PeproTech Inc.
Originally published online as doi:10.1189/jlb.1204699 on July 6, 2005

Published online before print July 6, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.1204699v1
78/3/665    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, J.
Right arrow Articles by Koziel, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, J.
Right arrow Articles by Koziel, H.
(Journal of Leukocyte Biology. 2005;78:665-674.)
© 2005 by Society for Leukocyte Biology

Negative regulatory role of mannose receptors on human alveolar macrophage proinflammatory cytokine release in vitro

Jianmin Zhang, Souvenir D. Tachado, Naimish Patel, Jinping Zhu, Amy Imrich, Pascal Manfruelli, Melanie Cushion, T. Bernard Kinane and Henry Koziel1

Division of Pulmonary & Critical Care Medicine, Department of Medicine, Beth Israel Deaconess Medical Center, Harvard School of Public Health, and Pediatric Pulmonary Medicine, Massachusetts General Hospital and Harvard Medical School, Boston

1Correspondence: Division of Pulmonary, Critical Care and Sleep Medicine, Kirstein Hall, Room E/KSB-23, Beth Israel Deaconess Medical Center, 330 Brookline Avenue, Boston, MA 02215. E-mail: hkoziel{at}bidmc.harvard.edu


arrow
ABSTRACT
 
Alveolar macrophages (AM) are critical components of lung innate immunity and contribute to an effective host response to Pneumocystis pneumonia. Recognition of unopsonized Pneumocystis organisms by human AM is mediated predominantly via mannose receptors and results in phagocytosis, release of reactive oxygen species, and activation of the nuclear transcription factor (NF)-{kappa}B. However, the AM host defense genes activated by Pneumocystis have not been defined. In the present study, incubation of AM with unopsonized Pneumocystis organisms was not associated with release of interleukin (IL)-1ß, IL-6, or tumor necrosis factor (TNF)-{alpha} (important cytokines in the host response to Pneumocystis) and did not induce IL-1ß, IL-6, or TNF-{alpha} mRNA transcripts. These findings were not attributed to Pneumocystis-induced cytopathic changes, as these same AM released IL-8 and matrix metalloproteinase-9 in response to Pneumocystis. NF-{kappa}B-mediated IL-8 release was independent of Pneumocystis phagocytosis. The observed response was specific, as IL-1ß, IL-6, and TNF-{alpha} release and mRNA induction were preserved in response to lipopolysaccharide or serum-opsonized Pneumocystis. The absence of IL-1ß, IL-6, and TNF-{alpha} release in response to Pneumocystis was predominately influenced by AM mannose receptors, as blocking mannose receptors or targeted mannose receptor small interfering RNA functional gene silencing resulted in TNF-{alpha} release in response to unopsonized Pneumocystis organisms. Furthermore, ligation of AM mannose receptors by unopsonized Pneumocystis organisms reduced Toll-like receptor 4-mediated TNF-{alpha} release. Taken together, these data suggest that mannose receptors on human AM may suppress select proinflammatory cytokine release and may serve to regulate the innate inflammatory responses to infectious challenge in the lungs.

Key Words: innate immunity • host defense • immunology • phagocytosis


arrow
INTRODUCTION
 
Life-threatening Pneumocystis pneumonia represents a common infectious complication of immunocompromised persons [1 , 2 ], although the underlying mechanisms contributing to disease pathogenesis remain incompletely understood. The critical contribution of CD4+ T lymphocytes in host susceptibility to Pneumocystis pneumonia is well-recognized, where depletion to critical levels increases the clinical susceptibility to pneumonia [3 4 5 ], and repletion of immunocompetent CD4+ T lymphocytes into mice with Pneumocystis pneumonia is associated with resolution of pneumonia in the absence of specific antimicrobials [6 , 7 ]. However, several studies suggest that resolution of Pneumocystis pneumonia can occur despite persistent depletion of CD4+ T lymphocytes [8 9 10 11 ]. Taken together, these observations suggest that CD4+ T lymphocyte-independent mechanisms also contribute to protective host responses to Pneumocytsis and suggest roles for other lung immune cells, such as alveolar macrophages (AM).

AM are the predominant resident host defense cells in the alveolar airspaces and are critical components of the pulmonary innate immune response to infectious challenge. Experimental data support the concept that AM contribute to an effective host response to Pneumocystis [6 , 7 , 9 , 12 13 14 15 16 17 ]. Recognition of unopsonized Pneumocystis organisms by human AM is mediated predominantly via mannose receptors and results in binding and phagocytosis [18 , 19 ], release of reactive oxygen species [20 ], and activation of the nuclear transcription factor (NF)-{kappa}B [21 ]. However, the AM host defense genes activated as a consequence of Pneumocystis-mediated NF-{kappa}B activation have not been fully defined.

An effective host response to Pneumocystis involves proinflammatory cytokines such interleukin (IL)-1ß [22 ], IL-6 [23 ], and tumor necrosis factor (TNF)-{alpha} [24 ]. In the murine model, resolution of Pneumocystis pneumonia is associated with the induction of IL-1ß, IL-6, and TNF-{alpha} mRNA [25 ] and an influx of AM [25 ]. Although AM may represent the source of TNF-{alpha} in vivo [26 ], whether direct activation of human AM by Pneumocystis organisms is sufficient for cytokine release has not been established. With human peripheral blood monocyte-derived macrophages, unopsonized Pneumocystis organisms induce the release of IL-1ß, IL-6, and TNF-{alpha} [27 ]. However, recognizing that macrophages from different organs may exhibit distinct functions [28 ], whether Pneumocystis induces a similar release of host defense cytokines by human AM has not been investigated previously. To further define the role of human AM in the innate immune response to opportunistic pulmonary pathogens, the purpose of this study was to examine the release of host defense cytokines IL-1ß, IL-6, and TNF-{alpha} by human AM in response to unopsonized Pneumocystis organisms in vitro and examine the specific role of AM mannose receptors.


arrow
MATERIALS AND METHODS
 
Human AM
Research bronchoscopy subjects included prospectively recruited, healthy 18- to 55-year-old adults without evidence for active pulmonary disease and with normal spirometry. Subjects were without known risk factors for human immunodeficiency virus (HIV) infection and confirmed to be HIV-seronegative by enzyme-linked immunosorbent assay (ELISA; performed according to the manufacturer’s instructions; Abbott Diagnostics, N. Chicago, IL). Pulmonary immune cells were obtained by bronchoalveolar lavage (BAL) using standard techniques as described previously [19 ]. All procedures were performed on consenting adults through protocols fully approved by the Beth Israel Deaconess Medical Center Institutional Review Board (Boston, MA). The cells were separated from the pooled BAL fluid as described previously [19 ] and counted on a hemacytometer with light microscopy. AM were isolated by adherence to plastic-bottom tissue-culture plates (3x106 cells/well in six-well plates for Western blotting; 7.5x105 cells/well in 24-well plates for ELISA) or 13 mm round glass cover slips (2.5x105 cells/slip in 24-well plates for phagocytosis) as described previously [19 ]. Isolation of AM from all healthy persons yielded cells that were ≥98% viable, as determined by trypan blue dye exclusion, and demonstrated >95% positive, nonspecific esterase staining by light microscopy.

Rat AM
For select experiments to validate the response of human AM to rat-derived Pneumocystis, rat AM are obtained from killed adult female CD rats (225–250 g) by tracheobronchoalveolar lavage as described previously [21 ]. Cell count and viability are determined by hemocytometer and trypan blue exclusion (Sigma Chemical Co., St. Louis, MO). AM are isolated by adherence in 24-well plates (7.5x105 cells/well x3 h at 37°C in 5% CO2) and then washed and replaced with fresh complete media RPMI 1640 with 10% fetal bovine serum.

Pneumocystis organisms
As sustainable cultivation of Pneumocysitis is not possible, and Pneumocystis derived from human disease (Pneumocystis jirovecii [29 ]) is rarely available, Pneumocystis organisms were obtained from chronically immunosuppressed male Lewis rats (University of Cincinnati Lab Animal Medicine Facility, OH) as described previously [21 ]. Isolated Pneumocystis mixed life-cycle preparations yield ~90% trophozoite and 10% cyst forms, and viability was >85% [30 ]. Pneumocystis preparations were relatively free of contaminating rat-derived proteins [20 ], and preparations were endotoxin-free (<1.0 endoxotin units/ml) as determined by the E-toxate Limulus polyphemus assay (Sigma Chemical Co.). For select experiments to examine the influence of opsonization on macrophage release of cytokines, Pneumocystis organisms were incubated with 20% heat-inactivated human immune serum at 37°C for 30 min and then washed x3 in phosphate-buffered saline prior to incubation with human AM.

Protein detection in cultured supernatants by ELISA
Human and rat AM are incubated with Pneumocystis or lipopolysaccharide (LPS) for 24 h at 37°C in humidified 5% CO2. Culture supernatants are harvested and centrifuged to remove cellular debris, and aliquots are stored at –80°C until assayed. Specific immunoreactivity for human IL-1ß, IL-6, TNF-{alpha}, IL-8, and matrix metalloproteinase-9 (MMP-9; R&D Systems, Minneapolis, MN) or rat IL-1ß, IL-6, TNF-{alpha}, or cytokine-induced neutrophil chemoattractant-1 (CINC-1; analog to human IL-8; Assay Designs, Inc., Ann Arbor, MI) in culture supernatants was measured by ELISA according to the manufacturer’s protocol. Samples are assayed in duplicate on a Biotek plate reader and quantitation performed compared with a standard curve. Select experiments used the Toll-like receptor 4 (TLR4)-specific ligand, lipid A (Escherichia coli F583 Rd mutant, Sigma Chemical Co.).

RNA isolation and mRNA analysis
Total RNA was isolated from AM using Trizol buffer (Gibco-BRL, San Diego, CA) according to the manufacturer’s protocol and stored at –80°C until analysis. Specific host defense gene mRNA was detected by three independent methods.

Macroarray gene expression hybridization analysis
Simultaneous measurement of mRNA for 375 human host defense genes was performed using macroarray hybridization (Human Cytokine Expression Array, Catalog No. GA001, R&D Systems), according to the manufacturer’s protocol. Briefly, the cDNA labeling was performed by first annealing human cytokine-specific primers to the RNA samples in a thermal cycler (90°C for 2 min and then ramp to 42°C in 20 min) and then adding radiolabeled nucleotide [{alpha}-P33]-deoxy-cytidine 5'-triphosphate (2500 Ci/mmol) and avian myloblastosis reverse transcriptase (RT). Following purification of labeled cDNA using spin columns, hybridization was performed in roller bottles in a hybridization oven (65°C for 18 h). The arrays were washed five times in saline sodium citrate 1% sodium dodecyl sulfate (3 min at 21°C x2 and then 20 min at 65°C x3). Following air-drying for 5 min, the arrays were wrapped in clear plastic and subject to autoradiography using Kodak BioMax MR imaging film (Kodak, Rochester, NY) for 3 days at –80°C. Quantitation of gene expression was performed by densitometry using ArrayVision software (Imaging Research Inc., St. Catherine’s, Ontario, Canada). For each array, the radioactive intensity of each spot was normalized to housekeeping genes, and nonspecific background was subtracted from each spot. Corresponding data compared unstimulated AM to LPS- or Pneumocystis-stimulated AM, and normalized signals were expressed as fold-induction.

mRNA detection by RT-polymerase chain reaction (PCR)
RT reactions are performed using a first-strand cDNA synthesis kit and a PCR core kit (Roche Molecular Biochemicals, Indianapolis, IN) according to the manufacturer’s instructions. The following primers are used for RT-PCR: TNF-{alpha}: 5'-AGC CCA TGT TGT AGC AAA CC-3' and 5'-GGA AGA CCC CTC CCA GAT AG-3'; MMP-9: 5'-CAT GAA CCG TGA GGA TGT TG-3' and 5'-CCT TCA GCC AGA AGA ACC TG-3'; transforming growth factor (TGF)-ß: 5'-AGG ACC TTG CTG TAC TGC GT-3' and 5'-GTA CCT GAA CCC GTG TTG CT-3'; ß-actin: 5'-CAT GAA CCG TGA GGA TGT TG-3' and 5'-CCT TCA GCC AGA AGA ACC TG-3'. The PCR conditions for the first-strand cDNA synthesis included 35 cycles at 96°C for 1 min, 57°C for 1 min, and 42°C for 60 min. The PCR condition for amplification of specific DNA fragments included 30 cycles at 94°C for 30 s, 65°C for 1 min, and 72°C for 3 min. PCR products were resolved by 1.2% agarose gel.

Quantitative analysis of mRNA by real-time RT-PCR
Total RNA was isolated from AM using RNAzol according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Amplification was performed with the following PCR cycle sequence: 30 min at 50°C (stage 1), 15 min at 95°C (stage 2), and 15 s at 94°C followed by 60 s at 60°C (stage 3, repeated for 40 cycles). Detection was performed with an ABI Prism 7700 sequence detector (ABI, Foster City, CA). The primers used for quantitative real-time PCR included: TNF-{alpha}: 5'-GGT GCT TGT TCC TCA GCC TC-3' and 5'-CAG GCA GAA GAG CGT GGT G-3', probe CTC CTT CCT GAT CGT GGC AGG CG; IL-8: 5'-CTG GCC GTG GCT CTC TTG-3' and 5'-CCT TGG CAA AAC TGC ACC TT-3', probe CAG CCT TCC TGA TTT CTG CAG CTC TGT GT; MMP-9: 5'-GCA GCA CTT CTT GGG TCT GAA-3' and 5'-AGG TGC GTG CAT CAT CTC C-3', probe CCG GGC AAC TGG ACA CAT CTA CCC; TGF-ß: 5'-CCA CGG AGA AGA ACT GCT GC-3' and 5'-CAC TTC CAG CCG AGG TCC T-3', probe TGC GGC AGC TGT ACA TTG ACT TCC G. The TaqMan® probe sequence was AGC AAC CTG TGC ATT CCC GTT CAA GTT. Data were normalized to human 18S rRNA (internal control) labeled with VIC/tetramethylrhodamine (Applied Biosystems Inc., Foster City, CA). Results of the real-time PCR data were represented as comparative values of the threshold cycle of PCR at which amplified product is first detected. Data were expressed as a fold-induction comparing stimulated to unstimulated cells.

Small interfering (si)RNA gene silencing of AM mannose receptors
To determine the specific contribution of mannose receptors to Pneumocystis-mediated cytokine release, phagocytosis, and signaling, siRNA gene silencing was used to produce functional "knock-down" of human AM mannose receptors as described previously [21 ]. Experiments used the following oligonucleotide (annealed double-stranded siRNA, Qiagen, Valencia, CA) for human mannose receptor siRNA (siRNA3): DNA target sequences, AAGTGGTACGCAGATTGCACG from 528 base pairs (bp) to 549 bp; 5'-GUGGUACGCAGAUUGCACG-3'; and 3'-CGUGCAAUCUGCGUACCAC-5'. Mannose receptor siRNA was transfected into AM using TransMessenger transfection reagent (Qiagen). Double-stranded siRNA3 specifically targeted different domains of the mannose receptor and provided the most robust suppression of mannose receptor mRNA [31 ]. Double-stranded laminarin siRNA and single-stranded mannose receptor siRNA are used as controls to examine specificity of gene silencing. The nonsilencing, rhodamine-labeled siRNA was used to determine transfection efficiency.

AM phagocytosis of Pneumocystis
Adherent AM were incubated with fluorescein isothiocyanate (FITC)-labeled Pneumocystis [18 ] at an organism-to-cell ratio of 10:1 for 60 min at 37°C in 5% CO2. Following washing and fixation, images were captured on a fluorescence microscope with a digital camera (Nikon Eclipse E800; Diagnostic Instruments, Sterling Heights, MI), and phagocytic index was determined by confocal microscopy as described previously [19 ] using a Sarastro 2000 confocal laser-scanning microscope (Molecular Dynamics, Sunnyvale, CA) fitted with a 25-mW argon-ion laser. Experimental conditions included BAY 11-7082 (E)-3-[4-methylphenylsulfonyl]-2-propenenitrile (BAY-11; Niomol Research Laboratories, Plymouth Meeting, PA), an inhibitor of NF-{kappa}B activation [32 ], and cytocholasin B, an inhibitor of actin-polymerization and phagocytosis. Experimental conditions were performed in duplicate, and the number of FITC-labeled organisms phagocytosed per 200 AM was counted on at least two separate slides.

Statistical analysis
Experimental conditions were performed in duplicate or triplicate and repeated with AMs from at least three different individuals. Data were analyzed with an Apple G3 Power PC computer using StatView (SAS Institute, Inc., Cary, NC) and INSTAT2 (Graph Pad Software, San Diego, CA) statistical software. Nonparametric data were analyzed by Fischer Exact test or ANOVA. Statistical significance was accepted for P < 0.05.


arrow
RESULTS
 
Unopsonized Pneumocystis organisms do not induce IL-1ß, IL-6, or TNF-{alpha} release by human AM
To examine the ability of Pneumocystis to induce proinflammatory cytokine release, adherent human AM were incubated with unopsonized Pneumocystis organisms, and release of cytokines into the cultured supernatants was determined by ELISA. Unstimulated, adherent human AM demonstrated minimal spontaneous release of TNF-{alpha} after 24 h (Fig. 1A ). Following incubation with Pneumocystis organisms, AM TNF-{alpha} release was not significantly different compared with unstimulated macrophages. In contrast, incubation with LPS resulted in a significant increase in TNF-{alpha} release by human AM. Similar patterns of responses were observed for IL-1ß (Fig. 1B) and IL-6 (Fig. 1C) , with minimal increase in the release of IL-1ß or IL-6 in response to Pneumocystis, whereas IL-1ß and IL-6 release by AM was increased significantly in response to LPS.



View larger version (20K):
[in this window]
[in a new window]
  		Figure 1. Unopsonized Pneumocystis organisms do not induce IL-1ß, IL-6, or TNF-{alpha} release by human AM. Adherent human AM were incubated with Pneumocystis (Pc; ratio of 10:1 Pc:AM) or LPS (1 µg/ml) for 24 h, and release of host defense gene products in cultured supernatants was measured by ELISA and compared with unstimulated (Unstim) macrophages. Experiments compared (A–E) unopsonized Pneumocystis to (F) heat-inactivated, immune, serum-opsonized Pneumocystis (Op-Pc). Data represent results using AM from at least three different individuals. Values are mean ± SEM; *, P< 0.05, compared with unstimulated.

Next, experiments were performed to determine whether AM viability was influenced by incubation with Pneumocystis organisms. AM viability was not altered by incubation with Pneumocystis organisms over 24 h, as determined by trypan blue dye exclusion (data not shown). Furthermore, assay of the cultured supernatants for other macrophage secretory products revealed that unopsonized Pneumocystis organisms stimulated the release of IL-8 (Fig. 1D) and MMP-9 (Fig. 1E) by AM. Finally, in contrast to unopsonized organisms, incubation with opsonized Pneumocystis resulted in the release of TNF-{alpha} (Fig. 1F) . These data demonstrate that unopsonized Pneumocystis organisms do not stimulate the release of IL-1ß, IL-6, and TNF-{alpha} specifically, and the relative lack of TNF-{alpha}, IL-1ß, or IL-6 release was not attributable to Pneumocystis-mediated, cytopathic changes in AM.

Unopsonized Pneumocystis organisms do not induce IL-1ß, IL-6, or TNF-{alpha} release by rat AM
To determine whether the relative lack of IL-1ß, IL-6, and TNF-{alpha} release by human AM in response to Pneumocystis was related to the species of origin for the Pneumocystis (rat origin), experiments were repeated using rat AM. Unstimulated, adherent rat AM released low levels of IL-1ß, IL-6, and TNF-{alpha} over 24 h. Incubation of rat AM with unopsonized Pneumocystis organisms (rat origin) did not stimulate release of IL-1ß (Fig. 2A ), IL-6 (Fig. 2B) , or TNF-{alpha} (Fig. 2C) above unstimulated levels. In contrast, release of CINC-1 (rat analog to human IL-8) was increased following incubation with unopsonized Pneumocystis (Fig. 2D) . Taken together, these data demonstrated that the lack of increase in IL-1ß, IL-6, and TNF-{alpha} release by human AM was not attributed to species differences. Furthermore, the similar patterns of cyokine and chemokine release by human and rat AM in response to Pneumocystis organisms, in part, validate the experimental model.



View larger version (17K):
[in this window]
[in a new window]
  		Figure 2. Unopsonized Pneumocystis organisms do not induce IL-1ß, IL-6, or TNF-{alpha} release by rat AM. Adherent rat AM were incubated with unopsonized Pneumocystis (Pc; ratio of 10:1 Pc:AM) or LPS (1 µg/ml) for 24 h, and release of host defense gene products in cultured supernatants was measured by ELISA and compared with unstimulated (Unstim) macrophages. CINC-1 is an analog to human IL-8. Values are mean ± SEM (n= 3); *, P< 0.05, compared with unstimulated.

Unopsonized Pneumocytsis organisms do not induce human AM IL-1ß, IL-6, or TNF-{alpha} mRNA
To determine the level of proinflammatory cytokine regulation, experiments next examined the ability of Pneumocystis organisms to induce proinflammatory cytokine mRNA in human AM, using three independent measurements. First, using simultaneous mRNA determinations for 375 host defense genes, incubation of adherent human AM with unopsonized Pneumocystis organisms induced mRNA for 35 different host defense genes, but the induced genes did not include mRNA for IL-1ß, IL-6, or TNF-{alpha} (Table 1 ). By independent measurements selected from these same samples, stable mRNA transcripts for IL-1ß, IL-6 (data not shown), and TNF-{alpha} were not induced as determined by RT-PCR (Fig. 3A ). Furthermore, quantitative assessment for mRNA by real-time PCR confirmed these observations, demonstrating the absence of mRNA induction of TNF-{alpha} (Fig. 3B) . In contrast, mRNA for MMP-9 was increased in response to Pneumocystis (Fig. 3B) . Taken together, these independent data demonstrated that Pneumocystis did not induce mRNA transcripts for IL-1ß, IL-6, or TNF-{alpha} in human AM in vitro.


View this table:
[in this window]
[in a new window]
  		Table 1. Induction of Host Defense Gene mRNA in Human Alveolar Macrophages*



View larger version (14K):
[in this window]
[in a new window]
  		Figure 3. Unopsonized Pneumocytsis organisms do not induce human AM. TNF-{alpha} mRNA. Total human AM RNA was isolated following incubation with unopsonized Pneumocystis (Pc; ratio of 10:1 Pc:AM) for 6 h and probed for specific host defense mRNA by (A) qualitative assessment using RT-PCR and (B) quantitative assessment of mRNA induction of host defense genes by real-time PCR. Data expressed as mRNA fold-induction as ratio of Pc-stimulated versus unstimulated (Unstim). Values are mean ± SEM (n=3).

IL-8 release was independent of phagocytosis of unopsonized Pneumocystis organisms by human AM
To determine whether the absence of proinflammatory cytokine release was in part attributed to AM functional defects, experiments investigated Pneumocystis phagocytosis by human AM in vitro. Qualitative assessment by fluorescence microscopy demonstrated that human AM bound and phagocytosed unopsonized Pneumocystis organisms (Fig. 4A ). Quantitative assessment demonstrated that Pneumocystis phagocytosis was reduced in the presence of cytocholasin B or functional gene silencing of mannose receptors but not influenced by NF-{kappa}B inhibition (Fig. 4B) . In contrast, IL-8 release was dependent on NF-{kappa}B activation (Fig. 4C) . These data confirmed that the absence of IL-1ß, IL-6, and TNF-{alpha} release was not attributed to defects in Pneumocystis phagocytosis and that phagocytosis was independent of NF-{kappa}B activation and IL-8 release.



View larger version (54K):
[in this window]
[in a new window]
  		Figure 4. AM NF-{kappa}B activation and IL-8 release were independent of phagocytosis of unopsonized Pneumocystis organisms. (A) Adherent human AM were incubated with unopsonized Pneumocystis (Pc alone; ratio of 10:1 Pc:AM) for 60 min in the presence or absence of BAY-11 [Bay 11+Pc; 50 µM; inhibitor of {kappa}B (I-{kappa}B)], functional gene silencing of mannose receptors (MRsiRNA+Pc), or cytochalasin B (CytoB+Pc; inhibitor of actin polymerization and phagocytosis) and examined by epifluorescence microscopy. Pneumocystis appear as yellow-green (FITC-labeled), AM are counterstained red (Cy3-labeled antiactin), and macrophage nuclei appear magenta-blue (4,6-diamidino-2-phenylindole stain). Representative fields for AM from one individual and similar to three other individuals. (B) Quantitative phagocytic index for conditions presented in A demonstrates reduced Pneumocystis phagocytosis in the presence of cytocholasin B or gene silencing of mannose receptors by siRNA but not with I-{kappa}B inhibition (n=4). (C) Reduced AM IL-8 release in response to unopsonized Pneumocystis (Pc; ratio of 10:1 Pc:AM) in the presence of mannose receptor-blocking ligand mannosyl-bovine serum albumin (ManBSA; 500 ng/ml), functional gene silencing of mannose receptors (MR siRNA), or I-{kappa}B inhibition (Bay 11). (B and C) Values are mean ± SEM; *, P< 0.05, compared with unstimulated; **, P< 0.05, compared with Pneumocystis-stimulated.

Functional gene silencing of human mannose receptor promotes TNF-{alpha} release in response to unopsonized Pneumocystis organisms
Experiments next examined the specific role of macrophage mannose receptors in the cytokine release response to Pneumocystis, focusing on TNF-{alpha} release. Unstimulated, adherent human AM released low levels of TNF-{alpha}, whereas LPS stimulation increased TNF-{alpha} release (Fig. 5 ). As above, incubation with unopsonized Pneumocystis organisms did not significantly increase AM TNF-{alpha} release. Pretreatment of the adherent AM with a mannose receptor-blocking agent man-BSA resulted in the enhanced release of TNF-{alpha} in response to unopsonized Pneumocystis. man-BSA alone did not significantly enhance TNF-{alpha} release. Furthermore, after functional gene silencing of macrophage mannose receptors using a targeted siRNA technique, incubation with Pneumocystis organisms resulted in increased TNF-{alpha} release (Fig. 5) , whereas irrelevant siRNA did not influence AM TNF-{alpha} release (data not shown). These data demonstrate that functional block or specific gene silencing of macrophage mannose receptors promotes TNF-{alpha} release in response to unopsonized Pneumocystis organisms.



View larger version (9K):
[in this window]
[in a new window]
  		Figure 5. Blocking or functional gene silencing of human mannose receptor promotes TNF-{alpha} release in response to unopsonized Pneumocystis organisms. Human AM release of TNF-{alpha} in response to unopsonized Pneumocystis (Pc; ratio of 10:1 Pc:AM) or LPS (1 µg/ml) in the presence or absence of (A) mannose receptor-blocking ligand, man-BSA (MBSA; 500 ng/ml), or (B) functional gene silencing of mannose receptor (MR) siRNA. Values are mean ± SEM; *, P< 0.05, compared with unstimulated.

Pneumocystis organisms suppress AM TLR4-mediated TNF-{alpha} release
To determine the specificity of these observations, experiments next examined the influence of unopsonized Pneumocystis on mannose receptor-independent TNF-{alpha} release by AM. Experiments focused on macrophage TLR4-mediated release of TNF-{alpha}. Unstimulated, adherent human AM released low levels of TNF-{alpha} (Fig. 6 ), and (as above) incubation with Pneumocystis organisms did not significantly increase AM TNF-{alpha} release (Fig. 6A) . In contrast, activation of the TLR4 by lipid A (specific ligand for TLR4) resulted in increased TNF-{alpha} release (Fig. 6A) . However, pretreatment of the adherent human AM with unopsonized Pneumocystis organisms reduced lipid A-mediated TNF-{alpha} release, dependent on the multiplicity of infection (MOI) of Pneumocystis organisms (Fig. 6A) . Furthermore, after functional gene silencing of AM mannose receptors using siRNA, coincubation with Pneumocystis organisms did not suppress TNF-{alpha} release in response to lipid A (Fig. 6B) . These data suggest that ligation of AM mannose receptors by unopsonized Pneumocystis organisms activated pathway(s) that suppressed TLR4-mediated TNF-{alpha} release by AM.



View larger version (18K):
[in this window]
[in a new window]
  		Figure 6. Pneumocystis organisms suppress AM TLR4-mediated TNF-{alpha} release. (A) TNF-{alpha} release by human AM in response to the TLR4 ligand, lipid A (1 µg/ml), in the presence of absence of increasing ratios of unopsonized Pneumocystis (Pc; ratios expressed as Pc:AM), or (B) TNF-{alpha} release by human AM in response to the TLR4 ligand, lipid A (1 µg/ml), and/or unopsonized Pneumocystis (Pc; ratio of 10:1 Pc:AM) in the presence or absence of functional gene silencing of mannose receptor (MR) siRNA. For the siRNA experiments in B, conditions required incubation of all AM in serum-starved conditions (0.2%) for up to 60 h prior to performing the experiments. TNF-{alpha} levels were measured in cultured supernatants by ELISA. Values are mean ± SEM; *, P < 0.05 (compared with lipid A stimulated but no PC).


arrow
DISCUSSION
 
This study demonstrated that unopsonized Pneumocystis organisms were not sufficient to promote the release of IL-1ß, IL-6, or TNF-{alpha} and did not induce IL-1ß, IL-6, or TNF-{alpha} mRNA transcripts in human AM in vitro. The absence of TNF-{alpha}, IL-1ß, or IL-6 release was not attributed to Pneumocystis-mediated cytopathic changes or AM functional defects, as these same macrophages released IL-8 and MMP-9 in response to Pneumocystis and were capable of Pneumocystis phagocytosis. The observed response was specific, as IL-1ß, IL-6, and TNF-{alpha} release and mRNA induction increased in response to LPS. It is important that the absence of IL-1ß, IL-6, and TNF-{alpha} release in response to Pneumocystis was predominately influenced by AM mannose receptors, as blocking mannose receptors or targeted mannose receptor siRNA functional gene silencing promoted TNF-{alpha} release in response to unopsonized Pneumocystis organisms. Taken together, these findings suggest that human AM mannose receptors mediate phagocytosis of unopsonized Pneumocystis but provide a suppressive signal for the release of select proinflammatory cytokines such as TNF-{alpha}. The release of IL-1ß, IL-6, and TNF-{alpha} (important cytokines in the effective host response to Pneumocystis [22 23 24 ]) may require stimulation of other macrophage receptors (through opsonization of organisms) or may require costimulation by other immune cells and/or molecules.

The absence of AM TNF-{alpha} release in response to unopsonized Pneumocystis was consistent with observations by other investigators using nonhuman cells. In other in vitro studies, stimulation of rat or rabbit AM by unopsonized rat-derived Pneumocystis organisms induced no significant or only very low levels of TNF-{alpha} release compared with unstimulated macrophages [33 , 34 ], and significant macrophage TNF-{alpha} release was observed only following immune serum opsonization of Pneumocystis organisms [34 ] (similar to the current study) or following incubation of macrophages with the isolated Pneumocystis cell wall component, ß-glucan [33 ]. More recently, using a syngeneic Pneumocystis model, other investigators noted that unopsonized murine Pneumocystis organisms did not induce TNF-{alpha} release by murine AM [35 ]. Taken together with the current study, these data support the concept that in the absence of lymphocytes or other factors, unopsonized Pneumocystis organisms induce minimal or no TNF-{alpha} release by AM across many species (i.e., rat, mouse, rabbit, and human).

The absence of IL-1ß, IL-6, or TNF-{alpha} release by AM in response to Pneumocystis in the current study was also supported by observations in the animal model of Pneumocystis pneumonia [25 ]. In severe combined immunodeficiency (SCID) mice, low basal levels of lung mRNA for IL-1ß, IL-6, or TNF-{alpha} were not increased in response to Pneumocystis infection but increased only following immunological reconstitution of the Pneumocystis-infected animals with immunocompetent spleen cells (including CD4+ T lymphocytes) [25 ]. Furthermore, local expression for IL-1ß and TNF-{alpha} mRNA in the lungs of Pneumocytsis-infected SCID mice was observed specifically in regions of inflammation corresponding to focal Pneumocystis infection only following reconstitution [25 ] and involved activated AM in direct contact with Pneumocystis organisms [25 ]. These data suggest that AM release of certain proinflammatory cytokines in response to Pneumocystis required the presence of other immune cells such as CD4+ T lymphocytes, which in turn, activated or provided a necessary costimulatory signal to promote IL-1ß and TNF-{alpha} release.

The finding in the current study that mannose receptor ligation suppressed an inflammatory cytokine response was consistent with studies of other innate immune receptors. In contrast to TLRs, ligation of other receptors of innate immunity were often associated with anti-inflammatory responses [36 ]. These receptors include vitronectin receptors [37 ], dendritic cell-specific intercellular cell adhesion molecule-3-grabbing nonintegrin [38 ], CD47 [39 ], class A scavenger receptors (SR-A) [40 ] and macrophage receptor with collagenous structure (MARCO) [41 ], the class B scavenger receptor CD36 [42 ], and dectin-1 [43 ]. SR-A can neutralize E. coli and Neisseria meningitidis without inducing inflammatory responses [40 , 44 ], and genetic deletion of MARCO was associated with impaired Streptococcus pneumoniae clearance and increased lung inflammation [41 ]. In support of a relative suppressive influence of mannose receptors on the inflammatory response, recent studies demonstrated an increased influx of inflammatory cells (including macrophages and neutrophils) in the lungs of mannose receptor "knockout" animals with Pneumocystis pneumonia compared with wild-type animals [45 ] and recent findings that Pneumocystis impaired AM NF-{kappa}B activation at high MOI in vitro [21 ].

The specific mechanism for the inhibition of select cytokines following mannose receptor ligation was not established in the current study. The anti-inflammatory mechanisms for other non-TLR innate immune receptors may include innate receptor-mediated release of immunosuppressive cytokines such as IL-10 [38 ] and TGF-ß [37 ], activation of receptor-associated intracellular immunoreceptor tyrosine-based inhibitory motifs (ITIMs) [39 ], or inhibition of IL-12 release by G protein-coupled cyclic adenosine monophosphate [46 ]. Dectin-1 receptors can mediate phagocytosis but require coreceptor activation to produce TNF-{alpha} [43 ]. Mannose receptors do not contain an intracellular ITIM motif [47 ], and in the current study, mannose receptor ligation did not induce IL-10 or TGF-ß release. Mannose receptor ligation by Pneumocystis can impair NF-{kappa}B nuclear translocation [21 ] at MOI used in this study and may in part contribute to absent TNF-{alpha} mRNA induction and TNF-{alpha} release observed in the current study. Furthermore, mannose receptor ligation demonstrated specificity, as the release of the proinflammatory chemokine IL-8 may be regulated by a NF-{kappa}B-independent pathway. Defining additional transcription factors or signaling pathways influenced by mannose receptors remain areas of active investigation.

In the current study, the finding that mannose receptor ligation impaired TLR4-mediated TNF-{alpha} release suggested that mannose receptors can modify or regulate proinflammatory cytokine pathways induced by other receptors. Prior reports on the cell signaling responses to mannose receptor ligands are controversial, with reports of cellular responses as stimulatory [48 , 49 ] and inhibitory [50 , 51 ]. The current study supports the concept that mannose receptors negatively regulate the TLR4 signal transduction pathway, as suggested by other investigators [50 ]. The influence may reflect a direct interaction of mannose receptors with TLR4, TLR4 adaptor molecules, or the TLR4 signal transduction pathway. The concept of innate receptor collaboration in modulating inflammatory responses is supported by the observations for CD14 interaction with TLR4 [52 ] and dectin-1 receptor interaction with TLR2 [53 ]. Additional studies are required to further define the role of mannose receptor interaction with specific TLR and remain an active area of investigation.

The absence of TNF-{alpha} release by AM in response to Pneumocystis in the current study contrasts prior observations with human monocyte-derived macrophages [27 ]. Recognizing that human macrophages from different physiological compartments exhibit differential responses to stimuli [28 ], the observed differences in TNF-{alpha} release in the prior study may relate to differences in the sources of macrophages (monocyte-derived macrophages vs. AM) and in part, may reflect influences of lung-specific molecules such as surfactant protein components [54 ]. Furthermore, differences in TNF-{alpha} release may relate to differences in Pneumocystis preparations (filtered vs. cultured organisms) and differences in experimental conditions.

The relative lack of IL-1ß, IL-6, and TNF-{alpha} release by human AM in response to Pneumocystis was not attributed to nonsyngeneic factors (i.e., reflecting the response of human AM to rat-derived Pneumocystis organisms), as similar patterns of cytokine release were observed comparing rat and human AM in response to Pneumocystis. Furthermore, the similar patterns of cyokine and chemokine release by human and rat AM in response to Pneumocystis organisms in part validates the experimental model used in this study. In siRNA mannose receptor gene silencing experiments, release of TNF-{alpha} in response to Pneumocystis organisms may represent interaction of Pneumocystis with other macrophage receptors, such as vitronectin, fibronectin, dectin-1, or TLRs, although these other receptors were not specifically investigated in the current study. These in vitro observations may not reflect in vivo mechanisms, although available animal data support the concept that mannose receptors activate negative regulatory influences on proinflammatory responses [45 ].

In conclusion, these data demonstrated that in AM from healthy individuals, binding and phagocytosis of unopsonized Pneumocystis were not associated with IL-1ß, IL-6, and TNF-{alpha} protein release or mRNA induction. Pneumocystis-mediated induction of IL-1ß, IL-6, and TNF-{alpha} (important cytokines in the host response to Pneumocystis) in AM may require opsonization or coactivation by other immune cells. The significance of these findings may relate to the regulation of inflammation in the context of host defenses. In this regard, AM mannose receptors may represent a prototypic first-line host defense pattern recognition receptor, ideally suited to maintain lung sterility without provoking significant inflammation that would interfere with alveolar gas exchange. However, in the appropriate host, continued or prolonged exposure to Pneumocystis, in the presence of opsonins (such as specific immune globulins, appropriate levels of vitronectin, or fibronectin) or upon exposure or release of Pneumocystis ß-glucans (perhaps induced by organism killing), activates macrophage NF-{kappa}B [55 ] and stimulates TNF-{alpha}, which then contribute to the observed inflammatory response in the lungs [56 ] that characterizes Pneumocystis pneumonia [57 ]. Thus, human AM mannose receptors may serve to regulate the innate inflammatory responses to infectious challenge in the lungs.


arrow
ACKNOWLEDGEMENTS
 
This study was supported by National Institutes of Health Research Grants RO1 HL63655 (H. K.) and F32 HL71372 (J. Zhang). The authors gratefully acknowledge the participation of all persons who consented to bronchoscopy and the technical assistance of Robert Garland, Lorraine Gryniuk, and Renee Andwood. We acknowledge the generous gift of Martine Armstrong and Frank Richards who provided Pneumocystisi organisms for initial studies. None of the authors have conflict of interest disclosures regarding the work in this study.

Received December 2, 2004; revised January 18, 2005; accepted April 17, 2005.


arrow
REFERENCES
 
    1
  1. Yale, S. H., Limper, A. H. (1996) Pneumocystis carinii pneumonia in patients without acquired immunodeficiency syndrome: associated illnesses and prior corticosteroid therapy Mayo Clin. Proc. 71,5-13[Abstract]
    2. 2
  2. Mansharamani, N., Garland, R., Delaney, D., Koziel, H. (2000) Management and outcome patterns for adult Pneumocystis carinii pneumonia 1985–95: comparison of HIV-associated cases to other immunocompromised states Chest 118,704-711[Abstract/Free Full Text]
    3. 3
  3. Masur, H., Ognibene, F. P., Yarchoan, R., Shelhamer, J. H., Baird, B. F., Travis, W., Suffredini, A. F., Deyton, L., Kovacs, J. A., Falloon, J., Davey, R., Polis, M., Metcalf, J., Baseler, M., Wesley, R., Gill, V. J., Fauci, A. S., Lane, H. C. (1989) CD4 counts as predictors of opportunistic pneumonias in human immunodeficiency virus (HIV) infection Ann. Intern. Med. 111,223-231
    4. 4
  4. Phair, J., Munoz, A., Detels, R., Kaslow, R., Rinaldo, C., Saah, A. (1990) The risk of Pneumocystis carinii pneumonia among men infected with human immunodeficiency virus type 1. Multicenter AIDS Cohort Study Group N. Engl. J. Med. 322,161-165[Abstract]
    5. 5
  5. Mansharamani, N. G., Balachandran, D., Vernovsky, I., Garland, R., Koziel, H. (2000) Peripheral blood CD4+ T-lymphocyte counts during P. carinii pneumonia in immunocompromised patients without HIV infection Chest 118,712-720[Abstract/Free Full Text]
    6. 6
  6. Shellito, J., Suzara, V. V., Blumenfeld, W., Beck, J. M., Steger, H. J., Ermak, T. H. (1990) A new model of Pneumocystis carinii infection in mice selectively depleted of helper T lymphocytes J. Clin. Invest. 85,1686-1693
    7. 7
  7. Harmsen, A., Stankiewicz, M. (1990) Requirement for CD4+ cells in resistance to Pneumocystis carinii pneumonia in mice J. Exp. Med. 172,937-945[Abstract/Free Full Text]
    8. 8
  8. Harmsen, A. G., Stankiewicz, M. (1991) T cells are not sufficient for resistance to Pneumocystis carinii pneumonia in mice J. Protozool. 38,44S-45S
    9. 9
  9. Harmsen, A. G., Chen, W. (1992) Resolution of Pneumocystis carinii pneumonia in CD4+ lymphocyte-depleted mice given aerosols of heat-treated Escherichia coli J. Exp. Med. 176,881-886[Abstract/Free Full Text]
    10. 10
  10. Harmsen, A. G., Chen, W., Gigliotti, F. (1995) Active immunity to Pneumocystis carinii reinfection in T cell depleted mice Infect. Immun. 63,2391-2395[Abstract]
    11. 11
  11. Kolls, J. K., Habetz, S., Shean, M. K., Vazquez, C., Brown, J. A., Lei, D., Schwarzenberger, P., Ye, P., Nelson, S., Summer, W. R., Shellito, J. E. (1999) IFN-{gamma} and CD8+ T-cells restore host defense against Pneumocystis carinii in mice depleted of CD4+ T-cells J. Immunol. 162,2890-2894[Abstract/Free Full Text]
    12. 12
  12. Barton, E., Campbell, W. (1969) Pneumocystis carinii in lungs of rats treated with cortisone acetate Am. J. Pathol. 54,209-236[Medline]
    13. 13
  13. von Behren, L. A., Pesanti, E. L. (1978) Uptake and degradation of Pneumocystis carinii by macrophages in vitro Am. Rev. Respir. Dis. 118,1051-1059[Medline]
    14. 14
  14. Masur, H., Jones, T. C. (1978) The interaction in vitro of Pneumocystis carinii with macrophages and L-cells J. Exp. Med. 147,157-170[Abstract/Free Full Text]
    15. 15
  15. Roths, J. B., Marshall, J. D., Allen, R. D., Carlson, G. A., Sidman, C. L. (1990) Spontaneous Pneumocystis carinii pneumonia in immunodeficient mutant SCID mice Am. J. Pathol. 136,1173-1186[Abstract]
    16. 16
  16. Limper, A. H., Hoyte, J. S., Standing, J. E. (1997) The role of alveolar macrophages in Pneumocystis cariniidegradation and clearance from the lung J. Clin. Invest. 99,2110-2117[Medline]
    17. 17
  17. Vassallo, R., Thomas, C. F., Jr, Vuk-Paklovic, Z., Limper, A. H. (1999) Alveolar macrophage interactions with Pneumocystis carinii J. Lab. Clin. Med. 133,535-540[CrossRef][Medline]
    18. 18
  18. Ezekowitz, R. A. B., Williams, D. J., Koziel, H., Armstong, M. Y. K., Warner, A., Richards, F. F., Rose, R. M. (1991) Uptake of Pneumocystis carinii mediated by the macrophage mannose receptor Nature 351,155-158[CrossRef][Medline]
    19. 19
  19. Koziel, H., Eichbaum, Q., Kruskal, B. A., Pinkston, P., Rogers, R. A., Armstrong, M. Y. K., Richards, F. F., Rose, R. M., Ezekowitz, R. A. B. (1998) Reduced binding and phagocytosis of Pneumocystis carinii by alveolar macrophages from persons infected with HIV-1 correlates with mannose receptor downregulation J. Clin. Invest. 102,1332-1344[Medline]
    20. 20
  20. Koziel, H., Li, X., Armstrong, M. Y. K., Richards, F. F., Rose, R. M. (2000) Alveolar macrophages from human immunodeficiency virus-infected persons demonstrate impaired oxidative burst response to Pneumocystis cariniiin vitro Am. J. Respir. Cell Mol. Biol. 23,452-459[Abstract/Free Full Text]
    21. 21
  21. Zhang, J., Zhu, J., Imrich, A., Cushion, M. T., Kinane, B. T., Koziel, H. (2004) Pneumocystis activates human alveolar macrophage NF-{kappa}B signaling through mannose receptors Infect. Immun. 72,3147-3160[Abstract/Free Full Text]
    22. 22
  22. Chen, W., Havell, E. A., Moldawer, L. L., McIntyre, K. W., Chizzonite, R. A., Harmsen, A. G. (1992) Interleukin 1: an important mediator of host resistance against Pneumocystis carinii J. Exp. Med. 176,713-718[Abstract/Free Full Text]
    23. 23
  23. Chen, W., Havell, E., Gigliotti, F., Harmsen, A. (1993) Interleukin-6 production in a murine model of Pneumocystis carinii pneumonia: relation to resistance and inflammatory response Infect. Immun. 61,97-102[Abstract/Free Full Text]
    24. 24
  24. Chen, W., Havell, E. A., Harmsen, A. G. (1992) Importance of endogenous tumor necrosis factor {alpha} and {gamma} interferon in host resistance against Pneumocystis carnii infection Infect. Immun. 60,1279-1284[Abstract/Free Full Text]
    25. 25
  25. Wright, T. W., Johnston, C. J., Harmsen, A. G., Finkelstein, J. N. (1997) Analysis of cytokine mRNA profiles in the lungs of Pneumocystis carinii-infected mice Am. J. Respir. Cell Mol. Biol. 17,491-500[Abstract/Free Full Text]
    26. 26
  26. Kolls, J., Beck, J., Nelson, S., Summer, W., Shellito, J. (1993) Alveolar macrophage release of tumor necrosis factor during murine Pneumocystis carinii pneumonia Am. J. Respir. Cell Mol. Biol. 8,370-376
    27. 27
  27. Kandil, O., Fishman, J. A., Koziel, H., Pinkston, P., Rose, R. M., Remold, H. G. (1994) Human immunodeficiency virus type 1 infection of human macrophages modulates the cytokine response to Pneumocystis carinii Infect. Immun. 62,644-650[Abstract/Free Full Text]
    28. 28
  28. Strieter, R. M., Remick, D. G., Lynch, J. P., Genord, M., Raiford, C., Spengler, R., Kunkel, S. L. (1989) Differential regulation of tumor necrosis factor-{alpha} in human alveolar macrophages and peripheral blood monocytes: a cellular and molecular analysis Am. J. Respir. Cell Mol. Biol. 1,57-63
    29. 29
  29. Stringer, J. R., Beard, C. B., Miller, R. F., Wakefield, A. E. (2002) A new name (Pneumocystis jiroveci) for Pneumocystis from humans Emerg. Infect. Dis. 8,891-896[Medline]
    30. 30
  30. Chen, F., Cushion, M. (1994) Use of an ATP bioluminescent assay to evaluate viability of Pneumocystis carinii from rats J. Clin. Microbiol. 32,2791-2800[Abstract/Free Full Text]
    31. 31
  31. Zhang, D., Zhang, G., Hayden, M. S., Greenblatt, M. B., Bussey, C., Flavell, R. A., Ghosh, S. (2004) A Toll-like receptor that prevents infection by uropathogenic bacteria Science 303,1522-1526[Abstract/Free Full Text]
    32. 32
  32. Pierce, J. W., Schoenleber, R., Jesmok, G., Best, J., Moore, S. A., Collins, T., Gerritsen, M. E. (1997) Novel inhibitors of cytokine-induced I{kappa}B{alpha} phosphorylation and endothelial cell adhesion molecule expression show anti-inflammatory effects in vivo J. Biol. Chem. 272,21096-21103[Abstract/Free Full Text]
    33. 33
  33. Hoffman, O. A., Standing, J. E., Limper, A. H. (1993) Pneumocystis carinii stimulates tumor necrosis factor-{alpha} release from alveolar macrophages through a ß-glucan-medicated mechanism J. Immunol. 150,3932-3940[Abstract]
    34. 34
  34. Neese, L. W., Standing, J. E., Olson, E. J., Castro, M., Limper, A. H. (1994) Vitronectin, fibronectin, and gp120 antibody enhance macrophage release of TNF-{alpha} in response to Pneumocystis carinii J. Immunol. 152,4549-4556[Abstract]
    35. 35
  35. Steele, C., Marrero, L., Swain, S., Harmsen, A. G., Zheng, M., Brown, G. D., Gordon, S., Shellito, J. E., Kolls, J. K. (2003) Alveolar macrophage-mediated killing of Pneumocystis carinii f. sp. muris involves molecular recognition by the dectin-1 ß-glucan receptor J. Exp. Med. 198,1677-1688[Abstract/Free Full Text]
    36. 36
  36. Fraser, I. P., Stuart, L., Ezekowitz, R. A. B. (2004) TLR-independent pattern recognition receptors and anti-inflammatory mechanisms J. Endotoxin Res. 10,120-124[CrossRef]
    37. 37
  37. Freire-de-Lima, C. G., Nascimento, D. O., Soares, M. B., Bozza, P. T., Castro-Faria-Neto, H. C., de Mello, F. G., DosReis, G. A., Lopes, M. F. (2000) Uptake of apoptotic cells drives the growth of a pathogenic trypanosome in macrophages Nature 403,199-203[CrossRef][Medline]
    38. 38
  38. Tailleux, L., Schwartz, O., Hermann, J. L., Pivert, E., Jackson, M., Amara, A., Legres, L., Dreher, D., Nicod, L. P., Gluckman, J. C., Lagrange, P. H., Gicquel, B., Neyrolles, O. (2003) DC-SIGN is the major Mycobacterium tuberculosis receptor on human dendritic cells J. Exp. Med. 197,121-127[Abstract/Free Full Text]
    39. 39
  39. Demeure, C. E. H., Tanaka, H., Mateo, V., Rubio, M., Delepesse, G., Sarfati, M. (2000) CD47 engagement inhibits cytokine production and maturation of human dendritic cells J. Immunol. 164,2193-2199[Abstract/Free Full Text]
    40. 40
  40. Peiser, L., Gough, P. J., Kodama, T., Gordon, S. (2000) Macrophage class A scavenger receptor-mediated phagocytosis of Escherichia coli: role of cell heterogeneity, microbial strain and culure conditions in vitro Infect. Immun. 68,1953-1963[Abstract/Free Full Text]
    41. 41
  41. Arredouani, M., Yang, Z., Ning, Y. Y., Qin, G., Soininen, R., Tryggvason, K., Kobzik, L. (2004) The scavenger receptor MARCO is required for lung defense against Pneumococcal pneumonia and inhaled particles J. Exp. Med. 200,267-272[Abstract/Free Full Text]
    42. 42
  42. Urban, B. C., Wilcox, N., Roberts, D. J. (2001) A role for CD36 in the regulation of dendritic cell function Proc. Natl. Acad. Sci. USA 98,8750-8755[Abstract/Free Full Text]
    43. 43
  43. Brown, G. D., Herre, J., Williams, D. L., Williment, J. A., Marshall, A. S. J., Gordon, S. (2003) Dectin-1 mediates the biological effects of ß-glucans J. Exp. Med. 197,1119-1124[Abstract/Free Full Text]
    44. 44
  44. Peiser, L., De Winther, M. P., Makepeace, K., Hollinshead, M., Coull, P., Plested, J., Kodama, T., Moxon, E. R., Gordon, S. (2002) The class A macrophage scavenger receptor is a major pattern recognition receptor for Neisseria meningitidis which is independent of lipopolysaccharide and not required for secretory responses Infect. Immun. 70,5346-5354[Abstract/Free Full Text]
    45. 45
  45. Swain, S. D., Lee, S. J., Nussenzweig, M. C., Harmsen, A. G. (2003) Absence of the macrophage mannose receptor in mice does not increase susceptibility to Pneumocystis carinii infection in vivo Infect. Immun. 71,6213-6221[Abstract/Free Full Text]
    46. 46
  46. Braun, M. C., Kelsall, B. L. (2001) Regulation of interleukin-12 production by G-protein coupled receptors Microbes Infect. 3,99-107[CrossRef][Medline]
    47. 47
  47. East, L., Isacke, C. M. (2002) The mannose receptor family Biochim. Biophys. Acta 1572,364-386[Medline]
    48. 48
  48. Yamamoto, Y., Klein, T. W., Friedman, H. (1997) Involvement of mannose receptor in cytokine interleukin-1 ß (IL-1ß), IL-6, and granulocyte-macrophage colony-stimulating factor responses, but not in chemokine macrophage inflammatory protein 1 ß (MIP-1ß), MIP-2, and KC responses, caused by attachment of Candida albicans to macrophages Infect. Immun. 65,1077-1082[Abstract]
    49. 49
  49. Shibata, Y., Metzger, W. J., Myrvik, Q. N. (1997) Chitin particle-induced cell-mediated immunity is inhibited by soluble mannan: mannose receptor mediated phagocytosis initiates IL-12 production J. Immunol. 159,2462-2467[Abstract/Free Full Text]
    50. 50
  50. Nigou, J., Zelle-Rieser, C., Gilleron, M., Thurnher, M., Puzo, G. (2001) Mannosylated lipoarabinomannans inhibit IL-12 production by human dendritic cells: evidence for a negative signal delivered through the mannose receptor J. Immunol. 166,7477-7485[Abstract/Free Full Text]
    51. 51
  51. Chieppa, M., Bianchi, G., Doni, A., Del Prete, A., Sironi, M., Laskarin, G., Monti, P., Piemonti, L., Biondi, A., Mantovani, A., Introna, M., Allavena, P. (2003) Cross-linking of the mannose receptor on monocyte-derived dendritic cells activates an anti-inflammatory immunosuppressive program J. Immunol. 171,4552-4560[Abstract/Free Full Text]
    52. 52
  52. Beutler, B. (2000) TLR4: central component of the sole mammalian LPS sensor Curr. Opin. Immunol. 12,20-26[CrossRef][Medline]
    53. 53
  53. Gantner, B. N., Simmons, R. M., Canavera, S. J., Akira, S., Underhill, D. M. (2003) Collaborative induction of inflammatory responses by dectin-1 and Toll-like receptor 2 J. Exp. Med. 197,1107-1117[Abstract/Free Full Text]
    54. 54
  54. Alcorn, J. F., Wright, J. R. (2004) Surfactant protein A inhibits alveolar macrophage cytokine production by CD14-independent pathway Am. J. Physiol. Lung Cell. Mol. Physiol. 286,L129-L136[Abstract/Free Full Text]
    55. 55
  55. Lebron, F., Vassallo, R., Puri, V., Llimper, A. H. (2003) Pneumocystis carinii cell wall ß-glucans initiate macrophage inflammatory responses through NF-{kappa}B activation J. Biol. Chem. 278,25001-25008[Abstract/Free Full Text]
    56. 56
  56. Wright, T. W., Gigliotti, F., Finkelstein, J. N., McBride, J. T., An, C. L., Harmsen, A. G. (1999) Immune-mediated inflammation directly impairs pulmonary function, contributing to the pathogenesis of Pneumocystis cariniipneumonia J. Clin. Invest. 104,1307-1317[Medline]
    57. 57
  57. Thomas, C. F., Limper, A. H. (2004) Pneumocystis pneumonia N. Engl. J. Med. 350,2487-2498[Free Full Text]



This article has been cited by other articles:


Home page
 J. Leukoc. Biol.Home page
N. R. Patel, K. Swan, X. Li, S. D. Tachado, and H. Koziel
Impaired M. tuberculosis-mediated apoptosis in alveolar macrophages from HIV+ persons: potential role of IL-10 and BCL-3
J. Leukoc. Biol., July 1, 2009; 86(1): 53 - 60.
[Abstract] [Full Text] [PDF]

Home page
 GlycobiologyHome page
S T. Hollmig, K. Ariizumi, and P. D Cruz Jr
Recognition of non-self-polysaccharides by C-type lectin receptors dectin-1 and dectin-2
Glycobiology, June 1, 2009; 19(6): 568 - 575.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
L. Y. A. Chai, B. J. Kullberg, A. G. Vonk, A. Warris, A. Cambi, J.-P. Latge, L. A. B. Joosten, J. W. M. van der Meer, and M. G. Netea
Modulation of Toll-Like Receptor 2 (TLR2) and TLR4 Responses by Aspergillus fumigatus
Infect. Immun., May 1, 2009; 77(5): 2184 - 2192.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
J. M. Kel, B. Slutter, J. W. Drijfhout, F. Koning, and L. Nagelkerken
Mannosylated self-peptide inhibits the development of experimental autoimmune encephalomyelitis via expansion of nonencephalitogenic T cells
J. Leukoc. Biol., July 1, 2008; 84(1): 182 - 190.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
B. M. Rotoli, V. Dall'Asta, A. Barilli, R. D'Ippolito, A. Tipa, D. Olivieri, G. C. Gazzola, and O. Bussolati
Alveolar Macrophages from Normal Subjects Lack the NOS-Related System y+ for Arginine Transport
Am. J. Respir. Cell Mol. Biol., July 1, 2007; 37(1): 105 - 112.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L.-Z. He, A. Crocker, J. Lee, J. Mendoza-Ramirez, X.-T. Wang, L. A. Vitale, T. O'Neill, C. Petromilli, H.-F. Zhang, J. Lopez, et al.
Antigenic Targeting of the Human Mannose Receptor Induces Tumor Immunity
J. Immunol., May 15, 2007; 178(10): 6259 - 6267.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
S. D. Tachado, J. Zhang, J. Zhu, N. Patel, M. Cushion, and H. Koziel
Pneumocystis-mediated IL-8 release by macrophages requires coexpression of mannose receptors and TLR2
J. Leukoc. Biol., January 1, 2007; 81(1): 205 - 211.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
G. S. Schulert and L.-A. H. Allen
Differential infection of mononuclear phagocytes by Francisella tularensis: role of the macrophage mannose receptor
J. Leukoc. Biol., September 1, 2006; 80(3): 563 - 571.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.1204699v1
78/3/665    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, J.
Right arrow Articles by Koziel, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, J.
Right arrow Articles by Koziel, H.