science pharmaceutical expo biotech jobs
Originally published online as doi:10.1189/jlb.1104627 on June 16, 2005

Published online before print June 16, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.1104627v1
78/3/647    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Coban, C.
Right arrow Articles by Kumar, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Coban, C.
Right arrow Articles by Kumar, N.
(Journal of Leukocyte Biology. 2005;78:647-655.)
© 2005 by Society for Leukocyte Biology

Effect of plasmid backbone modification by different human CpG motifs on the immunogenicity of DNA vaccine vectors

Cevayir Coban*,1, Ken J. Ishii{dagger},2, Mayda Gursel{dagger}, Dennis M. Klinman{dagger} and Nirbhay Kumar*,3

* Department of Molecular Microbiology and Immunology, Malaria Research Institute, Bloomberg School of Public Health, Johns Hopkins University, Baltimore, Maryland; and
{dagger} Division of Viral Products, Center for Biological Evaluation and Research, Food and Drug Administration, Bethesda, Maryland

3Correspondence: Department of Molecular Microbiology and Immunology, Johns Hopkins Malaria Research Institute, The Johns Hopkins University Bloomberg School of Public Health, 615 N. Wolfe Street, Baltimore, MD 21205. E-mail: nkumar{at}jhsph.edu


arrow
ABSTRACT
 
DNA vaccines, in general, have been found to be poorly immunogenic in nonhuman primates and humans as compared with mice. As the immunogenicity of DNA plasmids relies, to a large extent, on the presence of CpG motifs as built in adjuvants, we addressed the issue of poor immunogenicity by inserting recently identified CpG oligonucleotides (ODN) optimal for human (K-type or D-type CpG ODN) into the backbone of plasmid VR1020. We found that plasmid DNA containing K-type CpG motifs or D-type CpG motifs significantly enhanced the up-regulation of surface molecules and production of interleukin-6 from human peripheral blood mononuclear cells (PBMC) and stimulated monocytes to develop into functionally mature dendritic cells (DC) compared with unmodified plasmid. Monocyte maturation into DC was through plasmacytoid DC present in the culture. It is interesting that the K-type CpG motif-modified plasmid stimulated significant levels of interferon (IFN)-{gamma} and IFN-{alpha} from human PBMC. Immunization of mice with D-type CpG motif-modified plasmid, encoding Plasmodium falciparum surface protein 25, yielded enhanced antigen-specific antibodies. Taken together, these results suggest that insertion of immunomodulatory human CpG motifs into plasmid DNA can improve immunogenicity of DNA vaccines.

Key Words: Plasmodium falciparum • oligonucleotides • dendritic cells


arrow
INTRODUCTION
 
DNA vaccines have been shown to elicit humoral and cellular immune responses and thus offer an attractive strategy for large-scale vaccination. To date, DNA immunization has been widely investigated against several viral [1 , 2 ], bacterial [3 , 4 ], and parasitic [5 , 6 ] pathogens in various animal models. However, DNA vaccines in primates and humans are less immunogenic than in mice, particularly in their ability to induce humoral responses [7 8 9 10 11 ]. Some of the approaches used to increase the immunogenicity of DNA vaccines include adjuvants or different delivery systems, modifications in the plasmid backbone, or alteration in the codon bias [12 , 13 ]. Heterologous prime/boost immunization has also emerged as an alternate strategy to optimize immune responses induced by DNA vaccines [10 , 14 ]. It is generally believed that the immunogenicity of DNA plasmid largely relies on the presence of unmethylated CpG motifs in the backbone as a "built-in adjuvant" [15 , 16 ]. Immunization with DNA containing CpG motifs as well as synthetic CpG oligonucleotides (CpG ODN) activates the immune system thorough Toll-like receptor-9 (TLR9) [17 ] and stimulates B cells, natural killer (NK) cells, and professional antigen-presenting cells to produce cytokines, chemokines, and immunoglobulins (Igs) [18 ].

It has been observed that the immunomodulatory effects of CpG ODN are species-specific, differing with respect to the number of CpG and the flanking sequences. Although the optimal CpG motifs for the mouse were not active in human, recently, it was discovered that human peripheral blood mononuclear cells (PBMC) recognize and respond to two structurally distinct types of CpG ODN (K- and D-type, known as B- and A-type ODN, respectively) [19 , 20 ]. K-type ODN contain a phosphorothioate TCGT or TCGA motif that stimulates B cells and monocytes to proliferate and secrete IgM and interleukin (IL)-6. D-type ODN have a phosphodiester purine/pyrimidine/cytosine-guanine (CG)/purine/pyrimidine motif capped by a poly-G tail at the 3' end and stimulate monocytes to mature into functionally active dendritic cells (DC), plasmacytoid DC (pDC), to secrete interferon (IFN)-{alpha}, and indirectly, NK cells, to secrete IFN-{gamma}. Thus, we hypothesized that immunogenicity of plasmid DNA for humans and/or nonhuman primates might be modulated by the presence of human CpG motifs in the plasmid DNA backbone [15 , 16 ].

In the present study, we modified the backbone of plasmid VR1020 with the insertion of two types of human CpG motifs (K- or D-type CpG motifs) to optimize immunogenicity of plasmid DNA. Our data showed that plasmid DNA containing K-type CpG motifs or D-type CpG motifs significantly enhanced production of cytokines from human PBMC and stimulated monocytes to develop into mature DC. Our studies also showed a preferential effect of plasmid DNA on pDC. Moreover, immunization of mice with a D-type CpG motif-modified plasmid encoding a Plasmodium falciparum transmission blocking vaccine candidate significantly enhanced antigen-specific antibody response.


arrow
MATERIALS AND METHODS
 
Human CpG ODN and cloning strategy into DNA plasmid
Based on the core sequence of D-type (purine/pyrimidine/CG/purine/pyrimidine with poly-G tail) and K-type (TCGT or TCGA clusters) ODN, which stimulate human PBMC [19 ], single-stranded sense and antisense oligodeoxynucleotides were designed and synthesized (Biosynthesis Inc., Lewisville, TX). The D-type sense ODN sequence was 5'GGTGCATCGATGCAGCATCGAGGCAGGTGCATCGATACAGGGGGG3' [45 base pairs (bp)], and the K-type sense ODN sequence was 5'ATCGACTCTCGAGCGTTCTTCGTTCGTTCTC3' (31 bp). The immunostimulatory CpG motifs are underlined.

To obtain double-stranded DNA (dsDNA), equimolar amounts of sense and antisense ODN were incubated at 95°C for 10 min and allowed to cool at room temperature (RT) for 2 h. For cloning into plasmids (see Fig. 1 ), the vectors VR1020 (Vical Inc., San Diego, CA) and VR1020/Pfs25 (cloned as in refs. [10 , 21 ]) were transformed into DM1-competent cells (Invitrogen, Carlsbad, CA) to enable easier digestion of unmethylated DNA with StuI. After StuI digestion, double-stranded ODN were ligated overnight at 16°C and transformed into DH5{alpha}-competent Escherichia coli cells and positive colonies selected by polymerase chain reaction (PCR) analysis. For K ODN-inserted plasmid, sense and antisense single-stranded ODN were used as PCR primers to screen positive colonies. For D ODN-inserted plasmid primers, 5'GGTGCATCGATGCAGCATCG3' and 5'CCCCCCTGTATCGATGCACC3' were used for screening the colonies. After confirming DNA sequences of modified plasmids, endo-free plasmid purification kits (Qiagen, Valencia, CA) were used to purify plasmids. All samples were carefully checked for endotoxin levels by using limulus amoebocyte lysate assay (BioWhittaker, Inc., Walkersville, MD). Endotoxin levels were less than 0.1 EU/mg DNA. If endotoxin levels were higher, removal of endotoxin was achieved by the Triton-X114 method [10 ].



View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. Modification of plasmid (VR1020) with human CpG motifs. D-type and K-type of ODN sense and antisense single-stranded DNA were synthesized, annealed, and cloned into the StuI (nucleotide 3688) restriction site of the vector VR1020. The D-type sense ODN sequence was 5'GTGCATCGATGCAGCATCGAGGCAGGTGCATCGATACAGGGGGG3' (45 bp), and the K-type sense ODN sequence was 5'ATCGACTCTCGAGCGTTCTTCGTTCGTTCTC3' (31 bp). The CpG motifs are underlined. BGH, Bovine growth hormone.

Cells
Human PBMC and elutriated monocytes (>95% pure) were obtained from the National Institutes of Health (NIH) Department of Transfusion Medicine (Bethesda, MD). Human PBMC were isolated by density gradient centrifugation over Ficoll-Hypaque as described before [19 ] and cultured in RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum (FCS), 50 U/ml penicillin, 50 µg/ml streptomycin, 1.5 mM L-glutamine, 10 mM HEPES, 1 mM sodium pyruvate, and 0.5 mM 2-mercaptoethanol (2-ME) in a 5% CO2 in-air incubator. Human pDC were purified from elutriated monocytes using a blood DC antigen (BDCA)-2 cell isolation kit (Miltenyi Biotec, Auburn, CA). pDC had a purity >90% based on positive expression of BDCA-2, CD123 (IL-3R{alpha}), CD4, CD45RA, and lack of expression of CD14, CD1a, and CD11c (data not shown). pDC (5x105/ml) were cultured in complete RPMI-1640 medium supplemented with 10 ng/ml recombinant human IL-3 (PeproTech, Rocky Hill, NJ). Untransfected human embryonic kidney-293 (HEK293) cells or those stably transfected with human TLR9 [22 ] were maintained in Dulbecco’s modified Eagle’s medium (Invitrogen) supplemented with heat-inactivated FCS, penicillin/streptomycin, sodium pyruvate, HEPES buffer, L-glutamine, and 2-ME.

Antibodies
Antibodies against human IFN-{gamma} (Endogen, Woburn, MA), IFN-{alpha} (PBL-Biomedical Laboratory, New Brunswick, NJ), IL-6, and IFN-inducible protein 10 (IP-10; R&D Systems, Minneapolis, MN) were used for enzyme-linked immunosorbent assay (ELISA). Fluorescein isothicyanate-, phycoerythrin (PE)-, and/or CyChrome-labeled antibodies against human CD40, CD83, and CD86 and isotype-matched control antibodies were obtained from BD PharMingen (San Diego, CA) and used as recommended by the manufacturer.

Flow cytometry
Expression of cell-surface markers was measured by flow cytometry as described previously [23 ]. Briefly, cells were harvested and washed with phosphate-buffered saline (PBS) containing 3 mM EDTA and fixed in medium A (Caltag, Burlingame, CA) as recommended by the manufacturer. Cells were washed with PBS, stained with PE- or Cychrome-labeled antibodies for 45 min at RT in dark, then washed with PBS containing 0.1% bovine serum albumin (BSA) and 0.1% NaN3, and analyzed by FACSort (BD Biosciences, San Jose, CA). Cell-Quest software was used for data analysis.

Cytokine measurement in culture supernatants by ELISA
Supernatants of the cultured cells were analyzed immediately for cytokine production by using ELISA as described previously [19 ]. Briefly, 96-well Immulon 2 plates were coated with anti-human IL-6, IFN-{gamma}, IFN-{alpha}, or IP-10 in PBS (pH 7.2) for 4 h. The plates were blocked with 1% BSA-PBS and washed, and culture supernatants were added and incubated for 2 h at RT. The plates were then washed and treated with biotinylated anticytokine antibody (1 µg/ml) followed by phosphatase-streptavidin (BD PharMingen, San Diego, CA) for 1 h at RT. The plates were read using colorimeter at 405 nm after adding K-gold substrate (Neogen, Lexington, KY), and concentration of cytokine was determined by comparison with recombinant human cytokine standards included in the same experiment. The detection limit of the assays was 6 pg/ml for IFN-{gamma}, 20 pg/ml for IL-6, 10 pg/ml for IFN-{alpha} (1 Unit is approximately equal to 3–5 pg), and 5 pg/ml for IP-10. Stimulation index for IFN-{gamma} was calculated by the formula: (value for stimulated cells–background)/(value for unstimulated cells–background) [19 ].

Serum antibody ELISA
Briefly, 96-well Immulon plates were coated with recombinant Pfs25 at 2 µg/ml concentration in bicarbonate buffer (4 mM Na2CO3, 8 mM NaHCO3, pH 9.6) and incubated overnight at 4°C [21 , 24 ]. After blocking with 5% nonfat milk + 0.05% Tween 20-PBS, serum dilutions were made and incubated for 2 h. After extensive washes between incubations, plates were incubated with horseradish peroxidase-conjugated goat anti-mouse IgG (Kirkegaard and Perry Labs, Gaithersburg, MD) and IgG1 and IgG2a (Southern Biotechnology Assoc., Birmingham, AL) at 1:2000 dilutions. Plates were developed with 2,2'-azinobis(3-ethylbenzothiazoline 6-sulfonate) single reagent substrate (Kirkegaard and Perry Labs, Gaithersburg, MD), and absorbance was recorded at 405 nm. End-point titers were defined using an average optical density of preimmune serum + 2 SD as the cut-off value.

In vitro mammalian cell expression and Western blotting
Untransfected HEK293 cells or those stably transfected with human TLR9 were transiently transfected with 0.25, 0.5, and 1 µg DNA plasmids VR1020, KJ/VR1020, and DJ/VR1020, encoding Pfs25, using FuGENE transfection reagent (Roche Molecular Biochemicals, IN), according to the manufacturer’s instructions. Cells were harvested at 48 h post-transfection using lysis buffer (Sigma Chemical Co., St. Louis, MO). Whole cell lysates were heated at 95°C for 10 min and subjected to electrophoresis on 12% sodium dodecyl sulfate-polyacrylamide gel under nonreducing conditions and transferred to nitrocellulose membrane followed by probing with pooled mouse sera containing anti-Pfs25 antibody (at 1:5000 dilution). The bands were detected using LumiGLO detection system (Cell Signaling Technology, Beverly, MA). Immunodetection of extracellular signal-regulated kinase (ERK) using anti-ERK antibody (Promega, Madison, WI) was used as loading control.

Animals and immunizations
Six- to 8-week-old female Balb/c mice were purchased from Charles River Laboratories (Wilmington, MA) and housed at the Johns Hopkins University Bloomberg School of Public Health’s animal facility (Baltimore, MD). Animals were immunized intramuscularly in the tibialis anterior muscle with 25 µg VR1020, KJ/VR1020, and DJVR1020 encoding Pfs25 in 100 µl PBS. Four weeks later, all animals were boosted with the same dose regimen, and 4 weeks after the first boost, sera were collected and stored at –20°C until use. All groups contained 10–14 mice per group.

Statistical analysis
Statistically significant differences were analyzed by ANOVA one-way variance test. P< 0.05 was considered significant.


arrow
RESULTS
 
Plasmid modification by human CpG motifs
Plasmid VR1020, a commonly used DNA vaccine vector, has a cytomegalovirus (CMV) promoter and tissue plasminogen activator (TPA) signal sequence that allow better expression of the encoded products in mammalian cells and facilitate protein secretion, respectively. The analysis of nucleotide sequence of VR1020 showed that the CG dinucleotide is present at a frequency of one in 23 dinucleotides, and the plasmid VR1020 contains 11 mouse CpG motifs based on the 5'PuPuCpGPyPy3' sequence. It also contains two K-type CpG motifs in the cluster format of TCGT or TCGA and no D-type human CpG motif (ATCGAT or ACCGGT). To investigate the built-in adjuvant effect of human CpG motifs in the plasmid backbone, plasmid VR1020 was modified by insertion of K- or D-type CpG DNA (see Materials and Methods; Fig. 1 ) [19 , 23 ]. After modification, D-type ODN-modified plasmid (termed as DJ/VR1020) contained three extra CpG cores of D ODN (in the form of 45 bp dsDNA), and K-type ODN-modified plasmid (termed as KJ/VR1020) contained five extra K-type CpG motifs (in the form of 31 bp dsDNA).

Effects of modified plasmids on human PBMC
To investigate the effect of modified plasmids, we first used total human PBMC, which were incubated with various concentrations (10, 33, and 100 µg/ml) of unmodified (VR1020) and modified plasmids (KJ/VR1020 or DJ/VR1020) for 3 days, and the expression profiles of CD83, CD40, and human leukocyte antigen (HLA)-DR were analyzed by flow cytometry. Both modified plasmids (KJ/VR1020 or DJ/VR1020) enhanced the percentage of CD83-CD40 double-positive cells even at the lowest concentrations tested and reached a plateau at a higher concentration (Fig. 2a ). A dose of 10 µg/ml of the modified plasmids yielded similar numbers of CD83/CD40 double-positive cells observed with the highest dose (100 µg/ml) of the unmodified plasmid (*, P<0.05, 10 µg/ml KJ/VR1020 or DJ/VR1020 vs. 10 µg/ml VR1020). We also found a similar increase in the numbers of the CD83-HLA-DR double-positive cells after incubation with KJ/VR1020 or DJ/VR1020 (data not shown). Conversely, the two modified plasmids were comparable with each other with respect to the activation of human PBMC. These results suggest that the insertion of K- or D-type CpG ODN potentiated the immunostimulatory activity of the plasmid DNA.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Response of purified total human PBMC to modified plasmids. (a) Human PBMC were incubated with 10, 33, and 100 µg/ml plasmids VR1020, KJ/VR1020, and DJ/VR1020 for 3 days. Up-regulation of the surface molecules CD83 and CD40 was analyzed by flow cytometry. Data are given as the percentage of CD83+/CD40+ (double-positive) cells. Results are the mean ± SD of two donors. Statistical significance was determined by ANOVA test (*, P<0.05; 10 µg/ml VR1020 vs. 10 µg/ml KJ/VR1020 DJ/VR1020). (b) Human PBMC were incubated with 30 µg/ml plasmids VR1020, KJ/VR1020, and DJ/VR1020 for 3 days. Cytokines IFN-{gamma} and IL-6 in the culture supernatants were determined by ELISA. IFN-{gamma} results are expressed as stimulation indices (fold increase in cytokine secretion relative to unstimulated cells from the same donor). For IFN-{gamma}, the stimulation index 1 is equal to the levels of unstimulated cells (values varying from 6 to 86 pg/ml) of each donor. Results are mean ± SEM of nine donors. Statistical significance over the VR1020 plasmid group was determined by ANOVA test (*, P<0.05; **, P<0.001). (c) Human PBMC were incubated with 30 µg/ml plasmids VR1020, KJ/VR1020, and DJ/VR1020 for 3 days. IFN-{alpha} in the culture supernatants was determined by ELISA. Results are mean ± SEM of three donors. Statistical significance over media and VR1020 plasmid group was determined by ANOVA test (*, P<0.01).

Cytokine production was also analyzed in human PBMC stimulated with modified and unmodified plasmids (Fig. 2b) . In the preliminary experiments, we used different concentrations (10, 30, and 100 µg/ml) of plasmids to stimulate human PBMC and found optimal activation with 30 µg/ml concentration (data not shown). In subsequent studies, human PBMC were incubated with 30 µg/ml each plasmid for 3 days, and IFN-{gamma} and IL-6 levels were measured in the culture supernatants by ELISA. We found that both modified plasmids induced significantly higher levels of IL-6 secretion from human PBMC when compared with the unmodified parent plasmid (**, P<0.001). Conversely, IFN-{gamma} production was significantly enhanced only by KJ/VR1020 plasmid (*, P<0.05). Unmodified plasmid VR1020 did not induce IL-6, and the IFN-{gamma} level was only slightly affected.

We next investigated the ability of modified and unmodified plasmids to stimulate IFN-{alpha} secretion from human PBMC (Fig. 2c) , possibly reflecting the presence of pDC in the human PBMC. The secretion of IFN-{alpha} from pDC supports the differentiation of monocytes into DC [25 ]. Human PBMC were incubated with 30 µg/ml each plasmid for 3 days, and IFN-{alpha} was measured in the supernatants by ELISA. The IFN-{alpha} level was significantly enhanced only by KJ/VR1020 plasmid(*, P<0.01), although unmodified plasmid and DJ/VR1020 also induced lower levels of IFN-{alpha} from human PBMC.

Effects of modified plasmids on human monocytes
Elutriated monocytes mature into DC within 48 h by D ODN treatment, as characterized by increased surface expression of CD83 and CD86 and low levels of CD14 [25 ]. To investigate whether ODN-modified plasmids would have similar effects on human monocytes, elutriated monocytes were incubated with 30 µg/ml unmodified and modified plasmids for 48 h, and DC maturation was assessed by flow cytometry. As shown in Fig. 3 , the DC maturation (CD83/CD86 double-positive cells) in the presence of modified plasmids was much lower than that observed in previously published studies with free D ODN treatment. In these studies, we also noted that the up-regulation of CD83 (DC marker) on monocytes was remarkably higher after 48 h incubation with plasmids (KJ/VR1020, 40.32%; DJ/VR1020, 28.13%; VR1020, 14.58%, vs. 1.58% medium and 6.25% D ODN), suggesting that elutriated monocytes become mostly immature DC (expressed mostly CD83) when stimulated with DNA plasmids, and human CpG motifs inserted in the vector backbone further enhance the monocyte to differentiate into immature DC.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 3. Activation of monocytes by plasmids. Elutriated monocytes were incubated with 30 µg/ml plasmid VR1020, modified plasmids KJ/VR1020 and DJ/VR1020, and 3 µM CpG ODN (D35) and its control non-CpG ODN [25 ] for 48 h. Up-regulation of DC maturation markers (CD83/CD86-positive cells) was monitored by flow cytometry. Data shown are representative of three independent experiments.

Contribution of pDC to monocyte activation by plasmids
D ODN directly activate pDC to produce large amounts of chemokine IP-10 and cytokine IFN-{alpha}, which helps monocytes to differentiate into DC [25 , 26 ]. To identify primary target cell activation by plasmid DNA, we next analyzed the chemokine and cytokine production in the supernatants of elutriated monocytes, enriched or depleted in pDC population (Fig. 4 ). The enriched pDC cultures responded significantly to all plasmids and produced high levels of IP-10 (*, P<0.001, various plasmids vs. media). The extent of IP-10 production was generally comparable with each other except for a slight increase in the plasmid KJ/VR1020-stimulated group. The IP-10 production was abrogated when the pDC were depleted(**, P<0.001). We found similar results with IFN-{alpha} levels (data not shown). In addition, enriched pDC from the elutriated monocytes were monitored for the appearance of CD86hi CD123hi cells by flow cytometry and found that both modified plasmids resulted in higher numbers than unmodified plasmid (data not shown). Taken together, these data clearly show that similar to D-type ODN, plasmid DNA stimulates monocytes to differentiate into DC via pDC activation, possibly involving production of IFN-{alpha} and IP-10.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 4. Contribution of pDC to monocyte activation by plasmids. Elutriated monocytes were enriched or depleted of pDC (CD123hi CD45RA+) and then incubated with 30 µg/ml plasmids VR1020, KJ/VR1020, and DJ/VR1020 for 48 h. IP-10 was measured in the supernatants by ELISA. Results are mean ± SEM of three donors. Statistical significance over media and pDC-depleted groups were determined by ANOVA test(*, P<0.001).

In vitro and in vivo activity of modified plasmids encoding Pfs25
VR1020 encoding Pfs25, a P. falciparum transmission-blocking vaccine candidate, when administered intramuscularly (i.m.), has been shown to elicit high titers of antibodies in mice [21 ], although the same plasmid construct was only poorly immunogenic in nonhuman primates [10 ]. Thus, our long-term goal is to improve DNA vaccine to elicit better antibody responses against Pfs25 in nonhuman primates and eventually in humans. To analyze whether the expression level of Pfs25 was affected by the modification of the plasmid backbone, we first investigated the in vitro expression of Pfs25 in mammalian cells (HEK293 cells) transfected with K and D ODN-modified plasmids encoding Pfs25. Western blotting results showed that Pfs25 protein expression was not affected by the modification of plasmids (data not shown). CpG motifs in bacterial DNA are recognized by TLR9 [17 , 27 ]. To investigate whether the presence of TLR9 would affect the protein expression, possibly as a result of TLR9-mediated cellular activation, we also tested HEK293 cells stably transfected with human TLR9 [22 ] to monitor Pfs25 protein expression. As shown in Fig. 5a , Pfs25 expression levels were comparable in all groups, except for slightly higher expression with the DJ/VR1020-Pfs25 plasmid at a higher concentration used for transfection.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 5. In vitro and in vivo activity of antigen expressing (encoding P. falciparum surface antigen Pfs25) modified plasmids. (a) HEK293 cells stably transfected with human TLR9 (hTLR9) were transiently transfected with indicated amounts of plasmids. Western blot analysis was carried out to detect the protein levels by using polyclonal mouse sera against Pfs25 under nonreducing conditions. Immunodetection of ERK using anti-ERK antibodies was used as a loading control to normalize the expression of Pfs25. (b) Balb/c mice (10–14/group) were immunized i.m. with 25 µg various plasmids, VR1020-Pfs25, KJ/VR1020-Pfs25, and DJ/VR1020-Pfs25. Mice were boosted 4 weeks later with the same dose of plasmid and serum Pfs25-specific IgG responses determined by ELISA. The line shows the mean of each group. (c) Anti-Pfs25-specific IgG1 and IgG2a responses were measured by ELISA 4 weeks after the booster dose. Results are expressed as the reciprocal serum dilution of individual mouse sera. Statistical significance (*, P<0.05; DJ/VR1020 vs. VR1020) was determined by ANOVA one-way variance test. For isotypes, results for each group represent the mean ± SEM.

Next, we sought to investigate the in vivo effect of modified plasmids on the immunogenicity of the Pfs25 protein. Although the CpG motifs optimal for mice are not active in human, previous results have suggested that human CpG motifs are, however, active in mouse [28 ]. Six- to 8-week-old female Balb/c mice (10–14 per group) were immunized with 25 µg VR1020-Pfs25, KJ/VR1020-Pfs25, and DJ/VR1020-Pfs25 followed by a booster immunization at a 4-week interval. Four weeks after the second immunization, anti-Pfs25 antibody responses were measured by ELISA. The DJ/VR1020-Pfs25-immunized group showed a significant increase in Pfs25-specific IgG titers when compared with the control or KJ/VR1020-Pfs25 group (Fig. 5b ; *, P<0.05). The antibody responses for KJ/VR1020-Pfs25 and VR1020-Pfs25 groups were comparable. Pfs25, as a recombinant DNA vaccine, has been shown to induce IgG1 and IgG2a antibody isotypes in mice [21 ]. When analyzed for antibody isotypes, CpG-modified plasmids encoding Pfs25 did not have any drastic effect on the isotypes of antibodies (Fig. 5c) except that the DJ/VR1020-Pfs25-immunized mice revealed approximately threefold higher Pfs25-specific IgG2a (P<0.05; DJ/VR1020 vs. VR1020). Taken together, these results imply that modification of plasmid backbone by the D-type CpG motif might enhance the antigen-specific total IgG responses, and similar modifications could be even desirable if T helper cell type 1 immune responses and IgG2a isotype-switch are expected as outcomes for any given DNA vaccination.


arrow
DISCUSSION
 
DNA vaccines in nonhuman primates and humans are not as immunogenic as in mice and need to be optimized for human use. Several animal studies have shown that the immunogenicity of the plasmid DNA is dependent on the adjuvanticity of unmethylated CpG motifs found in the plasmid backbone [15 , 16 , 29 30 31 ]. However, recent studies have revealed sequence differences in the CpG motifs active in different species [28 , 32 ]. Optimal CpG motifs for mice do not stimulate human PBMC, whereas CpG motifs optimized for human are immunostimulatory for human and mice. In addition, two different types of CpG ODNs (D- and K-type CpG ODN) have been identified, which stimulate human PBMC differentially [19 ]. These observations led us to hypothesize that poor immunogenicity of the DNA vaccine in humans may be attributed to lower immunostimulatory activity of the plasmid for human immune cells. Thus, in the present study, we modified DNA plasmid backbone with these two distinct types of human-specific CpG motifs and investigated their effects on various types of human immune cells, aiming to improve the immunogenicity of the DNA vaccine for human use against malaria.

Our results showed that unmodified plasmid (VR1020) induced a low level of cytokines (trace amount of IL-6 and moderate levels of IFN-{gamma} and IFN-{alpha}) in total human PBMC. Conversely, both modified plasmids, KJ/VR1020 or DJ/VR1020, induced significantly higher levels of IL-6 (Fig. 2b) . In addition, up-regulation of surface molecules CD83 and CD40 by both modified plasmids was achieved with a 10 times lower dose than that of unmodified plasmid (Fig. 2a) . Conversely, we found distinct activation of IFN-{gamma} and IFN-{alpha} by the two modified plasmids. KJ/VR1020 but not DJ/VR1020 induced significantly higher levels of IFN-{gamma} and IFN-{alpha} by PBMC (Fig. 2b) [19 ]. Taken together, these observations revealed that two distinct human CpG motifs did enhance immunostimulatory activity of plasmid DNA when inserted into plasmid backbone. Moreover, there were significant differences between direct effects of free ODN and ODN-modified plasmids, particularly for the induction of IFN-{gamma} and IFN-{alpha}. Unlike K ODN, plasmid KJ/VR1020 was a strong inducer of IFN-{gamma} and IFN-{alpha}, and unlike D ODN, DJ/VR1020 plasmid did not induce IFN-{gamma} and IFN-{alpha}. The reasons for these differences are not known. It may be recalled that CpG, as ODNs, are single-stranded molecules, possibly making secondary structure, and the same CpG motifs in the plasmid DNA are present as a double-stranded helix. Clearly, additional studies are needed to investigate such immunomodulatory differences between free CpG ODN and ODN-modified plasmids. An additional effect may be a result of effective concentration of CpG motifs presented to the cells being targeted.

In the current study, we found that plasmid DNA induced the maturation of human monocytes into DC via activation of pDC, present in the culture. This was further supported by the result that plasmid-induced IP-10 and IFN-{alpha} production by elutriated monocytes were abrogated by pDC depletion (Fig. 4 and data not shown). Moreover, our findings showed that both modified plasmids resulted in differential DC maturation as compared with unmodified plasmid, as revealed by an increase in the numbers of CD83-positive cells (Fig. 3) . Collectively, these findings suggest that differential activation of human PBMC and monocytes by human CpG-modified plasmids is via pDC and possibly through TLR9 recognition, although further studies are needed to confirm it. Recently, Spies et al. [27 ] reported that similar to CpG DNA, plasmid DNA also activates murine DC subsets (myeloid and pDC) through TLR9, as confirmed by using TLR9-deficient cells. In mice, myeloid and pDC express TLR9, whereas in human, only pDC express TLR9 [26 ]. This difference in TLR9 expression might be contributing to the poor efficacy of DNA vaccines in humans. Our finding that human CpG-modified plasmids activated pDC as well as monocytes better than unmodified plasmid provides rationale for further evaluation of modified plasmids as DNA vaccine vectors.

Another important question deserving further investigation pertains to the number of CpG motifs inserted for optimum immunogenicity of plasmid DNA. Several studies have been conducted in mouse and bovine models to increase the immunogenicity of DNA plasmid by introducing CpG motifs into plasmid backbone [29 30 31 ]. In these studies, numbers of CpG motifs incorporated were up to 90. Our results suggest that as few as only three to five human CpG motifs are sufficient to augment the immunogenicity of plasmid DNA. As such, the VR1020 plasmid contains only two human K-type CpG motifs and 11 mouse CpG motifs, which may attribute to lower immunostimulatory activity of VR1020 in human PBMC. It is more striking that the VR1020 does not have any D-type CpG motif. Insertion of five additional K-type CpG or three extra D-type CpG into the plasmid may have had a greater impact on the immunostimulatory activity of the plasmid. The other possibility is that the site of insertion of CpG motifs may also have an effect on the immunogenicity of plasmid DNA. In our studies, we inserted K or D CpG motifs in the StuI restriction enzyme site, downstream of the kanamycin-resistance gene (Fig. 1) , which is similar to the site containing critical CpG motifs for immunogenicity of DNA vaccine in mice [15 ]. Although additional studies are required, our data suggest that insertion of as few as five K-type or three D-type CpG motifs significantly enhanced the immunostimulatory activity of plasmid DNA for human immune cells.

Our laboratory has long focused on improving the immunogenicity of DNA vaccines for the induction of high titer antibodies against the P. falciparum transmission-blocking vaccine antigen (Pfs25). We have previously reported on highly effective immunogenicity of DNA vaccines in mice [21 ]. However, the same vaccine construct was only modestly immunogenic when tested in nonhuman primates [10 ]. The current studies were designed to make an attempt to optimize the poor immunogenicity of the DNA vaccine in higher mammals by humanizing the immunostimulatory CpG motifs in the plasmid backbone. Although plasmid DNA may act via TLR9, the expression of an antigen encoded by the plasmid was not affected by additional immunostimulatory CpG motifs introduced in the plasmid backbone. Recent observations [33 ] using TLR9–/– and TLR9+/+ mice have also suggested that immunogenicity of DNA vaccines may not be entirely dependent on recognition of TLR9, and thus, other mechanisms might need to be taken into consideration for improving their immunogenicity. Our results showed no difference in the expression levels of encoded protein (Pfs25) between the modified and unmodified plasmids. This was the case even in the presence or absence of TLR9, which is the receptor for DNA-containing CpG motifs (Fig. 5a and data not shown). Finally, the immunogenicity of modified plasmids encoding Pfs25 was evaluated in vivo in mice, based on the observations that human CpG motifs are active in mice [28 ]. We found that the DJ/VR1020-Pfs25 plasmid induced higher levels of Pfs25-specific IgG with subtle differences in the isotypes of antibodies elicited. However, the results from the mice experiments do not exclude the possibility that these plasmids could behave differently in nonhuman primates and humans, and thus, further studies in larger mammals are needed to clarify this critical issue.

Results presented in this report demonstrate that introducing two distinct human CpG motifs into the plasmid DNA improves immunostimulatory effects of plasmid DNA on human immune cells. Our results also point out different outcomes for CpG motifs when present in the context of plasmid backbone as compared with ODN as such. Thus, any attempts to modulate immunogenicity of DNA vaccines must assess modified plasmids directly rather that relying on the effects of CpG ODN. Taken together, our work provides support for undertaking more studies to improve the immunogenicity of DNA vaccines by modification of the plasmid backbone in nonhuman primates and humans.


arrow
ACKNOWLEDGEMENTS
 
These studies were supported by research grants from NIH, AI47089 (N. K.). Pfs25 was a kind gift from the Malaria Vaccine Development Unit, National Institute of Allergy and Infectious Diseases, National Institutes of Health. C. C. and K. J. I. contributed equally to this work. We thank Jackie Conover for excellent technical assistance and Drs. Takeshita, Sugiyama, Kongkasuriyachai, Bhattacharyya, and Okulate for discussions.


arrow
FOOTNOTES
 
1 Current address: The 21st Century COE, Combined Program on Microbiology and Immunology, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamada-oka, Suita, Osaka 565-0871, Japan. Back

2 Current address: Exploratory Research for Advanced Technology (ERATO), Japan Science and Technology Agency (JST), Osaka, Japan, and Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, Osaka, Japan Back

Received November 1, 2004; revised December 13, 2004; accepted May 18, 2005.


arrow
REFERENCES
 
    1
  1. Ulmer, J. B., Donnelly, J. J., Parker, S. E., Rhodes, G. H., Felgner, P. L., Dwarki, V. J., Gromkowski, S. H., Deck, R. R., DeWitt, C. M., Friedman, A., Hawe, L. A., Leander, K. R., Martinez, D., Perry, H. C., Shiver, J. W., Montgomery, D. L., Liu, M. A. (1993) Heterologous protection against influenza by injection of DNA encoding a viral protein Science 259,1745-1749[Abstract/Free Full Text]
  2. 2
  3. Xiang, Z. Q., Spitalnik, S., Tran, M., Wunner, W. H., Cheng, J., Ertl, H. C. (1994) Vaccination with a plasmid vector carrying the rabies virus glycoprotein gene induces protective immunity against rabies virus Virology 199,132-140[CrossRef][Medline]
  4. 3
  5. Tascon, R. E., Colston, M. J., Ragno, S., Stavropoulos, E., Gregory, D., Lowrie, D. B. (1996) Vaccination against tuberculosis by DNA injection Nat. Med. 2,888-892[CrossRef][Medline]
  6. 4
  7. Luke, C. J., Carner, K., Liang, X., Barbour, A. G. (1997) An OspA-based DNA vaccine protects mice against infection with Borrelia burgdorferi J. Infect. Dis. 175,91-97[Medline]
  8. 5
  9. Gurunathan, S., Sacks, D. L., Brown, D. R., Reiner, S. L., Charest, H., Glaichenhaus, N., Seder, R. A. (1997) Vaccination with DNA encoding the immunodominant LACK parasite antigen confers protective immunity to mice infected with Leishmania major J. Exp. Med. 186,1137-1147[Abstract/Free Full Text]
  10. 6
  11. Sedegah, M., Hedstrom, R., Hobart, P., Hoffman, S. L. (1994) Protection against malaria by immunization with plasmid DNA encoding circumsporozoite protein Proc. Natl. Acad. Sci. USA 91,9866-9870[Abstract/Free Full Text]
  12. 7
  13. Wang, R., Doolan, D. L., Le, T. P., Hedstrom, R. C., Coonan, K. M., Charoenvit, Y., Jones, T. R., Hobart, P., Margalith, M., Ng, J., Weiss, W. R., Sedegah, M., de Taisne, C., Norman, J. A., Hoffman, S. L. (1998) Induction of antigen-specific cytotoxic T lymphocytes in humans by a malaria DNA vaccine Science 282,476-480[Abstract/Free Full Text]
  14. 8
  15. Calarota, S., Bratt, G., Nordlund, S., Hinkula, J., Leandersson, A. C., Sandstrom, E., Wahren, B. (1998) Cellular cytotoxic response induced by DNA vaccination in HIV-1-infected patients Lancet 351,1320-1325[CrossRef][Medline]
  16. 9
  17. Klinman, D. M., Ishii, K. J., Verthelyi, D. (2000) CpG DNA augments the immunogenicity of plasmid DNA vaccines Curr. Top. Microbiol. Immunol. 247,131-142[Medline]
  18. 10
  19. Coban, C., Philipp, M. T., Purcell, J. E., Keister, D. B., Okulate, M., Martin, D. S., Kumar, N. (2004) Induction of Plasmodium falciparum transmission-blocking antibodies in nonhuman primates by a combination of DNA and protein immunizations Infect. Immun. 72,253-259[Abstract/Free Full Text]
  20. 11
  21. Epstein, J. E., Gorak, E. J., Charoenvit, Y., Wang, R., Freydberg, N., Osinowo, O., Richie, T. L., Stoltz, E. L., Trespalacios, F., Nerges, J., Ng, J., Fallarme-Majam, V., Abot, E., Goh, L., Parker, S., Kumar, S., Hedstrom, R. C., Norman, J., Stout, R., Hoffman, S. L. (2002) Safety, tolerability, and lack of antibody responses after administration of a PfCSP DNA malaria vaccine via needle or needle-free jet injection, and comparison of intramuscular and combination intramuscular/intradermal routes Hum. Gene Ther. 13,1551-1560[CrossRef][Medline]
  22. 12
  23. O’Hagan, D. T., Valiante, N. M. (2003) Recent advances in the discovery and delivery of vaccine adjuvants Nat. Rev. Drug Discov. 2,727-735[CrossRef][Medline]
  24. 13
  25. Leitner, W. W., Ying, H., Restifo, N. P. (1999) DNA and RNA-based vaccines: principles, progress and prospects Vaccine 18,765-777[CrossRef][Medline]
  26. 14
  27. Moore, A. C., Hill, A. V. (2004) Progress in DNA-based heterologous prime-boost immunization strategies for malaria Immunol. Rev. 199,126-143[CrossRef][Medline]
  28. 15
  29. Sato, Y., Roman, M., Tighe, H., Lee, D., Corr, M., Nguyen, M. D., Silverman, G. J., Lotz, M., Carson, D. A., Raz, E. (1996) Immunostimulatory DNA sequences necessary for effective intradermal gene immunization Science 273,352-354[Abstract]
  30. 16
  31. Klinman, D. M., Yamshchikov, G., Ishigatsubo, Y. (1997) Contribution of CpG motifs to the immunogenicity of DNA vaccines J. Immunol. 158,3635-3639[Abstract]
  32. 17
  33. Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M., Hoshino, K., Wagner, H., Takeda, K., Akira, S. (2000) A Toll-like receptor recognizes bacterial DNA Nature 408,740-745[CrossRef][Medline]
  34. 18
  35. Gursel, M., Verthelyi, D., Gursel, I., Ishii, K. J., Klinman, D. M. (2002) Differential and competitive activation of human immune cells by distinct classes of CpG oligodeoxynucleotide J. Leukoc. Biol. 71,813-820[Abstract/Free Full Text]
  36. 19
  37. Verthelyi, D., Ishii, K. J., Gursel, M., Takeshita, F., Klinman, D. M. (2001) Human peripheral blood cells differentially recognize and respond to two distinct CpG motifs J. Immunol. 166,2372-2377[Abstract/Free Full Text]
  38. 20
  39. Krug, A., Rothenfusser, S., Hornung, V., Jahrsdorfer, B., Blackwell, S., Ballas, Z. K., Endres, S., Krieg, A. M., Hartmann, G. (2001) Identification of CpG oligonucleotide sequences with high induction of IFN-{alpha}/ß in plasmacytoid dendritic cells Eur. J. Immunol. 31,2154-2163[CrossRef][Medline]
  40. 21
  41. Lobo, C. A., Dhar, R., Kumar, N. (1999) Immunization of mice with DNA-based Pfs25 elicits potent malaria transmission-blocking antibodies Infect. Immun. 67,1688-1693[Abstract/Free Full Text]
  42. 22
  43. Ishii, K. J., Takeshita, F., Gursel, I., Gursel, M., Conover, J., Nussenzweig, A., Klinman, D. M. (2002) Potential role of phosphatidylinositol 3 kinase, rather than DNA-dependent protein kinase, in CpG DNA-induced immune activation J. Exp. Med. 196,269-274[Abstract/Free Full Text]
  44. 23
  45. Ishii, K. J., Suzuki, K., Coban, C., Takeshita, F., Itoh, Y., Matoba, H., Kohn, L. D., Klinman, D. M. (2001) Genomic DNA released by dying cells induces the maturation of APCs J. Immunol. 167,2602-2607[Abstract/Free Full Text]
  46. 24
  47. Coban, C., Ishii, K. J., Stowers, A. W., Keister, D. B., Klinman, D. M., Kumar, N. (2004) Effect of CpG oligodeoxynucleotides on the immunogenicity of Pfs25, a Plasmodium falciparum transmission-blocking vaccine antigen Infect. Immun. 72,584-588[Abstract/Free Full Text]
  48. 25
  49. Gursel, M., Verthelyi, D., Klinman, D. M. (2002) CpG oligodeoxynucleotides induce human monocytes to mature into functional dendritic cells Eur. J. Immunol. 32,2617-2622[CrossRef][Medline]
  50. 26
  51. Krug, A., Towarowski, A., Britsch, S., Rothenfusser, S., Hornung, V., Bals, R., Giese, T., Engelmann, H., Endres, S., Krieg, A. M., Hartmann, G. (2001) Toll-like receptor expression reveals CpG DNA as a unique microbial stimulus for plasmacytoid dendritic cells which synergizes with CD40 ligand to induce high amounts of IL-12 Eur. J. Immunol. 31,3026-3037[CrossRef][Medline]
  52. 27
  53. Spies, B., Hochrein, H., Vabulas, M., Huster, K., Busch, D. H., Schmitz, F., Heit, A., Wagner, H. (2003) Vaccination with plasmid DNA activates dendritic cells via Toll-like receptor 9 (TLR9) but functions in TLR9-deficient mice J. Immunol. 171,5908-5912[Abstract/Free Full Text]
  54. 28
  55. Ishii, K. J., Gursel, I., Gursel, M., Klinman, D. M. (2004) Immunotherapeutic utility of stimulatory and suppressive oligodeoxynucleotides Curr. Opin. Mol. Ther. 6,166-174[Medline]
  56. 29
  57. Shoda, L. K., Kegerreis, K. A., Suarez, C. E., Mwangi, W., Knowles, D. P., Brown, W. C. (2001) Immunostimulatory CpG-modified plasmid DNA enhances IL-12, TNF-{alpha}, and NO production by bovine macrophages J. Leukoc. Biol. 70,103-112[Abstract/Free Full Text]
  58. 30
  59. Weeratna, R. D., McCluskie, M. J., Comanita, L., Wu, T., Davis, H. L. (2000) Optimization strategies for DNA vaccines Intervirology 43,218-226[CrossRef][Medline]
  60. 31
  61. Pontarollo, R. A., Babiuk, L. A., Hecker, R., Van Drunen Littel-Van Den Hurk, S. (2002) Augmentation of cellular immune responses to bovine herpesvirus-1 glycoprotein D by vaccination with CpG-enhanced plasmid vectors J. Gen. Virol. 83,2973-2981[Abstract/Free Full Text]
  62. 32
  63. Takeshita, F., Leifer, C. A., Gursel, I., Ishii, K. J., Takeshita, S., Gursel, M., Klinman, D. M. (2001) Cutting edge: role of Toll-like receptor 9 in CpG DNA-induced activation of human cells J. Immunol. 167,3555-3558[Abstract/Free Full Text]
  64. 33
  65. Babiuk, S., Mookherjee, N., Pontarollo, R., Griebel, P., van Drunen Littel-van den Hurk, S., Hecker, R., Babiuk, L. (2004) TLR9–/– and TLR9+/+ mice display similar immune responses to a DNA vaccine Immunology 113,114-120[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.1104627v1
78/3/647    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Coban, C.
Right arrow Articles by Kumar, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Coban, C.
Right arrow Articles by Kumar, N.