Originally published online as doi:10.1189/jlb.1204698 on April 27, 2005
Published online before print April 27, 2005
(Journal of Leukocyte Biology. 2005;78:565-573.)
© 2005
by Society for Leukocyte Biology
Enhanced TLR4 reactivity following injury is mediated by increased p38 activation
Adrian A. Maung*,
,
Satoshi Fujimi*,
Marissa L. Miller*,
Malcolm P. MacConmara*,
John A. Mannick* and
James A. Lederer*,1
* Department of Surgery (Immunology), Brigham and Womens Hospital and Harvard Medical School, Boston, Massachusetts; and
Department of Surgery, Massachusetts General Hospital, Boston, Massachusetts
1 Correspondence: Brigham and Womens Hospital, Harvard Medical School, 75 Francis Street, Boston, MA 02115. E-mail: jlederer{at}rics.bwh.harvard.edu
 |
ABSTRACT
|
|---|
Severe injury primes the innate-immune system for increased Toll-like receptor 4 (TLR4)-induced proinflammatory cytokine production by macrophages. In this study, we examined changes in TLR4 signaling pathways in splenic macrophages from burn-injured or sham mice to determine the molecular mechanism(s) responsible for the increased TLR4 responsiveness. Using flow cytometry and specific antibodies, we first looked for injury-induced changes in the expression levels of several TLR-associated signaling molecules. We found similar levels of myeloid differentiation primary-response protein 88 (MyD88) and interleukin-1 receptor-associated kinase-M (IRAK-M) and somewhat lower levels of total p38, extracellular signal-regulated kinase (ERK), and stress-activated protein kinase (SAPK)/c-jun N-terminal kinase (JNK) mitogen-activated protein kinases (MAPKs) in burn compared with sham macrophages. However, with the use of antibodies specific for the phosphorylated (activated) forms of the three MAPKs, we found that macrophages from burn mice showed a twofold increase in purified lipopolysaccharide (LPS)-stimulated p38 activation as compared with cells from sham mice on days 1 and 7 post-injury, whereas ERK and SAPK/JNK activation was increased by burn injury only on day 1. Using the specific p38 inhibitor (SB203580), we confirmed that the increase in tumor necrosis factor
production by LPS-stimulated burn macrophages requires p38 activation. Although we demonstrated that injury increases macrophage TLR4 mRNA expression and intracellular expression of TLR4-myeloid differentiation protein-2 (MD-2) protein, macrophage cell-surface expression of TLR4-MD-2 was not changed by burn injury. Our results suggest that the injury-induced increase in TLR4 reactivity is mediated, at least in part, by enhanced activation of the p38 signaling pathway.
Key Words: monocytes macrophages inflammation signal transduction
 |
INTRODUCTION
|
|---|
Prior studies in humans and animals have shown that injured individuals produce higher levels of proinflammatory cytokines [interleukin (IL)-1, tumor necrosis factor
(TNF-
), IL-6] in response to Toll-like receptor (TLR) stimuli [1
2
3
4
]. The innate-immune system and specifically macrophages have been shown to be the major source of these cytokines [3
, 4
]. However, the molecular mechanism(s) that are involved in the enhanced TLR responsiveness by macrophages following injury are not well-defined.
TLRs are a family of IL-1 receptor (IL-1R)-related molecules that recognize conserved pathogen-associated molecules such as bacterial lipopolysaccharide (LPS), bacterial lipoprotein (BLP), CpG DNA, or viral double-stranded RNA to name a few. Each receptor recognizes a unique set of ligands such as LPS for TLR4 or BLP for TLR2. These receptors share a common [myeloid differentiation primary-response protein 88 (MyD88)-dependent] signaling pathway [5
, 6
]; however, TLR3 and TLR4 have also been shown to activate cells via a MyD88-independent signaling mechanism [6
, 7
].
Upon binding of the ligand to the TLR, MyD88 is recruited to the receptors cytoplasmic tail and mediates the phosphorylation of IL-1R-associated kinase (IRAK)-1 by IRAK-4. Phosphorylated IRAK-1 then associates with TNF receptor-associated factor 6 and through several intermediate steps, leads to the activation of the mitogen-activated protein kinase (MAPK) signaling molecules, which are signaling enzymes from three protein families: p38 MAPK, extracellular signal-regulated kinase (ERK), and c-jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK) [8
]. Following activation, MAPKs can initiate the synthesis and assembly of a number of transcription factors including nuclear factor-
B (NF-
B), activating transcription factor (ATF)-2, and activator protein-1 (AP-1). The existence of several recently described TLR signaling pathway inhibitors, IRAK-M and Toll-IL-1R-8/single immunoglobulin (Ig) IL-1R-related (Tir8/SIGIRR) molecule, indicates that this important innate-immune signaling pathway is under tight control [9
, 10
].
The aim of this study was to determine if changes in the well-defined MyD88-dependent TLR4 signaling pathway might be responsible for the enhanced TLR4 responsiveness by murine macrophages at 7 days post-injury described previously. Using flow cytometry and specific antibodies, we examined the TLR signaling cascade at several levels including changes in cell-surface and cytoplasmic TLR4 expression, expression of MyD88, and IRAK-M as well as expression and activation of p38, ERK, and SAPK/JNK in F4/80+ splenic macrophages. We show that burn injury primes splenic macrophages for augmented LPS-induced p38 activation, which persists for at least 7 days as opposed to ERK1/ERK2 or SAPK/JNK activation, suggesting that increased p38 signaling may be responsible for the augmented TLR4 reactivity of macrophages following burn injury.
 |
MATERIALS AND METHODS
|
|---|
Mice
Male C57BL/6J mice were obtained from the Jackson Laboratory (Bar Harbor, ME). Mice were maintained in an accredited virus and antibody-free animal facility, in accordance with the guidelines of National Institutes of Health (NIH; Bethesda, MD) and Harvard Medical School Standing Committee on Animal Research (Boston, MA). The mice were acclimated for at least 1 week before being used in experiments at 69 weeks of age.
Reagents
Culture medium for in vitro studies consisted of RMPI 1640 supplemented with 5% heat-inactivated fetal calf serum, 1 mM glutamine, penicillin/streptomycin/fungizone, 10 mM HEPES buffer, 100 µM nonessential amino acids, and 2.5 x 105 M 2-mercaptoethanol, all purchased from Gibco-Invitrogen Corp. (Grand Island, NY). LPS Escherichia coli 0111:B4 was obtained from Sigma-Aldrich Chemical Corp. (St. Louis, MO) and BLP, from Bachem (King of Prussia, PA), and unmethylated CpG DNA sequence 1826 was custom-prepared by Invitrogen (Carlsbad, CA). The LPS was repurified following the procedure described by Hirschfeld et al. [11
] to remove contaminating TLR2 reactivity. The LPS used in these studies was kindly confirmed to be a TLR4-restricted agonist by Dr. Evelyn Kurt-Jones of the University of Massachusetts (Amherst) using human embryonic kidney 2 cells transfected with TLR2 or TLR4 [11
, 12
].
Mouse injury model
The thermal injury protocol, approved by NIH and Harvard Medical School Standing Committee on Animal Research, was performed as described previously [13
]. Mice were anesthetized by intraperitoneal (i.p.) injection of ketamine (125 mg/kg) with xylazine (6.8 mg/kg). The dorsal fur was shaved, and the animal was placed in an insulated plastic mold to expose 25% total body surface area. This part of the dorsum was then immersed in 90°C water to induce a well-demarcated, full thickness, anesthetic burn injury. The exposed dorsum of sham animals was immersed in isothermic (24°C) water. All animals were resuscitated with an i.p. injection of 1 ml 0.9% pyrogen-free saline. The mortality from burn injury was less than 5%.
Preparation of spleen cell cultures
Mice were killed by CO2 asphyxiation. Spleens were harvested into serum-free RPMI-1640 medium and digested with Liberase CI enzyme (400 µg/ml final concentration; Roche Applied Science, Indianapolis, IN) for 10 min. Pilot experiments performed in our laboratory have demonstrated that Liberase CI increases the cell yield but does not significantly alter the expression of a number of cell-surface markers (CD4, CD8, CD19, F4/80, CD11c, TLR2, or TLR4). Cell suspensions were then prepared by mincing the tissues on wire mesh. Cells were treated with Tris-ammonium chloride solution for 3 min to lyse red blood cells and washed twice before suspension in culture medium in Costar round-bottom, 96-well plates at a concentration of 5 x 105 cells/well.
Measurement of total intracellular signaling molecules by fluorescein-activated cell sorter (FACS) analysis
At 1 and 7 days after injury, total spleen-cell suspensions were prepared from sham and burn-injured mice. The cells were fixed with 1.5% paraformaldehyde (PAF) for 10 min at 37°C, permeabilized with ice-cold methanol (100%) for an additional 10 min, and washed with phosphate-buffered saline, supplemented with 1% bovine serum albumin and 0.1% sodium azide (PBA). Prior to antibody staining, samples were incubated with FcBlock (PharMingen, San Diego, CA) to prevent nonspecific binding. Fluorescein isothiocyanate (FITC)-labeled anti-F4/80 antibody (PharMingen) was added along with unlabeled, primary rabbit polyclonal antibodies specific for MyD88 (StressGen, San Diego, CA), IRAK-M (Chemicon International, Temecula, CA), p38, ERK, or SAPK/JNK (Cell Signaling, Beverly, MA). An isotype-matched rabbit IgG was used as a nonspecific staining control. Cells were then washed and stained with a goat anti-rabbit phycoerythrin (PE)-labeled secondary antibody. Cells were subsequently washed twice and resuspended in 0.3% PAF. Flow cytometry was performed using the FACSCalibur instrument (BD Biosciences, Mountain View, CA), and the results were analyzed using the accompanying CellQuest Pro software.
Detection of phosphorylated (activated) MAPK signaling molecules by FACS
To distinguish between the activated and nonactivated forms of MAPK signaling molecules, we used antibodies specific for the phosphorylated (active) forms of p38, ERK1/2, and SAPK/JNK (Cell Signaling). Spleen cells were harvested at 1 and 7 days after injury, as described above, and then rested for 2 h at 37°C in culture medium to allow cells to reach steady-state conditions. This was done, as our preliminary studies showed that cell harvesting could cause a transient activation of the MAPK signaling cascade, but following 2 h of culture, the levels of phosphorylated MAPKs would return to baseline.
The cells were then incubated with 200 ng/ml phorbol 12-myristate 13-acetate (PMA) or 0.1, 1, or 10 µg/ml LPS for dose-response experiments and 1 µg/ml LPS or culture medium for stimulation experiments. After 5-, 15-, 30-, or 60-min incubation periods, the cells were rapidly fixed with 1.5% PAF, permeabilized with methanol, and stained and analyzed as described above using antibodies specific for the phosphorylated MAPKs.
To confirm the specificity of the antiphospho-p38 antibody, we performed an additional staining study in the presence of blocking peptides. Fifteen minutes after stimulation with 200 ng/ml PMA, the cells were stained with antibody specific for phospho-p38, which was preincubated with an excess amount (10 µg) of phosphorylated p38 peptide or nonphosphorylated p38 peptide.
FACS analysis of cell-surface and intracellular TLR4-MD-2 expression
Cell-surface and intracytoplasmic TLR4-MD-2 levels were measured using flow cytometry. Spleen cells from sham and burn mice were isolated as described above. After 2 h preincubation in culture medium, spleen cells were incubated with FcBlock for 15 min and stained with FITC-labeled anti-F4/80 antibody to identify the macrophage population. The cells were then divided into two groups: surface and intracellular. The surface group was stained with PE-labeled anti TLR4-MD-2 antibodies (eBiosciences, San Diego, CA) and then fixed with 1.5% PAF. The intracellular group was fixed, first with 1.5% PAF to preserve the F4/80 surface stain, permeabilized by adding 0.5% saponin (weight/volume in PBA), and then stained for intracellular TLR4-MD-2. Both groups of cells were washed twice with PBA, stored in 0.3% PAF, and subsequently analyzed by flow cytometer.
Measurement of cytokine production following MAPK inhibition
Spleen cells prepared from mice 7 days after sham or burn injury were cultured in the presence of a dimethyl sulfoxide control, p38 inhibitor SB203580 (Sigma-Aldrich Chemical Corp.), or ERK (MAPK kinase 1/2) inhibitor UO126 (Cell Signaling) at concentrations of 0.1, 0.5, 1, 5, 10, and 20 µM/ml for 1.5 h. LPS (1 µg/ml) was then added as a stimulant as well as Brefeldin A (10 µg/ml). Six hours later, the cells were fixed, surface-stained for F4/80, permeabilized with saponin, and stained for intracellular TNF-
expression using PE-labeled, anti-TNF-
antibody (eBiosciences).
Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR)
FITC-labeled F4/80+ macrophages were purified (>90% purity) from spleen cell preparations at 7 days after injury using anti-FITC magnetic beads (Miltenyi Biotec, Auburn, CA). RNA was isolated using the TRIzol Reagent (Gibco-BRL, Grand Island, NY), per the manufacturers instructions. cDNA was synthesized using the SuperScript III RT system (Invitrogen). RT-PCR was then performed using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a housekeeping gene control, TLR4 gene-specific primers sets, and the 2x ABsolute QPCR SYBR Green reagent (ABgene Inc., Rochester, NY; TLR4 primer forward CCTGGCTGGTTTACACGTC; reverse GACATTGCAGAAACATTCGC). The RT-PCR reactions were run on the GeneAmp 5700 sequence detection system, and the results were calculated using the accompanying software program (PE Biosystems, Foster City, CA).
Statistical analysis
Results in figures are presented as mean ± SEM. Statistical analysis was performed using the GraphPad Prism 4 software (GraphPad Software, San Diego, CA). Unpaired Students t-tests were used to generate two-tailed P values.
 |
RESULTS
|
|---|
Injury does not alter MyD88 or IRAK-M expression levels but does decrease the total levels of p38, ERK, and SAPK/JNK
Injury has been shown to prime splenic macrophages for enhanced reactivity to TLR2 and TLR4 agonists manifested by increased production of inflammatory cytokines [3
]. As IRAK-M knockout mice showed similar hyper-reactivity to TLR agonists [9
], we wished to test whether injury decreased the levels of this TLR signaling inhibitor. Another potential explanation for the augmented TLR response is that injured animals might up-regulate the expression of TLR signaling molecules, MyD88 or MAPKs. To test these possibilities, we measured the injury-induced effects on the expression levels of the inhibitor IRAK-M, MyD88, as well as the total levels of MAPK molecules p38, ERK, and SAPK/JNK in splenic macrophages using a flow cytometric approach (Fig. 1
). We identified macrophages with a FITC-labeled, anti-F4/80 antibody, and changes in the signaling molecules of interest were detected with the appropriate PE-labeled antibodies. We found that sham and burn-injured mice expressed comparable levels of MyD88 and IRAK-M at 1 and 7 days after injury. However, although similar at day 1 after injury, burn mice had lower levels of total p38, ERK, and SAPK/JNK compared with sham mice on day 7. This is somewhat counterintuitive, given the previously observed increased responsiveness to TLR2 and TLR4 agonists at day 7 [3
]. Therefore, changes in the expression levels of these TLR4 signaling molecules do not explain the increased TLR responsiveness observed at 7 days after injury.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 1. Expression levels of signaling molecules in F4/80+ macrophages at 1 and 7 days after sham or burn injury measured by flow cytometry. Total spleen cell suspensions were prepared as described in Materials and Methods, permeabilized with methanol, and stained with antibodies for surface F4/80+ and intracellular signaling molecules. At day 1 (A) and day 7 (B), the levels of MyD88 and IRAK-M were comparable in sham and burn mice. However, although similar on day 1, the total levels (phosphorylated and nonphosphorylated) of p38, ERK, SAPK/JNK were decreased by day 7 in burn mice compared with sham. Results are presented as mean value ± SEM of two experiments (n=8 mice; *, P<0.05).
|
|
Development and validation of a flow cytometry approach to detect MAPK activation in LPS-stimulated mouse macrophages
To further study TLR4 signaling after injury, we developed a methodology to examine MAPK activation in freshly isolated mouse macrophages in response to purified LPS stimulation. Our approach took full advantage of an assay described previously using fluorescent-labeled, phospho-specific antibodies to detect the activation of MAPK signaling in situ by flow cytometry [14
, 15
]. We believed that this method was needed for our work, as the limited number of F4/80+ cells that can be isolated from individual mice makes Western blots impractical in assaying multiple time-points and multiple signaling molecules. This technique has been validated previously and confirmed to be comparable with Western blots [14
15
16
]. This flow cytometry technique also has the advantage over Western blots of allowing macrophages to be stimulated in a more physiologic, mixed spleen-cell population by eliminating the need to purify macrophages before stimulation. In addition, we preferred using this flow cytometry approach, as we were concerned that current methods for purification of F4/80 cells might alter their activation status.
We first validated this method and determined the optimal LPS concentration needed to induce MAPK signaling by examining levels of phospho-p38 in LPS-stimulated, splenic F4/80+ macrophages from control C57BL/6J mice. As shown in Figure 2A
, LPS caused a rapid (within 15 min) and easily detectable increase in the levels of phospho-p38. These preliminary studies also demonstrated that the magnitude of the response appeared to plateau at
1 µg/ml. To assure efficient staining of the MAPK molecule examined, we used the strong stimulant PMA as a positive control in each experiment. We include a representative FACS profile of LPS-stimulated macrophages in Figure 2B
to illustrate the levels of staining attained with this approach. To validate the specificity of the antiphospho-p38 antibody, we stained cells with antibody preincubated with phosphorylated or nonphosphorylated p38 peptide (Fig. 2C)
. Phosphorylated p38 peptide completely blocked the antiphospho-p38 antibody-mediated staining of F4/80+ cells, bringing the staining levels down to isotype control. Conversely, the addition of nonphosphorylated p38 peptide to the staining reaction had no effect on the staining. Taken together, these control studies confirm the specificity of this antibody for the detection of phosphorylated p38 MAPK.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 2. Flow cytometric approach to detect p38 activation in LPS-stimulated, F4/80+ splenic macrophages. (A) After 15 min, LPS caused a rapid and easily detectable increase in the levels of phosphorylated p38. The magnitude of this response appeared to plateau at approximately the 1-µg/ml LPS concentration. PMA was used as a positive control. Results are presented as mean value ± SEM of two experiments (n=8 mice). (B) Representative FACS plots that illustrate the level of staining attainable using this approach. (C) Representative FACS histogram plots demonstrating specificity of the antiphospho-p38 antibody. Cells were stained with standard phospho-p38 antibody or antibody preincubated with phosphorylated or nonphosphorylated p38 peptide. Staining was blocked with the phosphorylated p38 peptide but not with the nonphosphorylated peptide, thus confirming the specificity of the antibody for the phosphorylated form of p38. MFI, Mean fluorescence intensity.
|
|
To gain a more complete overview of the TLR4 response in mouse splenic macrophages, we next studied the kinetics of LPS-induced MAPK activation. Mouse spleen cells were cultured with the optimal stimulatory dose of LPS (1 µg/ml) or control medium for 5, 15, 30, and 60 min. We then measured phosphorylated p38, ERK, and SAPK/JNK levels by flow cytometry. As shown in Figure 3
, LPS caused a rapid increase in the activated forms of the MAPK molecules; the maximum difference between the stimulated and unstimulated cells appeared between the 15- and 30-min time-points for all three signaling molecules. We also found that phospho-p38 levels returned to baseline levels within 60 min after stimulation, while phospho-ERK and SAPK/JNK remained elevated.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 3. MAPK activation kinetics. Spleen-cell cultures were stimulated with 1 µg/ml LPS or culture medium for 5, 15, 30, and 60 min. Using flow cytometry, we measured the activation of p38, ERK, and SAPK/JNK in F4/80+ cells with phospho-specific antibodies. LPS caused a rapid increase in the number of cells with detectable phospho-MAPKs. The maximum difference between stimulated and unstimulated cells occurred at the 15- and 30-min time-points. Results are presented as mean value ± SEM of four experiments (n=16 mice; *, P<0.05).
|
|
The influence of injury on LPS-stimulated MAPK activation
Having validated the flow cytometry technique needed to assess MAPK activation in freshly prepared mouse macrophages, we turned our attention to studying how injury affects LPS-induced MAPK activation. Previous work from our laboratory had shown that the major increase in LPS responsiveness by splenic macrophages occurs at 7 days as opposed to 1 day after injury. Thus, we were interested in studying and comparing the changes in MAPK activation at both of these time-points and accordingly, harvested spleen cells from mice at 1 and 7 days after sham or burn injury. Following a 2-h preculture, we stimulated these cell preparations with 1 µg/ml purified LPS. The cells were then fixed, permeabilized, and stained for phosphorylated p38, ERK1/2, and SAPK/JNK as described above. As shown in Figure 4A
, unstimulated cells showed similar levels of phospho-p38 for sham and burn mice at both time-points. However, within 15 min of LPS stimulation, injured mice showed a nearly twofold increase in p38 activation (P<0.001). This occurred at days 1 and 7. For comparison, pERK and pSAPK/JNK are shown in Figure 4B
and 4C
, respectively. At 1 day after injury, macrophages from burn mice showed increased activation of both of these signaling molecules compared with sham (P<0.05). However, by 7 days after injury, there was only a slight but not significant trend toward increased activation of ERK and SAPK/JNK in macrophages from burn mice. Evaluation of data as MFI instead of percent positive cells similarly showed higher activation of p38 in cells from burn animals compared with sham animals (Fig. 4D)
. As the LPS-induced increase in cytokine production was previously found to be highest at 7 days, our findings suggest that p38 signaling might play a greater role than ERK or SAPK/JNK in the post-injury TLR4 hyper-reactivity.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 4. The influence of injury on LPS activation of MAPK. Total spleen cell suspensions were prepared and rested in a 2-h preculture. The cells were then stimulated with 1 µg/ml LPS or culture medium for 15 and 30 min. Levels of phosphorylated p38, ERK, and SAPK/JNK were measured in F4/80+ cells after permeabilization with methanol. (A) The p38 response. Although similar in unstimulated cells, upon stimulation with LPS, cells from burn mice showed a twofold increase in p38 activation at days 1 and 7 compared with sham animals. (B and C) The ERK and SAPK/JNK responses, respectively. ERK and SAPK/JNK show increased activation in burn mice in response to LPS on day 1 but not by day 7. (D) Activation of MAPK after 15 min of LPS stimulation presented as MFI. Cells from burn mice show significantly increased activation of p38 compared with sham animals at days 1 and 7. Results are presented as mean value ± SEM of three experiments (n=12 mice; *, P<0.05; **, P<0.001).
|
|
Effects of p38 and ERK inhibition on the production of TNF-
by LPS-stimulated, splenic macrophages
Because of the finding that burn injury resulted in increased p38 activation, we wished to examine whether inhibiting its activation would have a significant effect on TLR4-mediated, proinflammatory cytokine production. We selected TNF-
as a prototypical, proinflammatory cytokine, as previous studies have shown that burn injury significantly increases the LPS-stimulated, intracellular TNF-
expression [3
, 17
]. We were therefore interested in the effect of adding specific p38 or ERK inhibitors on LPS-stimulated TNF-
production by splenic macrophages from sham and burn mice.
After preculturing spleen cells with graded doses of a specific p38 inhibitor (SB203580) or an ERK inhibitor (UO126), LPS was added for a 6-h activation period in the presence of Brefeldin A, a protein transport inhibitor. Intracellular TNF-
was then measured in F4/80+ cells by two-color flow cytometry. As shown in Figure 5
, as expected, LPS induced higher levels of intracellular TNF-
expression in cells from burn as compared with sham-injured mice. Adding the p38 inhibitor to these cultures caused a dose-dependent reduction in this enhanced TNF-
expression seen in cells from burn mice but at least at the lower doses (0.10.5 µM), had no effect on the TNF-
expression in sham cells. At the 0.5 µM concentration and higher, there were no longer any significant differences in the TNF-
expression between sham and burn-injured mice. In comparison, we found that the pERK inhibitor had virtually no effect on TNF-
expression, suggesting that p38 is indeed the dominant MAPK pathway used in these cells for TLR4-induced TNF-
production. Taken together, these results support the finding that the p38 signaling pathway plays a prominent role in the augmented TLR4 responsiveness displayed by splenic macrophages at 7 days after injury.
TLR4-MD-2 expression after injury
Previous work from our laboratory has demonstrated that the surface expression of TLR4-MD-2 on macrophages is not changed after burn injury [3
]. Because of the more recent reports demonstrating the presence of intracellular TLR4-MD-2 receptors [18
19
20
], we wanted to re-examine the influence of burn injury on surface and intracellular expression of these receptors. To accomplish this, we harvested spleen cells from sham or injured mice at 1 and 7 days and examined TLR4-MD2 expression on the cell surface and in the cytoplasm of F4/80+ macrophages (Fig. 6
). To examine intracellular expression, we permeabilized cells with saponin instead of methanol, as preliminary optimization studies demonstrated that methanol decreased the staining intensity, possibly from excessive denaturation of TLR4 or MD-2 proteins.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 6. Effects of injury on cell-surface and intracellular expression of TLR4-MD-2. Using flow cytometry and antibodies specific for TLR4-MD-2, we measured the surface and intracellular levels of this receptor in F4/80+ cells at 1 and 7 days after injury. (A) The results presented as percent of cells positive for the TLR receptor; (B) the data as MFI. On day 1, injured animals showed increased levels of intracellular TLR4-MD-2, which persisted at day 7. The surface expression of TLR4-MD-2 was not changed on day 1 or by day 7 in injured versus sham animals. Results are presented as mean value ± SEM of two experiments (n=12 mice; *, P<0.05).
|
|
The results of these studies confirmed that burn injury did not significantly alter the cell-surface expression of TLR4-MD-2. When we examined intracellular expression levels, we observed a statistically significant increase in the percentage of cells with detectable, intracellular TLR4-MD-2 receptors (P<0.05) as well as a trend toward increased density of intracellular TLR4-MD-2 at 1 day post-injury. However, by 7 days after injury, the intracellular level of TLR4-MD-2 staining in F4/80+ macrophages was clearly increased (P<0.05), suggesting that the increase in LPS responsiveness might be a result of a higher general expression of the TLR4-MD-2 protein.
To determine if injury influenced TLR4 gene expression, we used quantitative RT-PCR to assess changes in expression of TLR4 mRNA in purified F4/80+ macrophages from sham or burn mice at 7 days after injury. Using GAPDH as housekeeping gene control, we detected a 2.5-fold increase in TLR4 mRNA levels in burn mice compared with sham (Fig. 7
). Taken together, these findings indicate that injury induces a significant increase in TLR4 gene expression levels and intracellular TLR4-MD-2 expression in splenic macrophages.

View larger version (8K):
[in this window]
[in a new window]
|
Figure 7. Changes in TLR4 gene expression levels following injury. Using quantitative RT-PCR, we measured the TLR4 mRNA in highly purified F4/80+ cells at 7 days after sham or burn injury. Results are presented as 1/ Ct, the difference in the number of PCR cycles needed to reach a threshold between the measured gene (TLR4) and the housekeeping gene GAPDH. This corresponds to approximately a 2.5-fold increase in TLR4 mRNA in burn mice compared with sham (*, P<0.05).
|
|
 |
DISCUSSION
|
|---|
The increased responsiveness of the innate-immune system following severe injury likely plays a central role in the development of the post-injury systemic inflammatory-response syndrome. This augmented inflammatory phenotype that occurs after serious injury is thought to contribute to the development of multiple organ failure [21
22
23
]. We and others [1
2
3
4
] have reported that burn injury can potently enhance the responsiveness of macrophages to purified LPS stimulation, resulting in a markedly increased production of proinflammatory cytokines. The present study was initiated to provide a better understanding of the changes in the TLR4-mediated signaling pathways that might explain the increased reactivity of macrophages to LPS stimulation. We show that burn injury leads to augmented TLR4-mediated p38 activation in splenic macrophages. The other MAPK pathways examined in this study, ERK and SAPK/JNK, did not appear to play a significant role in the augmented TLR4 reactivity exhibited by burn injury-primed, splenic macrophages.
Other research groups have reported the critical role played by the p38 signaling pathway in the post-injury LPS response. In particular, Schwacha and colleagues [24
, 25
] have recently documented that burn injury causes increased p38 activation by crude LPS in plastic-adherent, splenic macrophages. Consistent with our findings, they found that the ERK and SAPK/JNK activation pathways played a lesser role in LPS signaling in murine macrophages. Others have shown that burn injury enhanced p38 activation in renal cells and that inhibiting p38 resulted in a reduced neutrophil influx into the glomerulus and prevented the development of burn-induced renal failure [26
]. Increased p38 activation has also been shown to occur after cardiac ischemia reperfusion injury [27
, 28
] and in cardiac myocytes exposed to LPS [29
]. In the latter study, inhibiting p38 activation not only caused decreased LPS-induced cardiac inflammatory cytokine gene expression but also attenuated the LPS-induced decline in left ventricular-developed pressure and coronary blood flow.
Although we have consistently observed similar levels of cell-surface TLR4 expression in burn and sham macrophages [3
, 17
], recent evidence supports the idea that higher levels of TLR4 reside in the Golgi apparatus within the cytoplasm of monocytes and other cells and that these intracellular receptors have the capacity to rapidly cycle to the cell surface to mediate LPS signaling. Although Wright and colleagues [30
, 31
] have reported that LPS traffics directly to the Golgi apparatus once internalized, and additional reports have suggested that TLR4 signals intracellularly in coronary artery endothelial [32
] and intestinal epithelial cells [33
, 34
], work by Golenbock and colleagues [18
, 19
, 35
] suggests that LPS signaling in monocytes/macrophages is initiated on the cell surface. Using fluorescent microscopy, they have illustrated that TLR4/CD14/MD-2 complexes recycle rapidly between the Golgi apparatus and the plasma membrane. In these experiments, they demonstrated that the plasma membrane-impermeable, TLR4-specific antibody was sufficient to induce signaling and that the pharmacological disruption of LPS trafficking to the Golgi apparatus did not disrupt the cell membrane-initiated TLR4 response. In light of their findings, we are uncertain what role the injury-associated increase in the intracellular TLR4 pool that we observed plays in the increased LPS responsiveness exhibited by splenic macrophages at 7 days after injury. Although there appears to be significantly more intracellular TLR4-MD-2 receptors available for recycling to the surface of burn versus sham macrophages, we have so far been unable to document any increase in the surface expression of these receptors by stimulated cells from burn animals.
Recently available flow cytometry techniques were used to study macrophage TLR4-MD-2 signaling in the present report, as the number of purified cells obtainable from the spleens of individual animals was insufficient to assay multiple time-points and multiple signaling molecules by Western immunoblotting and immunoprecipitation assays. Moreover, flow cytometry has the added advantage of permitting activation of TLR4 in macrophages within a more physiologic mixed spleen-cell population rather than an isolated fraction of purified macrophages, which would be required for Western analysis. The results of our experiments showed similar levels of MyD88 and IRAK-M molecules in F4/80+ cells from sham and burn-injured mice, suggesting that changes in the expression of these two molecules do not play a significant role in post-injury signaling. However, suitable reagents are not yet available for flow cytometric detection of a number of other molecules in the TLR4 signaling complex and for determination of their activation/phosphorylation. Thus, possible injury-induced alterations in TLR4 signaling proximal to MAPK activation cannot be ruled in or out by the present investigation.
The results presented here suggest the possibility of controlling the marked and potentially harmful up-regulation of TLR4 reactivity by severe injury in a clinical setting by modulating or inhibiting the p38 signaling pathway. However, the potential, beneficial effects of p38 inhibition would have to be weighted against the negative influence of such inhibition on host immunity.
 |
ACKNOWLEDGEMENTS
|
|---|
This research work was supported by grant funding from NIH (GM57664 and GM35633) and by the Julian and Eunice Cohen and Brook Family Funds for Surgical Research. The authors acknowledge Drs. Randy Wetzel and Andreas Nelsbach (Cell Signaling Technology, Beverly, MA) for their direct help in setting up the flow cytometric assays to detect activated MAPKs in mouse macrophages.
Received December 2, 2004;
revised April 1, 2005;
accepted April 7, 2005.
 |
REFERENCES
|
|---|
- Shahbazian, L. M., Jeevanandam, M., Petersen, S. R. (1999) Release of proinflammatory cytokines by mitogen-stimulated peripheral blood mononuclear cells from critically ill multiple-trauma victims Metabolism 48,1397-1401[CrossRef][Medline]
- Jeevanandam, M., Shahbazian, L. M., Petersen, S. R. (1999) Proinflammatory cytokine production by mitogen-stimulated peripheral blood mononuclear cells (PBMCs) in trauma patients fed immune-enhancing enteral diets Nutrition 15,842-847[CrossRef][Medline]
- Paterson, H. M., Murphy, T. J., Purcell, E. J., Shelley, O., Kriynovich, S. J., Lien, E., Mannick, J. A., Lederer, J. A. (2003) Injury primes the innate immune system for enhanced Toll-like receptor reactivity J. Immunol. 171,1473-1483[Abstract/Free Full Text]
- Schwacha, M. G., Somers, S. D. (1998) Thermal injury-induced immunosuppression in mice: the role of macrophage-derived reactive nitrogen intermediates J. Leukoc. Biol. 63,51-58[Abstract]
- Takeda, K., Akira, S. (2004) TLR signaling pathways Semin. Immunol. 16,3-9[CrossRef][Medline]
- Akira, S., Takeda, K. (2004) Toll-like receptor signaling Nat. Rev. Immunol. 4,499-511[CrossRef][Medline]
- Kawai, T., Adachi, O., Ogawa, T., Takeda, K., Akira, S. (1999) Unresponsiveness of MyD88-deficient mice to endotoxin Immunity 11,115-122[CrossRef][Medline]
- Rao, K. M. (2001) MAP kinase activation in macrophages J. Leukoc. Biol. 69,3-10[Abstract/Free Full Text]
- Kobayashi, K., Hernandez, L. D., Galan, J. E., Janeway, C. A., Jr, Medzhitov, R., Flavell, R. A. (2002) IRAK-M is a negative regulator of Toll-like receptor signaling Cell 110,191-202[CrossRef][Medline]
- Polentarutti, N., Rol, G. P., Muzio, M., Bosisio, D., Camnasio, M., Riva, F., Zoja, C., Benigni, A., Tomasoni, S., Vecchi, A., Garlanda, C., Mantovani, A. (2003) Unique pattern of expression and inhibition of IL-1 signaling by the IL-1 receptor family member TIR8/SIGIRR Eur. Cytokine Netw. 14,211-218[Medline]
- Hirschfeld, M., Ma, Y., Weis, J. H., Vogel, S. N., Weis, J. J. (2000) Cutting edge: repurification of lipopolysaccharide eliminates signaling through both human and murine Toll-like receptor 2 J. Immunol. 165,618-622[Abstract/Free Full Text]
- Kurt-Jones, E. A., Mandell, L., Whitney, C., Padgett, A., Gosselin, K., Newburger, P. E., Finberg, R. W. (2002) Role of Toll-like receptor 2 (TLR2) in neutrophil activation: GM-CSF enhances TLR2 expression and TLR2-mediated interleukin 8 responses in neutrophils Blood 100,1860-1868[Abstract/Free Full Text]
- Moss, N. M., Gough, D. B., Jordan, A. L., Grbic, J. T., Wood, J. J., Rodrick, M. L., Mannick, J. A. (1988) Temporal correlation of impaired immune response after thermal injury with susceptibility to infection in a murine model Surgery 104,882-887[Medline]
- Krutzik, P. O., Nolan, G. P. (2003) Intracellular phospho-protein staining techniques for flow cytometry: monitoring single cell signaling events Cytometry A 55,61-70[Medline]
- Chow, S., Patel, H., Hedley, D. W. (2001) Measurement of MAP kinase activation by flow cytometry using phospho-specific antibodies to MEK and ERK: potential for pharmacodynamic monitoring of signal transduction inhibitors Cytometry 46,72-78[CrossRef][Medline]
- Perez, O. D., Nolan, G. P. (2002) Simultaneous measurement of multiple active kinase states using polychromatic flow cytometry Nat. Biotechnol. 20,155-162[Medline]
- Murphy, T. J., Paterson, H. M., Mannick, J. A., Lederer, J. A. (2003) Injury, sepsis, and the regulation of Toll-like receptor responses J. Leukoc. Biol. 75,400-407
- Latz, E., Visintin, A., Lien, E., Fitzgerald, K. A., Espevik, T., Golenbock, D. T. (2003) The LPS receptor generates inflammatory signals from the cell surface J. Endotoxin Res. 9,375-380[CrossRef]
- Latz, E., Visintin, A., Lien, E., Fitzgerald, K. A., Monks, B. G., Kurt-Jones, E. A., Golenbock, D. T., Espevik, T. (2002) Lipopolysaccharide rapidly traffics to and from the Golgi apparatus with the Toll-like receptor 4-MD-2-CD14 complex in a process that is distinct from the initiation of signal transduction J. Biol. Chem. 277,47834-47843[Abstract/Free Full Text]
- Meng, G., Rutz, M., Schiemann, M., Metzger, J., Grabiec, A., Schwandner, R., Luppa, P. B., Ebel, F., Busch, D. H., Bauer, S., Wagner, H., Kirschning, C. J. (2004) Antagonistic antibody prevents Toll-like receptor 2-driven lethal shock-like syndromes J. Clin. Invest. 113,1473-1481[CrossRef][Medline]
- Vincent, J. L. (1996) Prevention and therapy of multiple organ failure World J. Surg. 20,465-470[CrossRef][Medline]
- Mannick, J. A., Rodrick, M. L., Lederer, J. A. (2001) The immunologic response to injury J. Am. Coll. Surg. 193,237-244[CrossRef][Medline]
- Schlag, G., Redl, H. (1996) Mediators of injury and inflammation World J. Surg. 20,406-410[CrossRef][Medline]
- Schwacha, M. G., Chaudry, I. H., Alexander, M. (2003) Regulation of macrophage IL-10 production postinjury via ß2 integrin signaling and the P38 MAP kinase pathway Shock 20,529-535[CrossRef][Medline]
- Alexander, M., Daniel, T., Chaudry, I. H., Schwacha, M. G. (2004) MAP kinases differentially regulate the expression of macrophage hyperactivity after thermal injury J. Cell. Physiol. 201,35-44[CrossRef][Medline]
- Kita, T., Yamaguchi, H., Sato, H., Kasai, K., Tanaka, T., Tanaka, N. (2004) Role of p38 mitogen-activated protein kinase pathway on renal failure in the infant rat after burn injury Shock 21,535-542[CrossRef][Medline]
- Chong, A. J., Shimamoto, A., Hampton, C. R., Takayama, H., Spring, D. J., Rothnie, C. L., Yada, M., Pohlman, T. H., Verrier, E. D. (2004) Toll-like receptor 4 mediates ischemia/reperfusion injury of the heart J. Thorac. Cardiovasc. Surg. 128,170-179[Abstract/Free Full Text]
- Armstrong, S. C. (2004) Protein kinase activation and myocardial ischemia/reperfusion injury Cardiovasc. Res. 61,427-436[Abstract/Free Full Text]
- Wang, M., Sankula, R., Tsai, B. M., Meldrum, K. K., Turrentine, M., March, K. L., Brown, J. W., Dinarello, C. A., Meldrum, D. R. (2004) P38 MAPK mediates myocardial proinflammatory cytokine production and endotoxin-induced contractile suppression Shock 21,170-174[CrossRef][Medline]
- Thieblemont, N., Wright, S. D. (1999) Transport of bacterial lipopolysaccharide to the Golgi apparatus J. Exp. Med. 190,523-534[Abstract/Free Full Text]
- Thieblemont, N., Thieringer, R., Wright, S. D. (1998) Innate immune recognition of bacterial lipopolysaccharide: dependence on interactions with membrane lipids and endocytic movement Immunity 8,771-777[CrossRef][Medline]
- Dunzendorfer, S., Lee, H. K., Soldau, K., Tobias, P. S. (2004) Toll-like receptor 4 functions intracellularly in human coronary artery endothelial cells: roles of LBP and sCD14 in mediating LPS responses FASEB J. 18,1117-1119[Abstract/Free Full Text]
- Hornef, M. W., Normark, B. H., Vandewalle, A., Normark, S. (2003) Intracellular recognition of lipopolysaccharide by Toll-like receptor 4 in intestinal epithelial cells J. Exp. Med. 198,1225-1235[Abstract/Free Full Text]
- Hornef, M. W., Frisan, T., Vandewalle, A., Normark, S., Richter-Dahlfors, A. (2002) Toll-like receptor 4 resides in the Golgi apparatus and colocalizes with internalized lipopolysaccharide in intestinal epithelial cells J. Exp. Med. 195,559-570[Abstract/Free Full Text]
- Espevik, T., Latz, E., Lien, E., Monks, B., Golenbock, D. T. (2003) Cell distributions and functions of Toll-like receptor 4 studied by fluorescent gene constructs Scand. J. Infect. Dis. 35,660-664[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
Y. Tsuda, K. Shigematsu, M. Kobayashi, D. N. Herndon, and F. Suzuki
Role of Polymorphonuclear Neutrophils on Infectious Complications Stemming from Enterococcus faecalis Oral Infection in Thermally Injured Mice
J. Immunol.,
March 15, 2008;
180(6):
4133 - 4138.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kawasaki, M. A. Choudhry, M. G. Schwacha, S. Fujimi, J. A. Lederer, K. I. Bland, and I. H. Chaudry
Trauma-hemorrhage inhibits splenic dendritic cell proinflammatory cytokine production via a mitogen-activated protein kinase process
Am J Physiol Cell Physiol,
March 1, 2008;
294(3):
C754 - C764.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Maung, S. Fujimi, M. P. MacConmara, G. Tajima, A. M. McKenna, A. J. Delisle, C. Stallwood, A. B. Onderdonk, J. A. Mannick, and J. A. Lederer
Injury Enhances Resistance to Escherichia coli Infection by Boosting Innate Immune System Function
J. Immunol.,
February 15, 2008;
180(4):
2450 - 2458.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Suzuki, T. Shimizu, H.-P. Yu, Y.-C. Hsieh, M. A. Choudhry, K. I. Bland, and I. H. Chaudry
Estrogen receptor-{alpha} predominantly mediates the salutary effects of 17beta-estradiol on splenic macrophages following trauma-hemorrhage
Am J Physiol Cell Physiol,
September 1, 2007;
293(3):
C978 - C984.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. T. Bailey, H. Engler, N. D. Powell, D. A. Padgett, and J. F. Sheridan
Repeated social defeat increases the bactericidal activity of splenic macrophages through a Toll-like receptor-dependent pathway
Am J Physiol Regulatory Integrative Comp Physiol,
September 1, 2007;
293(3):
R1180 - R1190.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tarang, A. Sodhi, and P. Chauhan
Differential expression of Toll-like receptors in murine peritoneal macrophages in vitro on treatment with cisplatin
Int. Immunol.,
May 1, 2007;
19(5):
635 - 643.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kawasaki, M. A. Choudhry, M. G. Schwacha, K. I. Bland, and I. H. Chaudry
Lidocaine depresses splenocyte immune functions following trauma-hemorrhage in mice
Am J Physiol Cell Physiol,
November 1, 2006;
291(5):
C1049 - C1055.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. Thobe, M. Frink, M. A. Choudhry, M. G. Schwacha, K. I. Bland, and I. H. Chaudry
Src family kinases regulate p38 MAPK-mediated IL-6 production in Kupffer cells following hypoxia
Am J Physiol Cell Physiol,
September 1, 2006;
291(3):
C476 - C482.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. H. Brownstein, T. Logvinenko, J. A. Lederer, J. P. Cobb, W. J. Hubbard, I. H. Chaudry, D. G. Remick, H. V. Baker, W. Xiao, J. A. Mannick, et al.
Commonality and differences in leukocyte gene expression patterns among three models of inflammation and injury
Physiol Genomics,
February 23, 2006;
24(3):
298 - 309.
[Abstract]
[Full Text]
[PDF]
|
 |
|