, CCL4, CCL5, and CCR1, which have also been implicated in fibrosis [7 , 8 , 21 , 22 ], were up-regulated from day 10 to day 19 in WT thyroids (Fig. 5B and data not shown). Whether these chemokines promote thyroid fibrosis needs further clarification.

In conclusion, various chemokines were up-regulated during development of G-EAT in CBA/J or DBA/1 WT or IFN-{gamma}–/– mice, suggesting a role of chemokines in the coordination of a range of inflammatory responses in G-EAT. The selective expression of chemokines reflects differences in infiltrating cells in DBA/1 WT versus IFN-{gamma}–/– thyroids. Specifically, expression of CXCL1 correlated with PMN infiltration and G-EAT severity in CBA/J and DBA/1 mice, and expression of CCL11 and CCCL8 correlated with eosinophil infiltration in DBA/1 IFN-{gamma}–/– thyroids. Furthermore, as in human autoimmune thyroid disorders [19 , 32 ], the selective and differential expression of CXCL10 and CXCR3 in DBA/1 WT thyroids bears a close relationship to the patterns and severity of inflammatory pathology in this animal model. The capability of TEC to express certain chemokines such as CXCL10 may contribute to the local recruitment of autoreactive T cells and to the pathogenesis of autoimmune thyroid diseases. The characterization of chemokines/chemokine receptors in this study also provided a basis to further examine the role of the certain chemokines/chemokine receptors or infiltrating leukocyte populations in the pathology and resolution in G-EAT.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by NIH Grant DK35527 and by the Arthritis National Research Foundation. A. A. was supported through the University of Missouri Life Sciences Undergraduate Research Opportunity Program. We also thank Patti Mierzwa for excellent technical assistance.

Received February 20, 2005; revised April 29, 2005; accepted May 2, 2005.


arrow
REFERENCES
 
    1
  1. Tran, E. H., Prince, E. N., Owens, T. (2000) IFN-{{gamma}}shapes immune invasion of the central nervous system via regulation of chemokines J. Immunol. 164,2759-2768[Abstract/Free Full Text]
  2. 2
  3. Thelen, M. (2001) Dancing to the tune of chemokines Nat. Immunol. 2,129-134[CrossRef][Medline]
  4. 3
  5. Gerard, C., Rollins, B. J. (2001) Chemokines and disease Nat. Immunol. 2,108-115[CrossRef][Medline]
  6. 4
  7. Rollins, B. J. (1997) Chemokines Blood 90,909-928[Free Full Text]
  8. 5
  9. Moore, B. B., Paine, R., III, Christensen, P. J., Moore, T. A., Sitterding, S., Ngan, R., Wilke, C. A., Kuziel, W. A., Toews, G. B. (2001) Protection from pulmonary fibrosis in the absence of CCR2 signaling J. Immunol. 167,4368-4377[Abstract/Free Full Text]
  10. 6
  11. Lloyd, C. M., Minto, A. W., Dorf, M. E., Proudfoot, A., Wells, T. N. C., Salant, D. J., Gutierrez-Ramos, J-C. (1997) RANTES and monocyte chemoattractant protein-1 (MCP-1) play an important role in the inflammatory phase of crescentic nephritis, but only MCP-1 is involved in crescent formation and interstitial fibrosis J. Exp. Med. 185,1371-1380[Abstract/Free Full Text]
  12. 7
  13. Zhang, Y., McCormick, L. L., Desai, S. R., Wu, C., Gilliam, A. C. (2002) Murine sclerodermatous graft-versus-host disease, a model for human scleroderma: cutaneous cytokines, chemokines, and immune cell activation J. Immunol. 168,3088-3098[Abstract/Free Full Text]
  14. 8
  15. Anders, H-J., Vielhauer, V., Frink, M., Linde, Y., Cohen, C. D., Blattner, S. M., Kretzler, M., Strutz, F., Mack, M., Grone, H-J., Onuffer, J., Horuk, R., Nelson, P. J., Schlondorff, D. (2002) A chemokine receptor CCR-1 antagonist reduces renal fibrosis after unilateral ureter ligation J. Clin. Invest. 109,251-259[CrossRef][Medline]
  16. 9
  17. Belperio, J. A., Keane, M. P., Burdick, M. D., Lynch, J. P., III, Xue, Y. Y., Li, K., Ross, D. J., Strieter, R. M. (2002) Critical role for CXCR3 chemokine biology in the pathogenesis of bronchiolitis obliterans syndrome J. Immunol. 169,1037-1049[Abstract/Free Full Text]
  18. 10
  19. Miura, M., Morita, K., Koyanagi, T., Fairchild, R. L. (2003) Neutralization of monokine induced by interferon-[{gamma}] during the early posttransplantation period prevents development of chronic allograft vasculopathy and graft fibrosis Transplant. Proc. 35,875-877[Medline]
  20. 11
  21. Kimura, H., Kimura, M., Rose, N. R., Caturegli, P. (2004) Early chemokine expression induced by interferon-{gamma} in a murine model of Hashimoto’s thyroiditis Exp. Mol. Pathol. 77,161-167[CrossRef][Medline]
  22. 12
  23. Martin, A. P., Coronel, E. C., Sano, G., Chen, S. C., Vassileva, G., Canasto-Chibuque, C., Sedgwick, J. D., Frenette, P. S., Lipp, M., Furtado, G. C., Lira, S. A. (2004) A novel model for lymphocytic infiltration of the thyroid gland generated by transgenic expression of the CC chemokine CCL21 J. Immunol. 173,4791-4798[Abstract/Free Full Text]
  24. 13
  25. Armengol, M-P., Cardoso-Schmidt, C. B., Fernandez, M., Ferrer, X., Pujol-Borrell, R., Juan, M. (2003) Chemokines determine local lymphoneogenesis and a reduction of circulating CXCR4+ T and CCR7 B and T lymphocytes in thyroid autoimmune diseases J. Immunol. 170,6320-6328[Abstract/Free Full Text]
  26. 14
  27. Braley-Mullen, H., Sharp, G. C., Tang, H., Chen, K., Kyriakos, M., Bickel, J. T. (1998) Interleukin-12 promotes activation of effector cells that induce a severe destructive granulomatous form of experimental autoimmune thyroiditis Am. J. Pathol. 152,1347-1358[Abstract]
  28. 15
  29. Braley-Mullen, H., Sharp, G. C. (2000) Adoptive transfer murine model of granulomatous experimental autoimmune thyroiditis Int. Rev. Immunol. 19,535-555[Medline]
  30. 16
  31. Chen, K., Wei, Y., Sharp, G. C., Braley-Mullen, H. (2003) Mechanisms of spontaneous resolution versus fibrosis in granulomatous experimental autoimmune thyroiditis J. Immunol. 171,6236-6243[Abstract/Free Full Text]
  32. 17
  33. Chen, K., Wei, Y., Sharp, G. C., Braley-Mullen, H. (2005) Balance of proliferation and cell death between thyrocytes and myofibroblasts regulates thyroid fibrosis in granulomatous experimental autoimmune thyroiditis (G-EAT) J. Leukoc. Biol. 77,166-172[Abstract/Free Full Text]
  34. 18
  35. Savinov, A. Y., Wong, F. S., Chervonsky, A. V. (2001) IFN-{{gamma}} affects homing of diabetogenic T cells J. Immunol. 167,6637-6643[Abstract/Free Full Text]
  36. 19
  37. Antonelli, A., Rotondi, M., Fallahi, P., Romagnani, P., Ferrari, S. M., Buonamano, A., Ferrannini, E., Serio, M. (2004) High levels of circulating CXC chemokine ligand 10 are associated with chronic autoimmune thyroiditis and hypothyroidism J. Clin. Endocrinol. Metab. 89,5496-5499[Abstract/Free Full Text]
  38. 20
  39. Fife, B. T., Kennedy, K. J., Paniagua, M. C., Lukacs, N. W., Kunkel, S. L., Luster, A. D., Karpus, W. J. (2001) CXCL10 (IFN-{gamma}-inducible protein-10) control of encephalitogenic CD4+ T cell accumulation in the central nervous system during experimental autoimmune encephalomyelitis J. Immunol. 166,7617-7624[Abstract/Free Full Text]
  40. 21
  41. Eis, V., Luckow, B., Vielhauer, V., Siveke, J. T., Linde, Y., Segerer, S., De Lema, G. P., Cohen, C. D., Kretzler, M., Mack, M., Horuk, R., Murphy, P. M., Gao, J. L., Hudkins, K. L., Alpers, C. E., Grone, H. J., Schlondorff, D., Anders, H. J. (2004) Chemokine receptor CCR1 but not CCR5 mediates leukocyte recruitment and subsequent renal fibrosis after unilateral ureteral obstruction J. Am. Soc. Nephrol. 15,337-347[Abstract/Free Full Text]
  42. 22
  43. Blease, K., Mehrad, B., Standiford, T. J., Lukacs, N. W., Kunkel, S. L., Chensue, S. W., Lu, B., Gerard, C. J., Hogaboam, C. M. (2000) Airway remodeling is absent in CCR1–/– mice during chronic fungal allergic airway disease J. Immunol. 165,1564-1572[Abstract/Free Full Text]
  44. 23
  45. Chen, K., Wei, Y. Z., Sharp, G. C., Braley-Mullen, H. (2002) Inhibition of TGF1 by anti-TGF1 antibody or lisinopril reduces thyroid fibrosis in granulomatous experimental autoimmune thyroiditis J. Immunol. 169,6530-6538[Abstract/Free Full Text]
  46. 24
  47. Chen, K., Wei, Y. Z., Sharp, G. C., Braley-Mullen, H. (2000) Characterization of thyroid fibrosis in a murine model of granulomatous experimental autoimmune thyroiditis J. Leukoc. Biol. 68,828-835[Abstract/Free Full Text]
  48. 25
  49. Scapini, P., Lapinet-Vera, J. A., Gasperini, S., Calzetti, F., Bazzoni, F., Cassatella, M. A. (2000) The neutrophil as a cellular source of chemokines Immunol. Rev. 177,195-203[CrossRef][Medline]
  50. 26
  51. Rot, A., Krieger, M., Brunner, T., Bischoff, S. C., Schall, T. J., Dahinden, C. A. (1992) RANTES and macrophage inflammatory protein 1 {alpha} induce the migration and activation of normal human eosinophil granulocytes J. Exp. Med. 176,1489-1495[Abstract/Free Full Text]
  52. 27
  53. Heath, H., Qin, S., Rao, P., Wu, L., LaRosa, G., Kassam, N., Ponath, P. D., Mackay, C. R. (1997) Chemokine receptor usage by human eosinophils. The importance of CCR3 demonstrated using an antagonistic monoclonal antibody J. Clin. Invest. 99,178-184[Medline]
  54. 28
  55. Hanaoka, R., Kasama, T., Muramatsu, M., Yajima, N., Shiozawa, F., Miwa, Y., Negishi, M., Ide, H., Miyaoka, H., Uchida, H., Adachi, M. (2003) A novel mechanism for the regulation of IFN-{gamma} inducible protein-10 expression in rheumatoid arthritis Arthritis Res. Ther. 5,R74-R81[CrossRef][Medline]
  56. 29
  57. Brown, C. R., Blaho, V. A., Loiacono, C. M. (2003) Susceptibility to experimental Lyme arthritis correlates with KC and monocyte chemoattractant protein-1 production in joints and requires neutrophil recruitment via CXCR2 J. Immunol. 171,893-901[Abstract/Free Full Text]
  58. 30
  59. Garcia-Lopez, M. A., Sancho, D., Sanchez-Madrid, F., Marazuela, M. (2001) Thyrocytes from autoimmune thyroid disorders produce the chemokines IP-10 and Mig and attract CXCR3+ lymphocytes J. Clin. Endocrinol. Metab. 86,5008-5016[Abstract/Free Full Text]
  60. 31
  61. Christen, U., McGavern, D. B., Luster, A. D., von Herrath, M. G., Oldstone, M. B. A. (2003) Among CXCR3 chemokines, IFN-{{gamma}}-inducible protein of 10 kDa (CXC chemokine ligand (CXCL) 10) but not monokine induced by IFN-{{gamma}} (CXCL9) imprints a pattern for the subsequent development of autoimmune disease J. Immunol. 171,6838-6845[Abstract/Free Full Text]
  62. 32
  63. Romagnani, P., Rotondi, M., Lazzeri, E., Lasagni, L., Francalanci, M., Buonamano, A., Milani, S., Vitti, P., Chiovato, L., Tonacchera, M., Bellastella, A., Serio, M. (2002) Expression of IP-10/CXCL10 and MIG/CXCL9 in the thyroid and increased levels of IP-10/CXCL10 in the serum of patients with recent-onset Graves’ disease Am. J. Pathol. 161,195-206[Abstract/Free Full Text]
  64. 33
  65. Hayashidani, S., Tsutsui, H., Shiomi, T., Ikeuchi, M., Matsusaka, H., Suematsu, N., Wen, J., Egashira, K., Takeshita, A. (2003) Anti-monocyte chemoattractant protein-1 gene therapy attenuates left ventricular remodeling and failure after experimental myocardial infarction Circulation 108,2134-2140[Abstract/Free Full Text]
  66. 34
  67. Antoniades, H., Neville-Golden, J., Galanopoulos, T., Kradin, R. L., Valente, A. J., Graves, D. T. (1992) Expression of monocyte chemoattractant protein 1 mRNA in human idiopathic pulmonary fibrosis Proc. Natl. Acad. Sci. USA 89,5371-5375[Abstract/Free Full Text]
  68. 35
  69. Belperio, J. A., Keane, M. P., Burdick, M. D., Lynch, J. P., III, Xue, Y. Y., Berlin, A., Ross, D. J., Kunkel, S. L., Charo, I. F., Strieter, R. M. (2001) Critical role for the chemokine MCP-1/CCR2 in the pathogenesis of bronchiolitis obliterans syndrome J. Clin. Invest. 108,547-556[CrossRef][Medline]
  70. 36
  71. Aust, G., Steinert, M., Boltze, C., Kiessling, S., Simchen, C. (2001) GRO-{alpha} in normal and pathological thyroid tissues and its regulation in thyroid-derived cells J. Endocrinol. 170,513-520[Abstract]
  72. 37
  73. Schmitt, A., Jouault, H., Guichard, J., Wendling, F., Drouin, A., Cramer, E. M. (2000) Pathologic interaction between megakaryocytes and polymorphonuclear leukocytes in myelofibrosis Blood 96,1342-1347[Abstract/Free Full Text]
  74. 38
  75. Milatovic, S., Nanney, L. B., Yu, Y., White, J. R., Richmond, A. (2003) Impaired healing of nitrogen mustard wounds in CXCR2 null mice Wound Repair Regen. 11,213-219[CrossRef][Medline]
  76. 39
  77. Qin, S., Rottman, J. B., Myers, P., Kassam, N., Weinblatt, M., Loetscher, M., Koch, A. E., Moser, B., Mackay, C. R. (1998) The chemokine receptors CXCR3 and CCR5 mark subsets of T cells associated with certain inflammatory reactions J. Clin. Invest. 101,746-754[Medline]
  78. 40
  79. Ruth, J. H., Rottman, J. B., Katschke, K. J., Jr, Qin, S., Wu, L., LaRosa, G., Ponath, P., Pope, R. M., Koch, A. E. (2001) Selective lymphocyte chemokine receptor expression in the rheumatoid joint Arthritis Rheum. 44,2750-2760[CrossRef][Medline]
  80. 41
  81. Aust, G., Sittig, D., Steinert, M., Lamesch, P., Lohmann, T. (2002) Graves’ disease is associated with an altered CXCR3 and CCR5 expression in thyroid-derived compared to peripheral blood lymphocytes Clin. Exp. Immunol. 127,479-485[CrossRef][Medline]
  82. 42
  83. Balashov, K. E., Rottman, J. B., Weiner, H. L., Hancock, W. W. (1999) CCR5+ and CXCR3+ T cells are increased in multiple sclerosis, and their ligands MIP-1{alpha} and IP-10 are expressed in demyelinating brain lesions Proc. Natl. Acad. Sci. USA 96,6873-6878[Abstract/Free Full Text]
  84. 43
  85. Frigerio, S., Junt, T., Lu, B., Gerard, C., Zumsteg, U., Hollander, G. A., Piali, L. (2002) ß cells are responsible for CXCR3-mediated T-cell infiltration in insulitis Nat. Med. 8,1414-1420[CrossRef][Medline]
  86. 44
  87. Sarween, N., Chodos, A., Raykundalia, C., Khan, M., Abbas, A. K., Walker, L. S. K. (2004) CD4+CD25+ cells controlling a pathogenic CD4 response inhibit cytokine differentiation, CXCR-3 expression, and tissue invasion J. Immunol. 173,2942-2951[Abstract/Free Full Text]
  88. 45
  89. Dufour, J. H., Dziejman, M., Liu, M. T., Leung, J. H., Lane, T. E., Luster, A. D. (2002) IFN-{{gamma}}-inducible protein 10 (IP-10; CXCL10)-deficient mice reveal a role for IP-10 in effector T cell generation and trafficking J. Immunol. 168,3195-3204[Abstract/Free Full Text]
  90. 46
  91. Gangur, V., Simons, F. E., Hayglass, K. T. (1998) Human IP-10 selectively promotes dominance of polyclonally activated and environmental antigen-driven IFN over IL-4 responses FASEB J. 12,705-713[Abstract/Free Full Text]
  92. 47
  93. Caturegli, P., Hejazi, M., Suzuki, K., Dohan, O., Carrasco, N., Kohn, L. D., Rose, N. R. (2000) Hypothyroidism in transgenic mice expressing IFN-{gamma} in the thyroid Proc. Natl. Acad. Sci. USA 97,1719-1724[Abstract/Free Full Text]
  94. 48
  95. Kemp, E. H., Metcalfe, R. A., Smith, K. A., Woodroofe, M. N., Watson, P. F., Weetman, A. P. (2003) Detection and localization of chemokine gene expression in autoimmune thyroid disease Clin. Endocrinol. (Oxf.) 59,207-213[CrossRef][Medline]
  96. 49
  97. Harvey, C. E., Post, J. J., Palladinetti, P., Freeman, A. J., Ffrench, R. A., Kumar, R. K., Marinos, G., Lloyd, A. R. (2003) Expression of the chemokine IP-10 (CXCL10) by hepatocytes in chronic hepatitis C virus infection correlates with histological severity and lobular inflammation J. Leukoc. Biol. 74,360-369[Abstract/Free Full Text]
  98. 50
  99. Keane, M., Arenberg, D., Lynch, J., III, Whyte, R., Iannettoni, M., Burdick, M., Wilke, C., Morris, S., Glass, M., DiGiovine, B., Kunkel, S., Strieter, R. (1997) The CXC chemokines, IL-8 and IP-10, regulate angiogenic activity in idiopathic pulmonary fibrosis J. Immunol. 159,1437-1443[Abstract]
  100. 51
  101. Jiang, D., Liang, J., Hodge, J., Lu, B., Zhu, Z., Yu, S., Fan, J., Gao, Y., Yin, Z., Homer, R., Gerard, C., Noble, P. W. (2004) Regulation of pulmonary fibrosis by chemokine receptor CXCR3 J. Clin. Invest. 114,291-299[CrossRef][Medline]
  102. 52
  103. Tager, A. M., Kradin, R. L., LaCamera, P., Bercury, S. D., Campanella, G. S., Leary, C. P., Polosukhin, V., Zhao, L. H., Sakamoto, H., Blackwell, T. S., Luster, A. D. (2004) Inhibition of pulmonary fibrosis by the chemokine IP-10/CXCL10 Am. J. Respir. Cell Mol. Biol. 31,395-404[Abstract/Free Full Text]
  104. 53
  105. Keane, M. P., Belperio, J. A., Arenberg, D. A., Burdick, M. D., Xu, Z. J., Xue, Y. Y., Strieter, R. M. (1999) IFN-{{gamma}}-inducible protein-10 attenuates bleomycin-induced pulmonary fibrosis via inhibition of angiogenesis J. Immunol. 163,5686-5692[Abstract/Free Full Text]
  106. 54
  107. Kelly, M., Kolb, M., Bonniaud, P., Gauldie, J. (2003) Re-evaluation of fibrogenic cytokines in lung fibrosis Curr. Pharm. Des. 9,39-49[CrossRef][Medline]
  108. 55
  109. Aust, G., Sittig, D., Becherer, L., Anderegg, U., Schutz, A., Lamesch, P., Schmucking, E. (2004) The role of CXCR5 and its ligand CXCL13 in the compartmentalization of lymphocytes in thyroids affected by autoimmune thyroid diseases Eur. J. Endocrinol. 150,225-234[Abstract]



This article has been cited by other articles:


Home page
EndocrinologyHome page
E. Borgogni, E. Sarchielli, M. Sottili, V. Santarlasci, L. Cosmi, S. Gelmini, A. Lombardi, G. Cantini, G. Perigli, M. Luconi, et al.
Elocalcitol Inhibits Inflammatory Responses in Human Thyroid Cells and T Cells
Endocrinology, July 1, 2008; 149(7): 3626 - 3634.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Yu, G. C. Sharp, and H. Braley-Mullen
Thyrocytes Responding to IFN-{gamma} Are Essential for Development of Lymphocytic Spontaneous Autoimmune Thyroiditis and Inhibition of Thyrocyte Hyperplasia
J. Immunol., January 15, 2006; 176(2): 1259 - 1265.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
jlb.0205102v1
78/3/716    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, K.
Right arrow Articles by Braley-Mullen, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, K.
Right arrow Articles by Braley-Mullen, H.