Journal of Leukocyte Biology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published online as doi:10.1189/jlb.0205061 on May 20, 2005

Published online before print May 20, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0205061v1
78/2/426    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dorsch, M.
Right arrow Articles by Fraser, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dorsch, M.
Right arrow Articles by Fraser, C. C.
(Journal of Leukocyte Biology. 2005;78:426-434.)
© 2005 by Society for Leukocyte Biology

PK1/EG-VEGF induces monocyte differentiation and activation

Marion Dorsch, Yubin Qiu, Dulce Soler, Nita Frank, Thao Duong, Andrew Goodearl, Steve O’Neil, Jose Lora and Christopher C. Fraser1

Millennium Pharmaceuticals Inc., Cambridge, Massachusetts

1 Correspondence: Millennium Pharmaceuticals Inc., 35 Landsdowne St., Cambridge, MA 02139. E-mail: fraser{at}mpi.com


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Macrophages exist as sentinels in innate immune response and react by expressing proinflammatory cytokines and up-regulating antigen-presenting and costimulatory molecules. We report a novel function for prokineticin-1 (PK1)/endocrine gland-derived vascular endothelial growth factor. Screening of murine tissue sections and cells for specific binding site leads to the identification of macrophages as an in vivo cellular target for PK1. We demonstrate PK1 induces differentiation of murine and human bone marrow cells into the monocyte/macrophage lineage. Human peripheral blood monocytes respond to PK1 by morphological changes and down-regulation of B7-1, CD14, CC chemokine receptor 5, and CXC chemokine receptor 4. Monocytes treated with PK1 have elevated interleukin (IL)-12 and tumor necrosis factor {alpha} and down-regulated IL-10 production in response to lipopolysaccharide. PK1 induces a distinct monocyte-derived cell population, which is primed for release of proinflammatory cytokines that favor a T helper cell type 1 response.

Key Words: macrophage • innate • Th1 • cytokine


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Human monocytes are derived from primitive precursors and progenitors in the bone marrow [1 ]. The primary cytokines responsible for differentiation and proliferation in the monocytic lineage are interleukin-3 (IL-3), granulocyte macrophage-colony stimulating factor (GM-CSF), and CSF-1 (Csf-1; also known as M-CSF) [2 ]. Pluripotent hematopoietic stem cells, with myeloid and lymphoid potential residing in the bone marrow, differentiate into a monocyte/macrophage-restricted progenitor and then into monoblast and promonocyte precursor cells in the bone marrow. Csf-1 is the primary cytokine responsible for most stages of monocyte production [3 , 4 ]. The mature monocyte travels into the circulation and then undergoes extravasation from the blood to peripheral tissues. The rate at which monocytes are produced into the circulation is elevated in response to inflammation [5 , 6 ].

Multiple factors influence monocyte development into mature, tissue-specific macrophages or dendritic cells (DC). In vitro Csf-1 induces maturation of monocytes into the macrophage lineage, and GM-CSF and IL-4 induce monocytes to mature into the DC lineage [7 ]. Tissue macrophages and DC serve as the sentinel cell for innate immune response to pathogens by production of proinflammatory cytokines but also alter the adaptive immune response through cytokine production and costimulatory signals [8 ]. IL-12 is a key mediator produced by monocyte-derived cells and is a critical link between innate and adaptive immunity by stimulating immature T helper (Th) cells to differentiate into Th cell type 1 (Th1) T cells [9 ]. IL-12 production in monocyte-derived cells is up-regulated by interferon-{gamma} (IFN-{gamma}) but down-regulated by tumor necrosis factor {alpha} (TNF-{alpha}) and IL-10 [10 11 12 ].

Although local soluble and membrane-bound mediators of innate and adaptive immunity are key in an inflammatory response, hormones produced by the endocrine system have been long proposed as regulators of the immune system [13 , 14 ]. Cytokines produced in response to inflammation stimulate the endocrine system to produce hormones directly as a result of stimulation of the hypothalamic-pituitary (HP) unit or through secondary stimulation of HP targets such as thyroid, gonad, and adrenal glands [15 16 17 ]. Glucocorticoids produced by the adrenal gland are up-regulated during inflammation and are thought to down-regulate cytokine production. This proposed feedback mechanism is simplistic, as glucocorticoids may enhance humoral or allergic immune response [18 ] and may support a shift to a Th2 cytokine secretion by altering IL-12 production in monocytes, macrophages, and DC [19 20 21 ].

Recently, a protein, prokineticin 1 (PK1), was identified, which induced contraction of gastrointestinal smooth muscle [22 ]. The same protein was subsequently shown to induce proliferation and differentiation of endothelial cells derived from endocrine glands and was termed endocrine gland-derived vascular endothelial growth factor (EG-VEGF) [23 , 24 ]. PK1 is a 105-amino acid protein (including signal sequence) with 10 cysteines and is highly related to a protein (venom protein A) found in abundance in the venom of black mamba snake (Dendroaspis polylepsis). PK1 is expressed primarily in adrenal gland, testis, and ovary, and its expression is induced by hypoxia [23 ]. Recently, the receptors for PK1 and a closely related ligand termed PK2 (PKR1 and PKR2, respectively) have been identified [25 ]. PKR1 and PKR2 are G protein-coupled receptors (GPCR), which bind and respond to the PK1 and PK2 by mobilization of calcium, turnover of phosphoinositide, and activation of mitogen-activated protein kinase (MAPK) signaling pathways. Both receptors were shown to be expressed in endocrine and nonendocrine tissues by reverse transcriptase-polymerase chain reaction (PCR) of cDNA [25 ]. It was recently shown that PK2 is expressed highly at inflammatory sites and can stimulate monocyte migration and survival [26 ].

In this report, we demonstrate that PK1 binds to murine macrophages and induces differentiation of human and mouse bone marrow-derived cells into the monocyte/macrophage lineage. PK1 induces morphological changes in human peripheral blood monocytes and alters expression of cell-surface proteins involved in innate and acquired immunity. Monocytes treated with PK1 are primed for release of TNF-{alpha} and IL-12 but express low levels of IL-10 in response to lipopolysaccharide (LPS). Our findings implicate PK1 as a newly discovered, secreted protein, which alters monocyte differentiation and function.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Recombinant protein purification and detection
PK1 was amplified by PCR and cloned into expression vectors containing different epitope tags. The following oligos were used: P1, 5' TTTTTGAATTCACCGCCATGAGAGGTGCCACGCGAG 3'; P2, 5' TTTTTCTCGAGAAAATTGATGTTCTTCAAGTCCA 3'; P3, 5' TTTTTAGATCTGCTGTGATCACAGGGGCC 3'; P4, 5' TTTTTCTCGAGCTAAAAATTGATGTTCTTCAAGTC 3'.

PK1 was amplified with P1 (contains EcoRI site and Kozak sequence) and P2 (contains XhoI site) and was cloned in-frame into the EcoRI and XhoI sites of the pMEAP3 vector, 5' of alkaline phosphatase (PK1-AP). Using the same sites, PK1 was also cloned into pcDNA3.1 containing the sequence encoding for the Fc part of human immunoglobulin G1 (hIgG1) or a FLAG epitope adding the Fc (PK1-Fc) or Flag (PK1-Flag) sequence in-frame to the 3' end of PK1. Oligos P3 and P4 were used to clone PK1 (without signal peptide) into the BglII and XhoI cloning sites of plasmid APTag3, 3' of AP and in-frame (AP-PK1). The sequenced DNA constructs were transiently transfected into human embryonic kidney 293 T cells in 150 mM plates using Lipofectamine (Gibco/BRL, Grand Island, NY), according to the manufacturer’s protocol. Post-transfection (72 h), the serum-free, conditioned media (OptiMEM, Gibco/BRL) were harvested, spun, and filtered. AP activity in conditioned media was quantitated using an enzymatic assay kit (Phosphalight Tropix, Bedford, MA), according to the manufacturer’s instructions and known standards. Conditioned medium samples were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by Western blot using polyclonal antipeptide antibodies to PK1 (see below). Isolation of the PK1-Fc was performed with a one-step purification scheme using the affinity of the hIgG1 Fc domain to Protein A. The conditioned media were passed over a POROS A column (4.6x100 mm, PerSeptive Biosystems, Framingham, MA); the column was then washed with phosphate-buffered saline (PBS), pH 7.4, and eluted with 200 mM glycine, pH 3.0. Samples were dialyzed against PBS, pH 7.4, at 4°C with constant stirring. The buffered, exchanged material was then sterile-filtered (0.2 µm, Millipore, Bedford, MA) and frozen at –80°C. Fc-control fusion protein of similar size was expressed and purified in the same manner. Purified proteins were tested for endotoxin using the limulus amebocyte lysate assay (Associates of Cape Cod, East Falmouth, MA), according to the manufacturer’s instructions. Endotoxin levels were consistenly below 0.2 pg (0.002 EU) per µg protein. Heat-inactivated (HI) PK1-Fc was used as control in all assays performed and had no functional activity, showing that functional effects were a result of PK1 and not endotoxin contamination.

Polyclonal anti-PK1 was produced in rabbits using the peptide PLGREGEECHPGSHK. Antibody was peptide affinity-purified from 12-week bleeds.

Generation of stable PKR2 cell transfectants in the Chinese hamster ovary (CHO)/G{alpha}16 cell line
Myc-tagged and untagged, wild-type PKR2 sequences were inserted into the pEF1 vector (Invitrogen, Carlsbad, CA) and transfected into the CHO cell line, stably transfected with the promiscuous G protein G{alpha}16 (Molecular Devices, Sunnyvale, CA) with established protocols using the Lipofectamine 2000 transfection reagent (Gibco/BRL). Forty-eight hours after transfection, transfected cells were selected with 0.8 mg/ml Geneticin. Bulk transfectants were sorted (FACSVantage SE, Becton Dickinson, Franklin Lakes, NJ) with anti-myc (Jackson Laboratory, Bar Harbor, MA) or with PKR2-specific monoclonal antibodies (mAb) raised against an N-terminal peptide of the receptor (D32-T46). Single-cell clones were isolated, and receptor level expression was monitored with the same antibodies. Clones were further selected by their ability to release intracellular calcium in response to PK1/EG-VEGF, as measured by a fluorometric imaging plate reader (FLIPR; Molecular Devices). Release of Ca2+ from intracellular stores was from PKR2 CHO/G{alpha}16 cell transfectants by PK1/EG-VEGF. Release of calcium from intracellular stores was measured using a FLIPR instrument. Cells were loaded with the calcium dye Fluo-3 by established protocols. Typically, 40,000 cells were plated on a black 96-well plate (Costar, Corning, NY) and incubated for 16 h. Cells were washed with wash buffer [HEPES/Hanks’ balanced salt solution (HBSS)] and incubated with loading dye buffer [Fluo-3/dimethyl sulfoxide, pluronic acid, bovine serum albumin (BSA), HBSS/HEPES buffer] for 1 h at 37°C. Cells were washed three times with wash buffer, and 50 mL of the same buffer was added. The FLIPR experiment was performed in triplicate by addition of 50 µL 2x ligand concentration, and fluorometric measurements were taken for 4 min. Mean and SD of maximum fluorescence values were plotted and analyzed with Kaleidograph (Synergy Software Reading, PA).

Binding studies
Binding studies using AP fusion proteins were done as described [27 ]. Briefly, 8 µM cyrostat sections were prepared from tissues embedded in OCT and frozen in liquid nitrogen. Sections were thawed, washed once in HBSS supplemented with 20 mM Hepes (HBHA), pH 7, 0.05% BSA, and 0.1% sodium azide, and incubated with AP fusion proteins for 1 h in a humidifed chamber. Sections were washed six times in HBHA, fixed in acetone/paraformaldehyde, washed three times in 20 mM Hepes, pH 7.5, 150 mM NaCl, and developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitroblue tetrazolium (NBT) substrate solution (100 mM Tris-HCl, pH 9.5, 100 mM NaCl, 5 mM MgCl, 0.17 mg/ml BCIP, and 0.33 mg/ml NBT). Bone marrow-derived macrophages were obtained by culturing nucleated bone marrow cells (see below) with 50 ng/ml M-CSF on coverslips in six-well plates [28 ]. After 3 days, nonadherent cells were removed, and adherent cells on coverslips were fixed in acetone and air-dried. Binding studies were done as outlined above.

Measurement of PKR1, PKR2, and PK1 mRNA expression
Human cell isolation and quanatitative PCR were performed as described previously [29 ]. Human tissues were obtained with informed consent. Total RNA from cells in culture was extracted by a single-step method using the Qiagen® RNA extraction kit RNeasy system (Qiagen, Valencia, CA). Murine cells were isolated from normal C57/B6 mice. Single-cell suspension of spleens was prepared by forcing tissues through sterile 70 µm nylon mesh (Becton Dickinson), followed by extensive washing with Dulbecoo’s modified Eagle’s medium (DMEM). Red blood cells were removed by red blood lysing buffer (Sigma-Aldrich, St. Louis, MO). CD4 T cells were isolated by using positive selection of magnetic cell sorter beads (Miltenyi Biotec, Bergish Gladbach, Germany), according to the manufacturer’s conditions. Briefly, cells were suspended with magnetic microbeads that had been conjugated with anti-murine (m)CD4 mAb (GK1.5) and isolated after immobilization with a magnet. The cells were suspended at 1–2 x 106/ml with DMEM containing 100 U/ml penicillin, 100 µg/ml streptomycin, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, 0.5 µM 2-mercaptoethanol (2-ME), and 10% HI fetal calf serum (FCS). Th1 cells were generated from CD4 cells, activated, and cultured in medium containing plate-bound anti-mCD3 (PharMingen, San Diego, CA), 3 µg/ml anti-mCD28, 10 µg/ml anti-mIL-4 (R&D Systems, Minneapolis, MN), and 50 ng/ml recombinant (r)mIL-12 (R&D Systems) for 5 days to polarize into Th1 cells. RNA was isolated with RNAzole (Tel-Test, Inc., Friendswood, TX). Th2 cells were generated by culturing with plate-bound anti-mCD3, 3 µg/ml anti-mCD28, 10 µg/ml anti-mIL-12 (R&D Systems), and 50 ng/ml rmIL-4 (R&D Systems) for 5 days. CD8 cells were isolated with anti-mCD8 microbeads. B cells were purified with mB220 microbeads. Macrophages were isolated with mCD11b microbeads. Expression profiles were determined by real-time PCR analysis (TaqmanTM, Applied Biosystems Foster City, CA). In brief, an oligonucleotide probe was designed to anneal the gene of interest between two PCR primers. The sequences for the primers and probes were as follows: hPKR1, probe, 5' CAACCCTCATGGAGCCCATGCC 3'; forward, 5' ACACTTCCACCAGCTTCCTTTCT 3'; reverse, 5' CGCTGTAGCTGAAGTTGAATGG 3'. mPKR1, probe, 5' CAATTCTCGGACTTTCTTTGCTGCCAAGAT 3'; forward, 5' CCCCTGGATGAAGAGGAAGAT 3'; reverse, 5' ACCAAAGCCATGCCAATGAC 3'. hPKR2, probe, 5' CAAACGGCCTCCTTCCTGATCGC 3'; forward, 5' CCCTTGAAACCACGGATGAAT 3'; reverse, 5' AATGGACACCATCCAGACCAA 3'. mPKR2, probe, 5' CATTGCTGCCCTCGCCCGC 3'; forward, 5' CGGCATTGGCAACTTTGTCT 3'; reverse, 5' AAGGTTGCGCAGCTTCTTGT 3'. hPK1, probe, 5' ATGCCTCTGAGGCCCCCTCTTACCA 3'; forward, 5' TGTGACCTTCTGCCAGAATTGT 3'; reverse, 5' GGGCTTCAGTGGTTAACTGGTAA 3'.

The probe was then fluorescently labeled with FAM (reporter dye) on the 5' end and TAMRA (quencher dye) on the 3' end. A similar probe and PCR primers were designed for ß2 microglobulin (human expression) or glyceraldehyde 3-phosphate dehydrogenase (GAPDH; mouse expression), which were used as internal controls. The probe for these genes incorporated VIC as the reporter dye. PCR reactions were run and included the primers and probes for the gene of interest and the internal control, as well as cDNA made from various cell types in culture. As the polymerase moves across the gene during the reaction, it cleaves the quencher dye from one end of each probe, which causes a fluorescent emission that is measured by the Sequence Detector 7700. The emissions recorded for each cDNA can then be converted into the level of expression for the gene normalized to the expression of ß2 microglobulin or GAPDH.

Mouse bone marrow assays
Mouse bone marrow assays were performed as described previously [30 ]. Bone marrow was harvested from femurs of 4- to 6-week-old C57BL6 mice and passed over a mouse density centrifugation medium (LympolyteM, Cedarlane Laboratories, Ontario, Canada) to isolate nucleated cells. Cultures were set up in six-well plates using 2.5 x 106 cells per well in McCoy’s 5A medium supplemented with 15% FCS and antibiotics. Cells were cultured for 3–7 days in the presence of PK1. For flow cytometry analysis, adherent cells were detached in Versene, pooled with nonadherent cells, washed, and then incubated for 60 min with 10 µg/ml fluorescein isothiocayante (FITC)-conjugated marker antibodies. Cells were then washed and analyzed with a FACSCaliber flow cytometer. Blocking antisera to M-CSF, GM-CSF, and IL-3 were purchased from R&D Systems and included in the assay where indicated. For in situ fluorescence analysis, adherent cells grown on chamberslides were fixed in acetone, washed in PBS, and incubated for 60 min with FITC-conjugated marker antibodies in a humidified staining chamber. Slides were washed in PBS, mounted with coverslips, and analyzed under a fluorescence microscope.

Human bone marrow CD34+ cell culture and analysis
Adult human bone marrow cells selected for expression of CD34 were purchased from Purecell (Foster City, CA). Cells (4x103 cells/ml) were cultured for 14 days in serum-free media containing cytokines (StemCell Technologies, Vancouver, BC, Canada) fetal liver tyrosine kinase 3 ligand (Flt3L; 100 ng/ml), stem cell factor (SCF; 100 ng/ml), IL-3 (10 ng/ml), and IL-6 (10 ng/ml) in a humidified 5% CO2 incubator at 37°C. Nonadherent cells were collected, and adherent cells were removed with a cell-lifter after incubation in Versene (Gibco/BRL), washed, and blocked with 1 mg/ml human {gamma} globulin (Gamimune, Miles Inc., Elkhart, IN). Total viable cell count was determined by trypan blue exclusion. FITC-labeled anti-CD14 and anti-CD16 and phycoerythrin (PE)-labeled anti-CD34 were obtained from PharMingen. After dilution in PBS, cells were analyzed by FACSCaliber flow cytometer (Becton Dickinson).

Human peripheral blood monocyte cultures
Peripheral blood mononuclear cells (PBMCs) were isolated by endotoxin-free Ficoll PaqueTM PLUS centrifugation (Amersham Pharmacia Biotech, Little Chalfont, UK) from buffy coats obtained from healthy adult donors at the Center for Blood Research (Boston, MA) and followed by CD14 microbead (Miltenyi Biotec)-positive selection. The PBMCs were cultured at a cell concentrations of 1 x 106 cells/ml in RPMI-1640 medium (Gibco/BRL), supplemented with 10% HI fetal bovine serum (Sigma-Aldrich), 2-ME (Gibco/BRL), 2 mM L-glutamine, and 1 mM sodium pyruvate. Monocytes were cultured alone or in the presence of indicated concentration of rhCsf-1 (R&D Systems) and PK1-Fc or control-Fc. For fluorescein-activated cell sorter studies, cells were cultured for 7 days with 2.86 nM control-Fc, 2.86 nM PK1-Fc, 50 ng/ml Csf-1, or 2.86 nM PK1-Fc plus 50 ng/ml Csf-1. For LPS response assays, monocytes were grown for 6 days, stimulated with the same combination of cytokines in addition to 250 ng/ml LPS (Sigma-Aldrich) in fresh growth medium for an additional 24 h. Conditioned media were harvested, and the concentration of IL-6, IL-10, IL-12, and TNF-{alpha} was determined by enzyme-linked immunosorbent assay (ELISA; Endogen, Woburn, MA), according to the manufacturer’s instruction.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
PK1 binds to cells of the monocyte/macrophage lineage and activates through the GPCR PKR
PK1 protein was evaluated in 293 cells transfected with expression vectors carrying PK1 Fc-tagged fusion protein, AP-tagged fusion protein, or with a retroviral vector expressing the native protein. Media from transfected cells were collected and evaluated by Western blot for the presence of secreted protein (Fig. 1a ). In all instances, polyclonal rabbit anti-PK1 antibodies recognized native or tagged protein. In addition, PK1 could be detected in media of 3T3 cells infected with a retrovirus expressing native PK1 but not in control cells infected with an empty vector. Two closely related receptors (PKR1 and -2) for PK1 were recently identified as GPCR, which are activated with PK1 at nanomolar concentrations leading to calcium mobilization, turnover of phosphoinositide, and phosphorylation of p44/p42 MAPK [25 ]. To test protein activity, we stably transfected CHO cells with human PKR2 and evaluated calcium mobilization with increasing doses of PK1 (Fig. 1b) , which induced a dose-dependent activation with an effective dose in 50% of test subjects (half-maximal concentration) of 9.0 ± 1.2 nM but did not stimulate cells transfected with vector alone.



View larger version (35K):
[in this window]
[in a new window]
  		Figure 1. PK1 is secreted and induces signaling through PKR2. (a) Western blot analysis of rPK1-Fc and PK1-AP fusion proteins as well as supernatants from 293 cells and 3T3 cells using affinity-purified rabbit anti-PK1 polyclonal antibodies. (b) Dose-dependent curves of PKR2-mediated calcium mobilization in response to PK1. CHO cells were stably transfected with a vector expressing human PKR2 (•) or vector alone({blacksquare}). RFU, Relative fluorescent units.

 
To identify potential sites of action of PK1, mouse tissues sections were screened for binding sites using PK1-AP fusion proteins. AP was fused in-frame to the N terminus (AP-PK1) or the C terminus (PK1-AP). Binding of PK1-AP (as well as AP-PK1) was detected in scattered cells in bone marrow (data not shown) and in the red pulp of spleen (Fig. 2a ). AP by itself was used as control and did not bind to spleen and bone marrow. A PK1-Fc fusion protein could specifically inhibit the PK1-AP binding (data not shown). The morphology of cells bound by PK1 was reminiscent of cells of the monocyte/macrophage lineage. We therefore analyzed the binding of PK1 to isolated bone marrow-derived macrophages. PK1-AP, but not AP alone, bound to murine macrophages, cultured in vitro for 3 days in the presence of Csf-1 (Fig. 2a) . To confirm the presence of receptors in those cells, real-time PCR was performed. PKR2 and PKR1 (Fig. 2b) could be detected in mouse bone marrow, lymph node, and mature T cells. In addition, PKR2 could be detected in purified macrophages (spleen-derived CD11b+) and purified splenic B (B220) and T cells (CD4).



View larger version (49K):
[in this window]
[in a new window]
  		Figure 2. PK1 binds to murine myeloid cells. (a) Binding of PK1 to spleen cells and purified macrophages. Mouse spleen sections were incubated with PK1-AP or AP alone at a concentration of 2 nM. Bound protein was visualized by the purple precipitate developing in the presence of the AP substrate NBT/BCIP. Sections were counterstained with hematoxylin, and pictures were taken at a magnification of 100x or 400x, as indicated. PK1-AP but not AP binds to scattered cells in the red pulp of mouse spleen. Isolated bone marrow-derived macrophages were grown on coverslips and stained with PK1-AP or AP. Pictures were taken at 400x magnification. (b) PKR2 and PKR1, respectively, are expressed in murine myeloid cells. Relative expression of PKR in multiple mouse tissues by quantitative PCR of cDNA. Bone marrow, thymus, lymph node, and no template control (BM, Thy, LN, NTC, respectively) are abbreviated.

 
PK1 induces macrophage differentiation of mouse bone marrow
The results of the binding studies prompted us to analyze the effect of purified PK1 on mouse mononuclear bone marrow cells, which were cultured in the presence of PK1 or a control protein for 7 days. We observed the appearance of adherent cells in cultures treated with PK1 but not with control or culture medium alone. PK1-responsive, adherent cells showed a macrophage-like morphology in a May-Gruenwald-Giemsa stain (Fig. 3a ). Immunofluorescence analysis demonstrated that the adherent cell population was positive for Mac-1, a marker specific for the myeloid lineage, and F4/80, which is a marker specific for macrophages [31 , 32 ] (Fig. 3a) . Adherent cells were detached and pooled with nonadherent cells and analyzed for the expression of differentiation markers. The number of adherent and nonadherent cells was approximately twofold higher in cultures treated with PK1 than in cultures treated with control protein or medium only (data not shown). Flow cytometry analysis showed that nearly all of the cells in cultures treated with PK1 expressed F4/80 and Mac-1 (Fig. 3b) but not Gr-1, B220, CD3, CD11c, or CD40 (data not shown). Cells cultured in the presence of control protein were negative for F4/80 and showed only weak expression of Mac-1 (Fig. 3b) . These data demonstrate the differentiation of murine mononuclear bone marrow cells into macrophages in response to PK1. Dose-response studies showed that PK1 induced a maximal response at a concentration of 20 nM (data not shown). Heat inactivation of PK1 abolished the effect on differentiation, ruling out the possibility that the functional response elicited by PK1 is a result of endotoxin contamination in the protein preparation. In summary, the above data demonstrate that PK1 stimulates differentiation in the macrophage lineage.



View larger version (30K):
[in this window]
[in a new window]
  		Figure 3. PK1 induces differentiation of murine myeloid cells. (a) Adherent cells were observed in bone marrow cultures stimulated with PK1 (10 nM) for 7 days. Cells have a macrophage-like morphology in a May-Gruenwald-Giemsa stain and are positive for membrane-activated complex 1 (Mac-1) and F4/80 but negative for an isotype-matched, control antibody (Co-mAb) as shown by immunofluoresence staining. (b) Adherent cells were detached and pooled with nonadherent cells and analyzed by flow cytometry. Cells cultured with PK1 are positive for F4/80 and show stronger staining with Mac-1 when compared with cells cultured with a control protein (black line). Gray line indicates staining with isotype-matched, control mAb.

 
It is possible that the effects of macrophage differentiation induced by PK1 are mediated through stimulation of other cytokines. To address this possibility, we stimulated bone marrow cells with PK1 in the presence of blocking antisera to mouse Csf-1, GM-CSF, or IL-3. Using antisera concentrations that blocked the response elicited by the respective growth factor (data not shown), the same antisera concentration did not block the effect of PK1, suggesting that PK1 might act directly. This is also supported by the PK1-AP binding data showing PK1 binding to macrophages.

PK1 contributes to differentiation of human bone marrow CD34+ cells into the monocyte/macrophage lineage
In recent years, culture conditions have been developed that allow human bone marrow CD34+ progenitors to expand in vitro and to differentiate into antigen-presenting cells [33 , 34 ]. CD34+ human bone marrow cells were cultured in serum-free media in the presence of Flt-3L, SCF, IL-3, and IL-6 in the presence or absence of PK1, which increased the proportion of adherent cells in expanded human bone marrow CD34+ cell cultures in a dose-dependent manner (Fig. 4a ). The morphology of the adherent cells was suggestive of cells differentiating into the monocyte/macrophage lineage. Cells were assessed for stage of differentiation using CD34, an early hematopoietic progenitor marker [35 , 36 ], and CD14, which is expressed by cells that have differentiated into the monocyte/macrophage lineage [37 ]. The addition of PK1 greatly decreased the percentage of CD34+/CD14– cells and increased CD34–/CD14+ cells after 14 days of culture (Fig. 4b) , suggesting that PK1 acts to induce differentiation into the monocyte lineage. This effect was not evident in media alone with a control protein or with HI PK1 (Fig. 4b) . Although the total number of CD14+ cells increased in response to PK1, a large percentage of cells in culture was CD14– (77–80% in four experiments) and expressed CD33, a myeloid-specific marker (data not shown). Total cell number after 2 weeks in cultures containing PK1 increased 1.5- to 2.2-fold compared with media alone or compared with a control. The total number of CD34+ cells in culture dropped 10-fold, with a concomitant threefold increase in the number of CD14+ cells when cultured in the presence of 2.86 nM PK1 compared with a control (Fig. 4c) . This effect was seen in a dose-dependent manner in a range of 0.01–7.14 nM when cultured for a 2-week period (Fig. 4d) .



View larger version (68K):
[in this window]
[in a new window]
  		Figure 4. In vitro differentiation of human bone marrow progenitors. (a) Human bone marrow CD34+ cells grown in culture for 14 days in cytokines with varying doses of PK1 (0.01–7.14 nM) and then photographed using an inverted microscope. (b) Flow cytometric analysis of cells grown in the presence of a control protein, in PK1 protein, or in HI PK1 (boiled; 2.86 nM). (c) Total number of CD34+ cells and CD14+ cells found after 14 days in culture with a control protein (shaded bars) or PK1 protein (solid bars). Cultures were initiated with 2.0 x 104 adult bone marrow CD34+ cells. Values represent the mean ± SE of three cultures from two bone marrow donors. (d) CD34+ cells (4x103) were cultured in 24-well, flat-bottom, tissue-culture dishes in increasing doses of protein (0.01–7.14 nM) and analyzed by flow cytometry for cells expressing CD34. The results represent the mean of four cultures using two different bone marrow donors and show a tenfold decrease in percent CD34+ cells in the presence of 7.14 nM PK1 (P<0.01).

 
PK1 causes morphological changes and alters cell-surface receptor expression in human peripheral blood monocytes
Evidence from human and mouse bone marrow cultures as well as binding studies indicated that cells of the monocyte/macrophage lineage differentiate in response to PK1 in vitro. To test this directly, monocytes were purified from human peripheral blood and exposed to PK1 alone or in combination with Csf-1 for 7 days. Figure 5 shows representative results from one of three experiments. PK1 altered monocyte morphology when analyzed by light microscope or by light scatter using flow cytometry. Cells cultured in Csf-1 alone were spindle-shaped and had elevated FSC when compared with PK-1, which had lower FSC, were round, and appeared firmly attached to the culture dish. Addition of PK1 to Csf-1 also altered monocyte morphology, inducing cobblestone-like cells, decreasing FSC and increasing SSC, suggesting PK1 induces a different cellular phenotype than Csf-1. Human immune cells were tested for expression of the receptors for PK1. Similar to the mouse receptors for PK1, PKR2 and PKR1 (Fig. 5b) could be detected in peripheral blood B cells (CD19), monocytes (CD14), and immune tissues. In addition, PK1 expression could be detected in T cells, B cells, monocytes, and in inflamed human tissues (Fig. 5c) .



View larger version (34K):
[in this window]
[in a new window]
  		Figure 5. PK1 stimulates morphological changes in human peripheral blood monocytes. (a) Cells expressing CD14 were isolated from human peripheral blood using magnetic beads and then cultured in the presence of a control protein, PK1 protein (2.86 nM), Csf-1 (25 ng/ml), and PK1 plus Csf-1, as indicated. After 7 days, cultures were photographed using an inverted microscope, and cells were harvested and analyzed by flow cytometry to evaluate morphology. Fields representative of the entire culture were selected. SSC, Side-scatter; FSC, forward-scatter. (b) PKR2, PKR1, and PK1 (c) are expressed in human immune cells. RNA was isolated from human tissue and from human peripheral blood, which was fractionated using magnetic beads selective for T cells (CD4- and CD8-positive), B cells (CD19-positive), and monocytes (CD14-positive). RNA was extracted from cells, and relative expression of PKR was evaluated by quantitative PCR of cDNA. Lymph node (LN), no template control (NTC), fibroblast-like synoviocytes (FLS), normal human bronchial epithelium (NHBE), human microvascular endothelial cells (HMVEC), synoviocytes (syn), rheumatoid arthritis (RA), and inflammatory bowel disease (IBD) are abbreviated.

 
Monocyte activity and maturation status can be assessed by cell-surface expression of costimulatory molecules, chemokine receptors, LPS receptors, Fc receptors, and class II human leukocyte antigen. We analyzed monocytes for expression of costimulatory molecules B7-1 (CD80) and B7-2 (CD86), chemokine receptors CC chemokine receptor 5 (CCR5) and CXC chemokine receptor 4 (CXCR4), and LPS receptor CD14. Expression of CD14, B7-1, CCR5, and CXCR4 was down-regulated on PK1-treated monocytes when compared with monocytes treated with a control or Csf-1 (Fig. 6 ). Whereas only a small percentage of control or Csf-1-treated monocytes was double-negative for CD14/B7-1, CD14/CCR5, or CD14/CXCR4, more than 60% of PK1-treated monocytes lacked expression of these marker pairs. It is interesting that B7-2 expression was maintained or elevated on monocytes exposed to PK1. Simultaneous stimulation of monocytes with PK1 and Csf-1 resulted in an expression profile similar to treatment with PK1 alone. These data show that PK1 induces a distinct cell-surface protein expression profile on monocytes, which has an alternative effect to Csf-1.



View larger version (53K):
[in this window]
[in a new window]
  		Figure 6. PK1 alters cell-surface receptor expression human peripheral blood monocytes. CD14 cells were isolated from human peripheral blood and cultured in the presence of a control protein, PK1 protein (2.86 nM), Csf-1 (25 ng/ml), and PK1 plus Csf-1, as indicated. After 7 days, cells were collected and stained with antibodies using PE-conjugated B7-1 (CD80), B7-2 (CD86), CCR5, and CXCR4, in combination with FITC-conjugated CD14 and analyzed by flow cytometry for expression. Live cells were gated using propidium iodide. Data show expression of CD14 versus B7-1, B7-2, CCR5, and CXCR4.

 
PK1 primes peripheral blood monocytes to express TNF-{alpha} and IL-12 and down-regulates IL-10 in response to LPS
The results above indicated that monocytes exposed in vitro to PK1 may be functionally distinct. To test this possibility, monocytes were cultured in Csf-1, PK1, or Csf-1 and PK1 and assayed for cytokine production in response to 24 h stimulation with LPS. Figure 7 shows a representative result from three experiments using peripheral blood monocytes from different donors and assaying for cytokine production, with and without LPS stimulation. In the absence of LPS stimulation, all culture conditions produced roughly equivalent amounts of TNF-{alpha}, IL-10, and IL-12. Stimulation of Csf-1-treated monocyte cultures with LPS resulted in up-regulation of IL-10 production (1300–2050 ng/ml) compared with cultures grown in PK1 (100–1550 ng/ml) or PK1 plus Csf-1 (0–150 ng/ml). In contrast, TNF production was only moderately affected in Csf-1 cultures (150–500 ng/ml) compared with PK1 cultures (1250–2800 ng/ml) and cultures grown in PK1 plus Csf-1 (1600–3050 ng/ml). Similarly, IL-12 production was increased moderately in Csf-1 cultures (345–790 ng/ml) but was highly elevated PK1 plus Csf-1 (1850–2800 ng/ml). In all cases, Csf-1 and PK1 had little effect on cytokine production in unstimulated cultures. Monocyte cultures treated with PK1 showed a different cytokine profile in response to LPS. Production of TNF-{alpha} and IL-12 is up-regulated, whereas IL-10 production is only weakly affected. These results are reminiscent of the effects of IFN-{gamma} in up-regulation of IL-12 secretion and in suppression of IL-10 in monocyte-derived cells [11 ] and implicate PK1 as a potential controller of innate and adaptive immune response.



View larger version (12K):
[in this window]
[in a new window]
  		Figure 7. PK1 up-regulates TNF-{alpha} and IL-12 production and down-regulates IL-10 production in response to LPS. CD14 cells were isolated from human peripheral blood and cultured in the presence of a PK1 protein (2.86 nM), Csf-1 (25 ng/ml), and PK1 plus Csf-1, as indicated. After 6 days, media were changed, with or without the addition of 250 ng/ml LPS (LPS and Media, respectively). Twenty-four hours later, culture supernatant was collected and assayed in triplicate using anti-human cytokine-specific ELISA for TNF-{alpha}, IL-10, and IL-12. Cytokine levels were determined by comparison with a standard curve. Results are representative of three separate experiments using monocytes from different donors.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Our results show that PK1 is a newly discovered, secreted protein that alters monocyte differentiation and function. Hematopoietic stem cells and progenitors undergo proliferation and differentiation into myeloid-committed cells in the adult bone marrow prior to entering the circulation [1 ]. Circulating monocytes then differentiate into tissue-specific macrophages, where they are available to respond to pathogens. Multiple cytokines are involved in different stages of monocyte/macrophage commitment and proliferation. The primary cytokines known to be involved in differentiation from progenitors to the macrophage lineage are IL-3, GM-CSF, and Csf-1. Although IL-3 and GM-CSF affect multiple myeloid cell types, the primary action of Csf-1 is in macrophage differentiation and proliferation [3 , 4 ]. However, some macrophage populations are not dependent on Csf-1 for development and maintenance [38 39 40 ].

It was shown recently that PK1 and PK2 enhanced the growth of granulocytic and monocytic colonies in vitro when used in combination with IL-3 and IL-6 [26 ]. We found the effect of PK1 on proliferation in mouse and human bone marrow cells in vitro was minimal, but the effect on differentiation into the monocyte/macrophage lineage was dramatic. PK1 increased expression of Mac-1 and F480 in mouse bone marrow cultures, and human bone marrow progenitor cells responded with loss of CD34+ cells and an increase in CD14+ cells.

Human peripheral blood monocytes down-regulated costimulatory molecule B7-1 (CD80), chemokine receptors CCR5 and CXCR4, and LPS receptor CD14 in response to PK1 when compared with CSF-1-treated cells but maintained expression of costimulatory molecule B7-2 (CD86), suggesting that monocytes exposed to PK1 may be functionally distinct. PK1, although not affecting steady-state production of TNF-{alpha}, IL-12, and IL-10, had a significant impact on expression of these cytokines in response to LPS. PK1 suppressed IL-10 production but induced a significant increase in production of TNF-{alpha} and IL-12, which is a potent inducer of a Th1-specific response, and IL-10 is known to inhibit IL-12 production and lessen the T cell response to IL-12. This observation was surprising considering that the LPS receptor CD14 is down-regulated in more than 50% of monocytes in response to PK1. It may be that expression of other LPS receptors, such as Toll-like receptors 2, which trigger IL-12 expression [41 ], may be maintained in PK1-treated monocytes. These data seem to indicate that PK1 primes monocytes by enhancing a proinflammatory response to pathogens geared toward Th1-specific Th cell production.

These observations are interesting in the context of where PK1 is expressed. PK1 has constitutive expression in the gonad and adrenal glands [22 , 23 ]. We have shown that PK1 expression can also be found in human B cells, T cells, and in inflamed tissues. Binding studies to mouse tissue sections using a PK1-AP fusion protein showed specific binding to mouse spleen and cultured macrophages. It is possible that the main site of PK1 action is on circulating immature monocytes and may act as a systemic regulator of myeloid development and/or monocyte-derived cell response. Expression of PK1 in inflamed tissues suggests it may be modifying macrophage function locally. However, at present, it is unknown to what extent PK1 plays a role as a circulating hormone in controlling monocytes in vivo or if inhibiting it will have a beneficial effect in inflammatory disease. It is interesting that it has been shown that PK2 is expressed by DC, monocytes, and neutrophils and at sites of inflammation [26 ]. In addition, the receptors PKR1 and PKR2 are expressed on leukocytes. Our results provide evidence that PK1 and PK2 and their receptors may be involved in regulating an immune response by altering monocyte differentiation and activation.

Received February 1, 2005; revised April 19, 2005; accepted April 26, 2005.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Faller, D. V., Mentzer, S. J. (2000) Monocyte and macrophage development and function Hoffman, R. Benz, E. J. Shattil, S. J. Furie, B. Cohen, H. J. Silberstein, L. E. McGlave, P. eds. Hematology, Basic Principles and Practice ,686-701 Churchill Livingstone New York, NY.
  2. Metcalf, D. (1998) Cell-cell signaling in the regulation of blood cell formation and function Immunol. Cell Biol. 76,441-447[Medline]
  3. Roth, P., Stanley, E. R. (1992) The biology of CSF-1 and its receptor Curr. Top. Microbiol. Immunol. 181,141-167[Medline]
  4. Cecchini, M. G., Hofstetter, W., Halasy, J., Wetterwald, A., Felix, R. (1997) Role of CSF-1 in bone and bone marrow development Mol. Reprod. Dev. 46,75-83[CrossRef][Medline]
  5. Meuret, G., Hoffmann, G. (1973) Monocyte kinetic studies in normal and disease states Br. J. Haematol. 24,275-285[Medline]
  6. Meuret, G., Detel, U., Kilz, H. P., Senn, H. J., van Lessen, H. (1975) Human monocytopoiesis in acute and chronic inflammation Acta Haematol. 54,328-335[Medline]
  7. Banchereau, J., Steinman, R. M. (1998) Dendritic cells and the control of immunity Nature 392,245-252[CrossRef][Medline]
  8. Delves, P. J., Roitt, I. M. (2000) The immune system. First of two parts N. Engl. J. Med. 343,37-49[Free Full Text]
  9. Moser, M., Murphy, K. M. (2000) Dendritic cell regulation of TH1-TH2 development Nat. Immunol. 1,199-205[CrossRef][Medline]
  10. Sieling, P. A., Wang, X. H., Gately, M. K., Oliveros, J. L., McHugh, T., Barnes, P. F., Wolf, S. F., Golkar, L., Yamamura, M., Yogi, Y., et al (1994) IL-12 regulates T helper type 1 cytokine responses in human infectious disease J. Immunol. 153,3639-3647[Abstract]
  11. Libraty, D. H., Airan, L. E., Uyemura, K., Jullien, D., Spellberg, B., Rea, T. H., Modlin, R. L. (1997) Interferon-{gamma} differentially regulates interleukin-12 and interleukin-10 production in leprosy J. Clin. Invest. 99,336-341[Medline]
  12. Ma, X., Sun, J., Papasavvas, E., Riemann, H., Robertson, S., Marshall, J., Bailer, R. T., Moore, A., Donnelly, R. P., Trinchieri, G., Montaner, L. J. (2000) Inhibition of IL-12 production in human monocyte-derived macrophages by TNF J. Immunol. 164,1722-1729[Abstract/Free Full Text]
  13. Besedovsky, H., Sorkin, E. (1977) Network of immune-neuroendocrine interactions Clin. Exp. Immunol. 27,1-12[Medline]
  14. Blalock, J. E., Smith, E. M. (1980) Human leukocyte interferon: structural and biological relatedness to adrenocorticotropic hormone and endorphins Proc. Natl. Acad. Sci. USA 77,5972-5974[Abstract/Free Full Text]
  15. Rook, G. A., Hernandez-Pando, R., Lightman, S. L. (1994) Hormones, peripherally activated prohormones and regulation of the Th1/Th2 balance Immunol. Today 15,301-303[CrossRef][Medline]
  16. Blalock, J. E. (1994) The syntax of immune-neuroendocrine communication Immunol. Today 15,504-511[CrossRef][Medline]
  17. Savino, W., Dardenne, M. (1995) Immune-neuroendocrine interactions Immunol. Today 16,318-322[CrossRef][Medline]
  18. Wilckens, T., De Rijk, R. (1997) Glucocorticoids and immune function: unknown dimensions and new frontiers Immunol. Today 18,418-424[CrossRef][Medline]
  19. Blotta, M. H., DeKruyff, R. H., Umetsu, D. T. (1997) Corticosteroids inhibit IL-12 production in human monocytes and enhance their capacity to induce IL-4 synthesis in CD4+ lymphocytes J. Immunol. 158,5589-5595[Abstract]
  20. DeKruyff, R. H., Fang, Y., Umetsu, D. T. (1998) Corticosteroids enhance the capacity of macrophages to induce Th2 cytokine synthesis in CD4+ lymphocytes by inhibiting IL-12 production J. Immunol. 160,2231-2237[Abstract/Free Full Text]
  21. Vieira, P. L., Kalinski, P., Wierenga, E. A., Kapsenberg, M. L., de Jong, E. C. (1998) Glucocorticoids inhibit bioactive IL-12p70 production by in vitro-generated human dendritic cells without affecting their T cell stimulatory potential J. Immunol. 161,5245-5251[Abstract/Free Full Text]
  22. Li, M., Bullock, C. M., Knauer, D. J., Ehlert, F. J., Zhou, Q. Y. (2001) Identification of two prokineticin cDNAs: recombinant proteins potently contract gastrointestinal smooth muscle Mol. Pharmacol. 59,692-698[Abstract/Free Full Text]
  23. LeCouter, J., Kowalski, J., Foster, J., Hass, P., Zhang, Z., Dillard-Telm, L., Frantz, G., Rangell, L., DeGuzman, L., Keller, G. A., Peale, F., Gurney, A., Hillan, K. J., Ferrara, N. (2001) Identification of an angiogenic mitogen selective for endocrine gland endothelium Nature 412,877-884[CrossRef][Medline]
  24. Lin, R., LeCouter, J., Kowalski, J., Ferrara, N. (2002) Characterization of endocrine gland-derived vascular endothelial growth factor signaling in adrenal cortex capillary endothelial cells J. Biol. Chem. 277,8724-8729[Abstract/Free Full Text]
  25. Lin, D. C., Bullock, C. M., Ehlert, F. J., Chen, J. L., Tian, H., Zhou, Q. Y. (2002) Identification and molecular characterization of two closely related G protein-coupled receptors activated by prokineticins/endocrine gland vascular endothelial growth factor J. Biol. Chem. 277,19276-19280[Abstract/Free Full Text]
  26. LeCouter, J., Zlot, C., Tejada, M., Peale, F., Ferrara, N. (2004) Bv8 and endocrine gland-derived vascular endothelial growth factor stimulate hematopoiesis and hematopoietic cell mobilization Proc. Natl. Acad. Sci. USA 101,16813-16818[Abstract/Free Full Text]
  27. Cheng, H. J., Flanagan, J. G. (1994) Identification and cloning of ELF-1, a developmentally expressed ligand for the Mek4 and Sek receptor tyrosine kinases Cell 79,157-168[CrossRef][Medline]
  28. Hirsch, S., Austyn, J. M., Gordon, S. (1981) Expression of the macrophage-specific antigen F4/80 during differentiation of mouse bone marrow cells in culture J. Exp. Med. 154,713-725[Abstract/Free Full Text]
  29. Kingsbury, G. A., Feeney, L. A., Nong, Y., Calandra, S. A., Murphy, C. J., Corcoran, J. M., Wang, Y., Prabhu Das, M. R., Busfield, S. J., Fraser, C. C., Villeval, J. L. (2001) Cloning, expression, and function of BLAME, a novel member of the CD2 family J. Immunol. 166,5675-5680[Abstract/Free Full Text]
  30. Moore, R. N., Rouse, B. T. (1983) Enhanced responsiveness of committed macrophage precursors to macrophage-type colony-stimulating factor (CSF-1) induced in vitro by interferons {alpha} + ß 1 J. Immunol. 131,2374-2378[Abstract]
  31. Ho, M. K., Springer, T. A. (1982) Mac-1 antigen: quantitative expression in macrophage populations and tissues, and immunofluorescent localization in spleen J. Immunol. 128,2281-2286[Medline]
  32. Austyn, J. M., Gordon, S. (1981) F4/80, a monoclonal antibody directed specifically against the mouse macrophage Eur. J. Immunol. 11,805-815[Medline]
  33. Zandstra, P. W., Conneally, E., Petzer, A. L., Piret, J. M., Eaves, C. J. (1997) Cytokine manipulation of primitive human hematopoietic cell self-renewal Proc. Natl. Acad. Sci. USA 94,4698-4703[Abstract/Free Full Text]
  34. Bhatia, M., Bonnet, D., Kapp, U., Wang, J. C., Murdoch, B., Dick, J. E. (1997) Quantitative analysis reveals expansion of human hematopoietic repopulating cells after short-term ex vivo culture J. Exp. Med. 186,619-624[Abstract/Free Full Text]
  35. Baines, P., Mayani, H., Bains, M., Fisher, J., Hoy, T., Jacobs, A. (1988) Enrichment of CD34 (My10)-positive myeloid and erythroid progenitors from human marrow and their growth in cultures supplemented with recombinant human granulocyte-macrophage colony-stimulating factor Exp. Hematol. 16,785-789[Medline]
  36. Berenson, R. J., Andrews, R. G., Bensinger, W. I., Kalamasz, D., Knitter, G., Buckner, C. D., Bernstein, I. D. (1988) Antigen CD34+ marrow cells engraft lethally irradiated baboons J. Clin. Invest. 81,951-955
  37. Ziegler-Heitbrock, H. W. (1996) Heterogeneity of human blood monocytes: the CD14+ CD16+ subpopulation Immunol. Today 17,424-428[CrossRef][Medline]
  38. Cecchini, M. G., Dominguez, M. G., Mocci, S., Wetterwald, A., Felix, R., Fleisch, H., Chisholm, O., Hofstetter, W., Pollard, J. W., Stanley, E. R. (1994) Role of colony stimulating factor-1 in the establishment and regulation of tissue macrophages during postnatal development of the mouse Development 120,1357-1372[Abstract]
  39. Lieschke, G. J., Stanley, E., Grail, D., Hodgson, G., Sinickas, V., Gall, J. A., Sinclair, R. A., Dunn, A. R. (1994) Mice lacking both macrophage- and granulocyte-macrophage colony-stimulating factor have macrophages and coexistent osteopetrosis and severe lung disease Blood 84,27-35[Abstract/Free Full Text]
  40. Nilsson, S. K., Lieschke, G. J., Garcia-Wijnen, C. C., Williams, B., Tzelepis, D., Hodgson, G., Grail, D., Dunn, A. R., Bertoncello, I. (1995) Granulocyte-macrophage colony-stimulating factor is not responsible for the correction of hematopoietic deficiencies in the maturing op/op mouse Blood 86,66-72[Abstract/Free Full Text]
  41. Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D., Modlin, R. L. (2000) Activation of Toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10 J. Immunol. 165,3804-3810[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
F. C. Denison, S. Battersby, A. E. King, M. Szuber, and H. N. Jabbour
Prokineticin-1: A Novel Mediator of the Inflammatory Response in Third-Trimester Human Placenta
Endocrinology, July 1, 2008; 149(7): 3470 - 3477.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
A. Morales, S. Morimoto, L. Diaz, G. Robles, and V. Diaz-Sanchez
Endocrine gland-derived vascular endothelial growth factor in rat pancreas: genetic expression and testosterone regulation
J. Endocrinol., May 1, 2008; 197(2): 309 - 314.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
K. Urayama, C. Guilini, G. Turkeri, S. Takir, H. Kurose, N. Messaddeq, A. Dierich, and C. G. Nebigil
Prokineticin Receptor-1 Induces Neovascularization and Epicardial-Derived Progenitor Cell Differentiation
Arterioscler. Thromb. Vasc. Biol., May 1, 2008; 28(5): 841 - 849.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
F. Shojaei, M. Singh, J. D. Thompson, and N. Ferrara
Role of Bv8 in neutrophil-dependent angiogenesis in a transgenic model of cancer progression
PNAS, February 19, 2008; 105(7): 2640 - 2645.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
K. Urayama, C. Guilini, N. Messaddeq, K. Hu, M. Steenman, H. Kurose, G. Ert, and C. G. Nebigil
The prokineticin receptor-1 (GPR73) promotes cardiomyocyte survival and angiogenesis
FASEB J, September 1, 2007; 21(11): 2980 - 2993.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
T. Kisliouk, A. Friedman, E. Klipper, Q.-Y. Zhou, D. Schams, N. Alfaidy, and R. Meidan
Expression Pattern of Prokineticin 1 and Its Receptors in Bovine Ovaries During the Estrous Cycle: Involvement in Corpus Luteum Regression and Follicular Atresia
Biol Reprod, May 1, 2007; 76(5): 749 - 758.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Interv.Home page
Q.-Y. Zhou
The Prokineticins: A NOVEL PAIR OF REGULATORY PEPTIDES
Mol. Interv., December 1, 2006; 6(6): 330 - 338.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
E. E. McCandless, Q. Wang, B. M. Woerner, J. M. Harper, and R. S. Klein
CXCL12 Limits Inflammation by Localizing Mononuclear Infiltrates to the Perivascular Space during Experimental Autoimmune Encephalomyelitis
J. Immunol., December 1, 2006; 177(11): 8053 - 8064.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
L. Negri, R. Lattanzi, E. Giannini, M. Colucci, F. Margheriti, P. Melchiorri, V. Vellani, H. Tian, M. De Felice, and F. Porreca
Impaired nociception and inflammatory pain sensation in mice lacking the prokineticin receptor PKR1: focus on interaction between PKR1 and the capsaicin receptor TRPV1 in pain behavior.
J. Neurosci., June 21, 2006; 26(25): 6716 - 6727.
[Abstract] [Full Text] [PDF]

Home page
 Exp. Biol. Med.Home page
F. Nimura, L. F. Zhang, K. Okuma, R. Tanaka, H. Sunakawa, N. Yamamoto, and Y. Tanaka
Cross-linking cell surface chemokine receptors leads to isolation, activation, and differentiation of monocytes into potent dendritic cells.
Experimental Biology and Medicine, April 1, 2006; 231(4): 431 - 443.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0205061v1
78/2/426    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dorsch, M.
Right arrow Articles by Fraser, C. C.
Right arrow Search for Related Content
PubMed
Right arrow