science pharmaceutical expo biotech jobs
Originally published online as doi:10.1189/jlb.0105010 on April 7, 2005

Published online before print April 7, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0105010v1
78/1/85    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wilmanski, J.
Right arrow Articles by Spolarics, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilmanski, J.
Right arrow Articles by Spolarics, Z.
(Journal of Leukocyte Biology. 2005;78:85-94.)
© 2005 by Society for Leukocyte Biology

Augmented IL-10 production and redox-dependent signaling pathways in glucose-6-phosphate dehydrogenase-deficient mouse peritoneal macrophages

Jeanette Wilmanski*, Muhammad Siddiqi{dagger}, Edwin A. Deitch{dagger} and Zoltán Spolarics{dagger},1

* Graduate School of Biomedical Sciences and
{dagger} Department of Surgery, University of Medicine and Dentistry of New Jersey-New Jersey Medical School, Newark

1 Correspondence: Department of Surgery, UMDNJ-New Jersey Medical School, 185 South Orange Ave., MSB G-626, Newark, NJ 07103. E-mail: spolaric{at}umdnj.edu


arrow
ABSTRACT
 
Glucose-6-phosphate dehydrogenase (G6PD) supports cellular antioxidant pathways. G6PD deficiency is associated with malaria protection but was shown to worsen the clinical course to injury. This study tested whether G6PD deficiency manifests in altered cytokine responses using peritoneal macrophages from a G6PD-deficient mouse model with a degree of defect similar to the common type A human G6PD deficiency. Lipopolysaccharide (LPS)-induced interleukin (IL)-10 and IL-12 production was doubled in G6PD-deficient macrophages compared with wild-type (WT). Protein kinase C (PKC) activation by phorbol-ester prior to LPS resulted in a fivefold greater IL-10 production in G6PD-deficient macrophages compared with WT. Interferon-{gamma} treatment prior to LPS augmented IL-12 production in G6PD-deficient and WT macrophages and partially inhibited IL-10 production by G6PD-deficient macrophages. The antioxidants (N-acetyl-L-cysteine and glutathione ethyl-ester) blunted IL-10 and IL-12 production, indicating a role for oxidative stress in the observed response differences between deficient and WT macrophages. LPS-induced activation of nuclear factor-{kappa}B, cyclic adenosine monophosphate response element-binding protein, and specificity protein 3 was augmented in G6PD-deficient cells compared with WT. The PKC{delta} inhibitor Rottlerin inhibited IL-10 and IL-12 production at different 50% effective-dose concentrations between deficient and WT macrophages, indicating elevated PKC{delta} activity in deficient cells. This study reveals that activated G6PD-deficient macrophages display an augmented production of cytokines with a prominent impact on IL-10 production. The altered cytokine responses are associated with augmented activation of redox-dependent transcription factors and PKC{delta}. Alterations in signaling pathways and associated changes in cytokine production may play a role in modulating the inflammatory responses following bacterial or malarial infections in G6PD deficiency.

Key Words: cytokines • NF-{kappa}B • CREB • SP • protein kinase • porbol ester • interferon • cell signaling


arrow
INTRODUCTION
 
Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human genetic polymorphism, affecting over 400 million people worldwide [1 ]. The single-copy G6PD gene is located on the X chromosome in mammals, thus inheritance follows the X-linked pattern. G6PD primarily supports antioxidant pathways by the generation of reduced nicotinamide adenine dinucleotide phosphate (NADPH), which is consumed by the glutathione redox cycle and required for the stability of catalase [1 , 2 ]. G6PD is expressed in all cells of the body and is under tissue-specific regulation [1 , 3 ].

As G6PD deficiency provides some protection against malaria infection, the frequency of the defect may reach 10–25% in populations where malaria is common [1 , 4 ]. The African (type A–) variants, with 15% residual activity in red blood cells (RBCs), belong to the moderate (class III) deficiencies. Ten percent of African-American males carry the deficiency [5 ]. Whereas healthy type A– G6PD-deficient individuals have no clinical symptoms, the deficiency may present infection-, drug-, or Fava bean-induced, acute hemolysis, neonatal jaundice [1 , 6 ] and was shown to worsen the clinical course after major injuries [5 ].

The relationship between G6PD deficiency and cytokine modulation has not been investigated thoroughly despite the fact that this relationship may be important from several aspects. For example, it is well-accepted that cellular redox status is an important modulator of cytokine signaling pathways [7 8 9 10 11 ], and as G6PD plays a central role in the support of antioxidant pathways [2 , 12 ], it is plausible to suggest that the redox changes in G6PD deficiency may have an impact on cytokine production. Redox-dependent cytokine modulation is especially relevant during the innate immune response when activated white blood cells, endothelial cells, and tissue parenchyma are exposed to different degrees of oxidative stress. Additionally, as malaria infection results in changes in the production of pro- and anti-inflammatory cytokines including interleukin (IL)-12, IL-6, tumor necrosis factor {alpha} (TNF-{alpha}), and IL-10 [13 14 15 ], it is possible that alterations in cytokine production in G6PD-deficient cells may contribute to the modulation of the inflammatory response to malaria. There is indirect evidence from human studies indicating that in vivo- or ex vivo-induced cytokine responses may be altered by G6PD deficiency in support of this hypothesis. The hemozoin-induced IL-10 response was shown to be lower, whereas TNF-{alpha} production was similar in monocytes from individuals with the Mediterranean deficiency when compared with cells from nondeficient individuals [16 ]. We have previously demonstrated decreased blood IL-10 levels in severely injured G6PD-deficient (type A–) trauma patients on day 5 post-injury as compared with similarly injured, nondeficient patients [5 ]. Additionally, lipopolysaccharide (LPS)-induced ex vivo IL-10 production was also decreased in type A–-deficient, moderately injured trauma patients as compared with nondeficient controls [17 ]. Lastly, a bias in the allele frequencies of cytokine single nucleotide polymorphisms, including IL-6, interferon- {gamma} (IFN-{gamma}), and IL-10, has been shown in individuals from malaria-endemic regions [18 , 19 ]. Taken together, these in vivo and ex vivo human clinical observations suggest that cytokine responses may be altered in G6PD deficiency. However, no experimental evidence exists indicating a direct effect of G6PD deficiency on cytokine production or redox-dependent transcription factor activation in well-controlled, in vitro experimental systems.

Therefore, this investigation tested the hypothesis that G6PD deficiency alters macrophage cytokine responses. The study focused on a selected set of cytokines, including the proinflammatory cytokines IL-12, TNF-{alpha}, and IL-6, as well as the anti-inflammatory cytokine IL-10. We compared the responses of peritoneal macrophages obtained from G6PD-deficient animals and their wild-type (WT) littermates using a G6PD-deficient mouse model that displays a similar degree of G6PD deficiency to that observed in the common type A– human defect (10–15% of residual G6PD activity) [1 , 5 , 20 ]. As G6PD deficiency is expected to manifest phenotypic effects only upon functional challenges, cytokine responses were compared under different activation protocols using LPS stimulation alone and in combination with IFN-{gamma} administration or protein kinase C (PKC) activation. The role of oxidative or nitrosylative stresses was assessed by using antioxidants and nitric oxide (NO) inhibitors. We also tested the role of selected transcription factors and PKC in these responses.


arrow
MATERIALS AND METHODS
 
Reagents
Endotoxin-free, cell culture-grade buffers, media, and reagents were used. Enzyme-linked immunosorbent assay (ELISA) kits for murine IL-10, IL-12, TNF-{alpha}, and IL-6 were obtained from R&D Systems (Minneapolis, MN). Anti-nuclear factor (NF)-{kappa}B p65 and p50, cyclic adenosine monophosphate response element-binding protein (CREB), and specificity proteins 1 and 3 (Sp1 and Sp3) antibodies were purchased from Santa Cruz Biotechnology (CA) and N-acetyl cysteine (NAC), Rottlerin, and Gö6976 from Calbiochem (San Diego, CA). Reverse transcriptase-polymerase chain reaction (RT-PCR) kit was purchased from Roche (Nutley, NJ). TriReagent and formazol were purchased from Molecular Research Center (Cincinnati, OH). Gel shift assay reagents and lactate dehydrogenase (LDH) assay kit were purchased from Promega (Madison, WI). Phosphate-buffered saline (PBS) was purchased from Life Technologies (Grand Island, NY). Fetal bovine serum (FBS) was purchased from Irvine Scientific (Santa Ana, CA), protein assay kit from Pierce (Rockford, IL), and Brewer’s thioglycolate broth from Becton Dickinson (Sparks, MD). All other reagents and chemicals of the highest grade available were purchased from Sigma-Aldrich Co. (St. Louis, MO).

Animals and genotyping
Male G6PD-deficient (y/–) and normal (WT, y/+), 10- to 14-week-old mice were used in the experiments, as described in detail earlier [20 , 21 ]. Original breeding pairs of G6PD mutant mice were purchased from the Medical Research Council (MRC) of England (Frozen Embryo and Sperm Archive Mammalian Genetics Unit, MRC, Chilton). Initial breeding pairs were established in quarantine at Taconic Farms (Germantown, NY). Offspring were genotyped, and breeding colonies were established at Taconic Farms. Animals were shipped to our institute and housed in our animal facility under 12-h light/dark cycles. Animals were fed with standard rodent chow. The studies were performed in accordance with the Guide for the Care and Use of Laboratory Animals {Department of Health and Human Services Publication No. [National Institutes of Health (NIH)] 85–23, Revised 1985, Office of Science and Health Reports, Division of Research Resources/NIH (Bethesda, MD)} and were approved by the Institutional Animal Care and Use Committee of the New Jersey Medical School (Newark).

Animals used in the experiments were phenotyped by G6PD activity in whole blood using a kit from Sigma-Aldrich and genotyped by DNA analysis. The mutant G6PD variant was identified as described previously [20 ]. The particular mutation in the G6PD gene results in the disappearance of a DdeI restriction site in the mutant gene. Briefly, total genomic DNA was isolated from tail clippings, and the target gene was amplified with sense (GGAAACTGGCTGTGCGCTAC) and antisense (TCAGCTCCGGCTCTCTTCTG) primers. PCR was performed with a Perkin Elmer (Wellesley, MA) kit in a Perkin Elmer 2400 thermacycler. Samples were incubated in the presence or absence of DdeI. Products were visualized with ethidium bromide staining and polyacrylamide gel electrophoresis (PAGE), as we published previously [20 ].

Macrophage isolation and treatments
Peritoneal macrophages were isolated from male, G6PD-deficient (y/–) and normal (WT, y/+) littermates, as described previously. Briefly, mice were injected with 2.5 ml sterile Brewer’s thioglycolate broth intraperitoneally. On day 4, peritoneal cells were harvested, washed repeatedly (300 g for 15 min at 4°C), and resuspended in Dulbecco’s modified Eagle’s medium (DMEM) containing 20 mM HEPES, 4 mM glutamine, penicillin-streptomycin solution, and 10% FBS. Cells were seeded into Falcon six-well, tissue-culture plates (1.2x106 cells/well) and incubated at 37°C (95% air/5% CO2) to allow cells to adhere. Nonadherent cells were removed by washing with PBS, and the cells were re-fed with DMEM containing 1% FBS at 24 h and incubated in the presence of vehicle; LPS alone, 100 ng/ml; IFN-{gamma} (100 U/ml, 2 h preincubation) and then LPS, 100 ng/ml; and phorbol myristate acetate (PMA), 1 µM (20 min preincubation) and then LPS, 100 ng/ml. Antioxidants [NAC, 5 mM; glutathione (GSH) ethyl ester, 5 mM], NO inhibitor [L-N(G)-nitro-arginine methyl ester (L-NAME), 1 mM], or PKC inhibitors (Gö6976, 50 nM, or Rottlerin, 0.25–2.0 µM) were added 5–20 min prior to cell activation protocols. TNF-{alpha} and IL-6 production were measured at 6 h post-stimulation and IL-12 and IL-10 production at 24 h post-stimulation. All agents used in the experiments were dissolved in media as vehicle, unless otherwise stated. After various treatments, media were collected, and cytokine content was determined by ELISA, according to the manufacturer’s protocol. Standards were run on each ELISA plate and analyzed in parallel with the test samples. Values were normalized to cell protein content in individual wells to correct for small variations.

Analysis of NF-{kappa}B, CREB, and Sp1 and Sp3 activation by electrophoretic mobility shift assay (EMSA)
Nuclear extracts were prepared, as described previously with modifications [22 ]. Briefly, 3.6 x 106 cells were washed three times with PBS then resuspended in 400 µl ice-cold buffer lysis buffer [10 mmol HEPES (pH 8.0), 10 mmol/L KCl, 1 mmol/L MgCl2, 1 mmol/L phenylmethylsulfonyl fluoride, 0.5 mmol/L dithiothreitol (DTT), 1 mmol/L NaVO3, 5 µg/ml leupeptin, 1 µg/ml pepstatin, 5 µg/ml aprotinin, 0.5 mmol/L EDTA, 10 mmol/L sodium fluoride, and 20% glycerol]. The samples were left on ice for 30 min, and then 10% Nonidet P-40 was added, and samples were homogenized. The nuclei were sedimented by centrifugation at 4300 g for 5 min at 4°C. The supernatant was carefully removed, and the nuclei were lysed in 30 µl ice-cold buffer (same composition as the lysis buffer above, except that KCl was replaced with 420 mmol/L NaCl). The samples were kept at 4°C on a shaker for 30 min and then centrifuged at 16,000 g at 4°C for 10 min. The supernatants (nuclear extracts) were stored at 80°C until use.

The binding reaction (20 µl) contained 50 mM Tris-HCl (pH 7.5), 1 mM MgCl2, 1 mmol/L DTT, 20% glycerol, 2 µg poly(dI:dC), and 58.8 mmol/L KCl. The double-stranded NF-{kappa}B consensus oligonucleotide (5'-AGT TGA GGG GAC TTT CCC AGG C-3'), CREB consensus oligonucleotide (5'-AGA GAT TGC CTG ACG TCA GAG AGC TAG-3'), and Sp consensus oligonucleotide reacting with Sp1 and Sp3 (5'-ATT CGA TCG GGG CGG GGC GAG-3') probes were end-labeled with {gamma}-[32P] adenosine 5'-triphosphate 10 µCi at 222 TBq/mmol (Amersham, Arlington Heights, IL). Binding reactions, containing 35 fmoles oligonucleotide and 10 µg cellular protein, were carried out for 20 min at room temperature. To determine the specificity of binding, 100-fold molar excess of unlabeled probe was added before the administration of the radiolabeled probe. For supershift analyses, 2.5–5 µg each antibody was added to the reaction mixture and incubated for 30 min prior to the addition of the radiolabeled probe. Following the binding reactions, samples were subjected to nondenaturing 4% PAGE in low ionic-strength buffer (80 mM Tris-borate, 2 mM EDTA). Gels were vacuum-dried and signals quantified using the Phosphorimager SI analyzer and Imagequant v4.1 program (Molecular Dynamics, Sunnyvale, CA).

Analytical procedures
LDH activity in media was measured using the CytoTox 96® assay (Promega). Cellular LDH release was normalized to maximal LDH release in cells incubated in parallel with experimental samples. Maximal LDH release was determined by LDH activity in cell extracts disintegrated by sonication at the end of the incubations. NO production by macrophages was assessed by analysis of the conditioned media for nitrite plus nitrate content using the Griess reaction. Protein concentrations were determined by the bicinchoninic acid method using the protein assay kit (Pierce).

RNA determinations
Total cellular RNA was isolated using the TriReagent (Molecular Research Center), according to the manufacturer’s protocol, as described previously [22 ]. Deoxyoligonucleotide primers used for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and IL-10 determinations were synthesized in the Molecular Biology Core Laboratory of the University of Medicine and Dentistry of New Jersey (Newark). GAPDH expression controls were carried out throughout all the RT-PCR reactions. The sequences of the oligonucleotide primers used were as follows: GAPDH forward, 5'-GTC TTC ACC ACC ATG GAG AA-3'; reverse, 5'-ATC CAC AGT CTT CTG GGT GG-3'; for the real-time RT-PCR reactions, GAPDH forward, 5'-TGT GCA GTG CCA GCC TC-3'; reverse, 5'-CCC AAT ACG GCC AAA TCC-3'; IL-10 used in RT-PCR reactions forward, 5'-CGG GAA GAC AAT AAC TG-3'; reverse, 5'-CAT TTC CGA TAA GGC TTG G-3'; IL-10 used in real-time PCR reactions forward, 5'-AAG TGA TGC CCC AGG CA-3'; reverse, 5'-TCT CAC CCA GGG AAT TCA AA-3'.

RNA samples were subjected to RT followed by PCR amplification. The RT-PCR reactions were carried out using the GeneAmp, Thermostable RT RNA PCR kit (Roche, Branchburg, NJ). Following the RT step, Mn2+ was chelated and MgCl2 added for the amplification steps (2.0 mM) in the presence of deoxy-unspecified nucleoside 5'-triphosphate (dNTP) mixtures (2 mM each). Amplification was carried out in a Perkin Elmer GeneAmp 2400 instrument as follows: RT step 70°C 15 min and PCR 95°C 1 min, 95°C 10 s, and 60°C 15 s for 35 cycles, followed by 60°C 7 min. The reaction was terminated by cooling the mixture to 4°C. Aliquots of the reaction samples were subjected to PAGE.

Quantitative real-time PCR was performed in a GeneAmp 7700 sequence detection system SDS (Applied Biosystems, Foster City, CA), using SYBR Green (Applied Biosystems) as the detection format. Amplification was carried out in a total volume of 40 µl containing SYBR Green, PCR buffer [50 mM KCl, 20 mM Tris–HCl (pH 8.3), 2.5 mM MgCl2, 0.2% glycerol, and 0.2% dimethylsulfoxide], 0.2 mM each primer, 0.2 mM dNTPs, 1.25 U AmpliTaq DNA polymerase (Applied Biosystems), and serially diluted cDNA. The reactions were cycled 40 times under the following parameters: 50°C for 2 min, 95°C for 10 min, 95°C for 15 s, and 60°C for 1 min. A nontemplate control was run with every assay, and all determinations were performed in duplicate.

Statistical analysis
Statistical calculations were performed using JMP software (SAS Institute Inc., Cary, NC). Results were analyzed using ANOVA followed by t-test for pair-wise comparisons or Tukey-Kramer’s test for multiple comparisons. Statistically significant difference was concluded at P< 0.05.


arrow
RESULTS
 
Comparison of pro- and anti-inflammatory cytokine production between G6PD-deficient and WT macrophages
In the first series of experiments, we compared IL-10 and IL-12 production between peritoneal macrophages from deficient and WT animals following LPS treatment in the absence and presence of the coactivating signals IFN-{gamma} or PMA. Peritoneal macrophage cultures were incubated for 24 h and cytokine levels determined using ELISA. Figure 1A shows that LPS treatment alone resulted in a small but significant increase in IL-10 production in G6PD-deficient macrophages but not in cells from WT animals. PMA pretreatment (20 min) prior to LPS increased IL-10 production with a markedly greater effect (four- to sixfold) in G6PD-deficient rather than WT cells. PMA alone had no effect on IL-10 production in deficient or WT macrophages. IFN-{gamma} inhibited the PMA plus LPS-induced increase in IL-10 production by G6PD-deficient macrophages; however, IL-10 production remained greater in deficient rather than WT cells (Fig. 1A) .



View larger version (30K):
[in this window]
[in a new window]
 
Figure 1. Comparison of IL-10 and IL-12 production between G6PD-deficient and WT macrophages. (A and B) Cells from deficient (solid bars) or WT (open bars) animals were incubated in the absence or presence of PMA (106 M for 20 min) or IFN-{gamma} (100 U/ml for 2 h) followed by an additional 22-h incubation in the presence or absence of LPS (100 ng/ml) as indicated. At 24 h, media were collected, and IL-10 (A) and IL-12 (B) contents were determined. Mean ± SE from 12 independent cell preparations in each group (determined in duplicates). (C and D) Incubations were carried out using the combined treatments by PMA and LPS, but LPS administration was delayed to 60 min post-PMA, or the sequence of the administration was reversed as indicated on the figures. Mean ± SE from four independent cell preparations. Statistically significant differences: *, compared with WT in the same treatment group; &, compared with PMA + LPS in the deficient group; #, compared with LPS in corresponding groups.

Figure 1B indicates that the LPS-induced IL-12 response was approximately double in deficient macrophages rather than in cells from WT animals. IFN-{gamma} preincubation markedly and similarly increased LPS-induced IL-12 production in deficient and WT cells. PMA preincubation inhibited the LPS-induced IL-12 production in deficient and WT macrophages. However, PMA did not inhibit IFN-{gamma} plus LPS-induced IL-12 production significantly in deficient or WT cells (Fig. 1B) .

Experiments were also carried out to test whether delayed administration of LPS or reversal in the sequence of PMA and LPS administrations alters cytokine responses. Figure 1C shows that the augmented production of IL-10 by G6PD-deficient cells as compared with WT was maintained when LPS was administered at 60 min post-PMA, as well as when LPS was administered prior to PMA. However, there was a tendency for a lessened IL-10 response when LPS was administered later or when the sequence of PMA and LPS additions was reversed (Fig. 1C) . Determination of IL-12 in the same samples indicated a tendency of lessened PMA inhibition on the LPS-induced IL-12 response upon delayed administration of LPS or after reversal in treatment sequence (note the difference in the y-axis scale in Fig. 1B and 1D ). These observations indicated that PMA costimulus to LPS activation renders the IL-10/IL-12 balance toward the anti-inflammatory side in G6PD-deficient macrophages.

In contrast to the observations on IL-10 and IL-12, comparison of early, proinflammatory cytokine production showed only a slightly increased TNF-{alpha} production by deficient cells as compared with WT (Fig. 2 ). The small increase in IL-6 production by deficient cells compared with WT did not reach statistically significant levels. TNF-{alpha} and IL-6 responses were also similar in deficient and WT cells following the combined PMA plus LPS (Fig. 2) or IFN-{gamma} plus LPS treatments (data not shown).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 2. Comparison of TNF-{alpha} and IL-6 production between G6PD-deficient and WT macrophages. Cells were incubated in the absence or presence of PMA (106 M for 20 min) followed by incubation in the presence or absence of LPS (100 ng/ml) as indicated. At 6 h, media were collected, and TNF-{alpha} (A) and IL-6 (B) contents were determined. Mean ± SE from four to eight independent cell preparations in each group determined in duplicates. Statistically significant difference: *, compared with vehicle in corresponding groups; &, compared with WT in the same treatment group.

To determine whether the marked difference in IL-10 production between deficient and WT macrophages manifests in increased gene expression, steady-state IL-10 mRNA levels were determined. As IL-10 mRNA abundance is known to be low, even under induced conditions, we used semiquantitative RT-PCR as well as real-time RT-PCR in these determinations. Figure 3A shows that IL-10 mRNA in macrophages from WT animals was near or below detection limit even after the induced conditions. However, IL-10 mRNA was readily detectable following LPS in deficient macrophages, which was increased further following LPS plus PMA stimulation. The increase in IL-10 mRNA in deficient macrophages compared with WT was confirmed by quantitative real-time RT-PCR assays using a different set of primers for IL-10 and GAPDH (Fig. 3B) .



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. Comparison of IL-10 mRNA content between G6PD-deficient and WT macrophages. (A) Cells were incubated in the absence or presence of LPS or PMA followed by LPS. Six hours later, total cellular RNA was isolated and tested for IL-10 and GAPDH mRNA content. The last lane indicates a positive control for IL-10 mRNA derived from a murine B-1 lymphoma cell that constitutively expresses IL-10 [23 ], which runs parallel in the RT-PCR reactions and gel electrophoresis. Typical findings from four independent cell preparations with similar results are shown. (B) Findings of quantitative real-time RT-PCR determinations that used a different set of IL-10 and GAPDH primers.

The effect of antioxidants and NO inhibitors on cytokine production
To test the potential role of oxidative stress in the observed differences in cytokine responses, deficient and WT macrophages were incubated using the combined activation protocols in the presence or absence of the antioxidant NAC (Fig. 4 ), which partially inhibited PMA plus LPS-induced IL-10 response in G6PD-deficient cells. Under IFN-{gamma} plus LPS-stimulated conditions, IL-10 production was completely inhibited by NAC in deficient as well as WT cells (Fig. 4A) . The presence of NAC also completely inhibited the IFN-{gamma} plus LPS-induced IL-12 production in deficient and WT macrophages (Fig. 4B) . Results were similar when the same experiments were carried out using an alternative antioxidant, GSH ethyl-ester (data not shown).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. The effect of NAC on IL-10 and IL-12 production in G6PD-deficient and WT macrophages. Cells were incubated using the PMA plus LPS or IFN-{gamma} plus LPS protocols in the absence or presence of NAC (2 mM). Twenty-four hours later, IL-10 (A) and IL-12 (B) contents were determined in media. Mean ± SE from four independent cell preparations in each group determined in duplicates. Statistically significant difference: *, compared with WT in the same treatment group; &, compared with vehicle in corresponding groups.

Figure 5 depicts nitrite/nitrate and cytokine production in activated macrophages in the presence or absence of the NO synthase inhibitor L-NAME. Following stimulation by PMA plus LPS or IFN-{gamma} plus LPS, nitrite/nitrate production was similar in deficient and WT macrophages (Fig. 5A) . As expected, L-NAME inhibited nitrite/nitrate production by macrophages. The inhibitory effects of L-NAME were similar in deficient and WT cells (Fig. 5A) . Cytokine determinations from the same samples, however, revealed that inhibition of nitrite/nitrate production had no effects on IL-10 or IL-12 production in G6PD-deficient or WT macrophages (Fig. 5B and 5C) . The antioxidants or L-NAME used caused no cellular damage, as determined by measurement of LDH release in the same samples that were used for cytokine determinations (data not shown).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 5. The effect of L-NAME on IL-10 and IL-12 production in G6PD-deficient and WT macrophages. Cells were incubated using the PMA plus LPS or IFN-{gamma} plus LPS protocols in the absence or presence of L-NAME (1 mM). Twenty-four hours later, nitrite/nitrate (A), IL-10 (B), and IL-12 (C) contents were determined in media. Mean ± SE from four independent cell preparations in each group determined in duplicates. Statistically significant difference: *, compared with vehicle in corresponding groups; &, compared with WT in the same treatment group.

Comparison of transcription factor activation and the role of PKC{delta}
Because of the observed differences in cytokine production between deficient and WT cells following the LPS or LPS plus PMA treatments, we compared the activation of selected transcription factors after these activation protocols. Following a 4-h incubation, nuclear proteins were isolated and tested for NF-{kappa}B, CREB, and Sp1 and Sp3 content using EMSAs (Fig. 6 ). Nuclear content of NF-{kappa}B, CREB, and SP3 was greater in LPS-stimulated, G6PD-deficient rather than WT macrophages (Fig. 6 , bar graphs). PMA treatment prior to LPS administration inhibited the LPS-induced increase in NF-{kappa}B, CREB, and SP3 content in deficient cells (Fig. 6 , bar graphs). Preincubation of nuclear extracts with antibodies against the p50 and p65 subunits of the NF-{kappa}B complex, individually or in a mixture, resulted in supershifts (Fig. 6C) . Preincubation of nuclear extracts with antibodies against CREB or SP3 also resulted in supershifts (Fig. 6F and 6I) , confirming the identity of these transcription factors.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 6. Activation of transcription factors in G6PD-deficient macrophages. Cells were incubated in the absence or presence of LPS or PMA followed by LPS. Four hours later, nuclear proteins were isolated and tested for NF-{kappa}B, CREB, and SP binding using consensus oligos and EMSA as described in Materials and Methods. HeLa nuclear extracts run parallel with cell extracts were used as positive controls. Graph bars (A, D, and G) indicate summary from six to eight independent cell preparations, mean ± SE. Middle panels (B, E, and H) depict typical findings. Gels on the right (C, F, and I) depict findings after incubation of nuclear extracts from LPS-stimulated, G6PD-deficient macrophages in the presence of specific antibodies against the p50 and/or p65 NF-{kappa}B subunits or antibodies against CREB, SP1, or SP3 transcription factors as indicated. Statistically significant difference: *, compared with vehicle; &, compared with LPS.

As PKC{delta} has been shown to play an important role in the signaling pathways of IL-10 and IL-12 production, we used the specific PKC{delta} inhibitor, Rottlerin, to determine whether PKC{delta} contributes to the augmented IL-10 and IL-12 production by deficient cells compared with WT when stimulated with LPS alone or in combination with PMA or IFN-{gamma} (Fig. 7 ). In G6PD-deficient cells, Rottlerin inhibited LPS-induced IL-10 production in a dose-dependent manner with a 50% effective-dose (ED50) <0.25 µM (Fig. 7A) . (The variability observed on WT macrophages is related to the fact that LPS alone causes minimal increase in IL-10.) As expected, under PMA + LPS-stimulated conditions, Rottlerin dose-response curve of IL-10 inhibition shifted to the right (ED50 ~1.5 µM), and the inhibitory response was similar in G6PD-deficient and WT macrophages (Fig. 7B) . Rottlerin also inhibited IL-12 production under LPS alone and LPS + IFN-{gamma}-induced conditions in deficient and WT cells. However, the inhibitory curve showed a right-shift under LPS (Fig. 7C) as well as LPS + IFN-{gamma}-induced (Fig. 7D) conditions in G6PD-deficient cells as compared with WT. Gö6976 (50 nM), an inhibitor of conventional Ca2+-dependent PKC isoforms, had no inhibitory effects on IL-10 or IL-12 production in G6PD-deficient and WT macrophages (data not shown). These observations indicate that under LPS-induced conditions, the increased production of IL-10 and IL-12 by G6PD-deficient macrophages is associated with elevated, cellular PKC{delta} activity. Rottlerin or Gö6976, in the concentrations used, caused no cellular damage, as assessed by LDH release in the same samples that were used for cytokine determinations (data not shown).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 7. The role of PKC{delta} in IL-10 and IL-12 production by G6PD-deficient and WT macrophages. Cells were incubated using the LPS alone, PMA plus LPS, or IFN-{gamma} plus LPS protocols in the absence or presence of PKC{delta} inhibitor Rottlerin (0.25–2 µM) as indicated. Twenty-four hours later, IL-10 (A, B) and IL-12 (C, D) contents were determined in media. Mean ± SE from four to eight independent determinations in each group. Lack of error bars indicates that SE is within the size of the symbol. Statistically significant difference: *, compared with WT; &, compared with absence of Rottlerin in corresponding groups.


arrow
DISCUSSION
 
This study demonstrates for the first time that G6PD-deficient macrophages display augmented production of proinflammatory as well as anti-inflammatory cytokines in response to stimulatory signals. Dependent on the activation status of cells, G6PD-deficient macrophages present markedly up-regulated IL-10 production compared with WT. The prominently increased IL-10 production by G6PD-deficient cells is accompanied by a relatively modest increase in early (TNF-{alpha} and IL-6) and late (IL-12) proinflammatory cytokine production, indicating a shift toward the anti-inflammatory potential in G6PD-deficient macrophages. The augmented cytokine production is associated with increased cellular levels of selected redox-dependent signaling factors, NF-{kappa}B, Sp3, CREB, and PKC{delta} in G6PD-deficient cells. The observed cytokine response differences between deficient and WT macrophages may be related to cellular redox status, but they are independent of nitrosylative stress. These observations, together with earlier clinical observations in the human type A– deficiencies, indicate that G6PD deficiency modulates cytokine responses with the foremost impact on IL-10 metabolism. The potential in vivo significance of these findings is supported by a recent study indicating elevated blood IL-10 content in G6PD-deficient animals compared with WT following a polymicrobial peritonitis challenge in vivo [24 ].

The study used a mouse model that displays the same degree of G6PD deficiency (~10% of normal) as presented in the most common form (type A–), human G6PD deficiency [5 , 20 ]. This mouse model has been used by us and others in studies demonstrating the effect of G6PD deficiency on vascular endothelial growth factor-dependent angiogenesis [25 ], ischemia-reperfusion injury in the heart [26 ], teratogenesis [27 ], and sepsis-induced RBC dysfunction [20 ]. The G6PD-deficient animals, or cells derived from these animals, did not display phenotypic differences from WT under normal, unchallenged conditions, similar to those observed in the human deficiency. However, following functional or pathological challenges, the deficiency manifest altered cellular responses [1 , 20 ]. LPS stimulus alone revealed only small differences, indicating an increase in pro- and anti-inflammatory cytokine productions in G6PD-deficient macrophages compared with WT. However, marked differences were manifested between deficient and WT cells when LPS stimulus was combined with additional response modifiers.

PKC activation by PMA resulted in dichotomic effects on the proinflammatory IL-12 and anti-inflammatory IL-10 production. This is evident from the fact that PMA inhibited LPS-induced IL-12 and simultaneously increased IL-10 production (Fig. 1A and 1B) . This dichotomy of PKC activation is further supported by the observation that delayed administration of LPS after PMA (or reversal in the sequence of LPS and PMA) resulted in a lessening tendency of the contrasting effects on stimulating IL-10 and inhibiting IL-12 (refer to Fig. 1C and 1D ). These observations suggest that protein kinase activation represents a "regulatory switch", promoting anti-inflammatory cytokine production with simultaneous down-regulation of the proinflammatory IL-12 in LPS-activated macrophages. The effect of PKC activation causing an increase in IL-10 and a decrease in IL-12 production is in contrast to the effects of IFN-{gamma}, which resulted in decreased IL-10 and increased IL-12 production in LPS-stimulated cells (Fig. 1C and 1D) . However, under the IFN-{gamma}-stimulated conditions, G6PD-deficient cells still displayed an elevated production of IL-10 as compared with WT. This indicates that the increased anti-inflammatory potential of G6PD-deficient cells is retained even in the presence of a counteracting, physiologically relevant, proinflammatory signal.

PKC activation by PMA stimulates the oxidative burst in phagocytes, suggesting that redox alterations and PKC-dependent signaling pathways may play a role in regulating IL-10 production. The role of oxidative stress in the activation of protein kinases has been described [28 29 30 31 ]. It is well known that the diacylglycerol mimic, PMA, results in the activation of the conventional (Ca2+-dependent, {alpha}, ß, and {gamma}) as well as the novel (Ca2+-independent, {delta}, {varepsilon}, {eta}, and {theta}) PKC isoforms [28 , 32 ]. Our observation using PKC inhibitors revealed that the specific PKC{delta} inhibitor Rottlerin caused marked inhibitory effects on IL-10 production, whereas Gö6976, an inhibitor of the conventional Ca2+-dependent PKC isoforms, was ineffective in inhibiting cytokine production. This indicates an important regulatory role of PKC{delta} in the observed IL-10 responses. It is also evident that the LPS-induced IL-12 production was dependent on PKC{delta} activity, as demonstrated by the inhibitory effects of Rottlerin on IL-12 release. However, Rottlerin was more efficient in inhibiting IL-10 than IL-12 production in G6PD-deficient compared with WT macrophages. This is reflected in the fact that the ED50 for IL-10 inhibition was ~0.25 µM, whereas the ED50 for IL-12 inhibition was ~1 µM in LPS-stimulated, deficient cells. Additionally, the right shift of the Rottlerin-inhibitory curve on the LPS or LPS + IFN-{gamma}-induced IL-12 production in the deficient cells further supports the conclusion that PKC{delta} activity is increased in G6PD-deficient cells compared with WT (refer to Fig. 7 ).

Our data also showed that PMA treatment in the absence of LPS was unable to exert these responses, indicating that PKC activation alone is not sufficient to up-regulate IL-10 production in these cells. The observation that the PMA plus LPS combination was effective when administration of PMA was delayed or reversed is also important from the perspective that the differences in IL-10 production between deficient and WT cells are not restricted to a narrow window of PKC activation. These observations may have importance in the broader context of sepsis and endotoxemia, as PKC activation in macrophages occurs in a variety of conditions, including cell migration or attachment, as well as in response to cytokines, bacterial products, and hormones [33 ].

The role of other PKC isoforms, including the conventional isoforms, in dissociating TNF-{alpha} and IL-10 responses has been demonstrated in other experimental systems including human monocytes and alveolar macrophages as well as murine macrophages [34 35 36 37 ]. It is evident from these studies that the role of particular PKC isoforms in regulating IL-10 production is dependent on the activating signals, status of inflammation, and the type of infectious challenge. Nevertheless, these investigations suggest a critical role of protein kinases in regulating the pro/anti-inflammatory cytokine balance in activated macrophages.

Sp1, Sp3, and CREB were shown to play important roles in the regulation of IL-10 and IL-12 production in a variety of experimental models [38 39 40 41 42 ]. NF-{kappa}B plays an important role in the regulation of IL-12, IL-6, and TNF-{alpha} synthesis [39 , 43 , 44 ], whereas the IL-10 promoter is believed to have no functional NF-{kappa}B binding sites. Furthermore, cellular redox alterations have been shown to be involved in the activation of Sp1 and Sp3, CREB, and NF-{kappa}B, with consequent increases in TNF-{alpha}, IL-6, IL-10, and IL-12 production [7 8 9 , 45 , 46 ]. Our observations indicating elevated nuclear contents of Sp3, CREB, and NF-{kappa}B are consistent with the increased production of IL-12 and TNF-{alpha} in LPS-stimulated, G6PD-deficient cells compared with WT. Additionally, the PMA-induced inhibition of the LPS-induced activation of Sp3, CREB, and NF-{kappa}B is in agreement with the decrease in IL-12 production under this condition (Fig. 1B) . However, it is evident that the observed down-regulation of Sp3 and CREB after the combined PMA + LPS challenge cannot account for the augmentation of IL-10 expression in G6PD-deficient macrophages. Collectively, these observations indicate that augmented activation of redox-dependent transcription factors may play a role in the increased proinflammatory cytokine production in LPS-stimulated, G6PD-deficient cells. However, it remains to be determined which transcription factors are responsible for the marked increase in IL-10 expression following LPS combined with PKC{delta} activation in G6PD-deficient cells.

Our observations indicating that the antioxidant NAC or the GSH donor ethyl ester inhibits cytokine release by activated macrophages support the role of oxidative stress in these responses. The fact that NAC treatment completely inhibited IL-12 production in deficient and WT cells, whereas IL-10 inhibition was only partial in G6PD-deficient macrophages following PMA + LPS further supports the conclusion that increased oxidative stress plays a role in augmenting IL-10 production in deficient cells. In contrast to the findings using antioxidants, inhibition of NO production did not alter IL-12 and IL-10 responses in these cells. Furthermore, nitrite/nitrate production was similar in activated G6PD-deficient and WT macrophages. This finding may seem unexpected considering that NO production is also dependent on NADPH. A plausible explanation for this observation is the fact that the Michaelis constant (Km) of NO synthase for NADPH is lower than the Km of glutathione reductase or catalase [2 ]. Thus, under a moderate degree of oxidative stress, a decrease in cellular NADPH would affect H2O2-detoxifying pathways more than cellular NO production. It is to note that peritoneal macrophages reside in a low-oxygenated environment. Although our experiments were carried out under normoxic conditions, the LPS/PMA-induced oxidative stress expected to occur at lower oxygen tension as a result of the fact that NADPH oxidase has high affinity for O2, and cytosolic NADPH production via the hexose monophosphate shunt is not dependent on, or regulated by, oxygen tension.

Previous findings, indicating attenuated ex vivo IL-10 production on day 2 post-injury and decreased blood IL-10 levels on day 5 post-injury in G6PD-deficient trauma patients [5 , 17 ], apparently contradict our current observations indicating increased IL-10 production in G6PD-deficient mouse macrophages. However, despite the fact that the degree of the defect in the mouse model used is similar to that observed in the type A– deficiency, there are important differences between the human deficiency and the murine model. On the one hand, the human defect, historically, is associated with the selective pressure caused by malaria. Furthermore, in populations living in tropical regions, malaria or other endemic infections may also represent a selective pressure on the distribution of polymorphic cytokine alleles with different expression levels. In fact, studies demonstrated marked biases in the high-producing IL-6 and low-producing IFN-{gamma} alleles in individuals from tropical regions [19 ]. Furthermore, we demonstrated increased frequencies of low-producing, polymorphic IL-10 alleles in G6PD-deficient individuals compared with nondeficient controls [18 ]. Whereas, the presence of these polymorphic alleles may modulate cytokine responses in humans, these genetic considerations are not pertinent in the G6PD-deficient murine model used, which was created by chemically induced mutagenesis [21 ]. However, the fact that this bias in the frequencies of polymorphic cytokine alleles is absent in the G6PD-deficient mice reinforces the direct effects of the deficiency in modulating IL-10 responses. Thus, in the context of human observations, it is plausible to suggest that an elevated IL-10 production in G6PD deficiency may represent an "inflammatory disadvantage" with a consequent increase in the frequency of the low-producing, polymorphic IL-10 alleles in this population [18 ].

In summary, these investigations, together with findings on septic G6PD-deficient humans, reveal that G6PD deficiency modulates cytokine responses with a pronounced impact on IL-10 metabolism. Endotoxemia associated with PKC{delta} activation moves the pro/anti-inflammatory cytokine balance toward the anti-inflammatory side in G6PD-deficient macrophages. Alterations in redox-dependent signaling pathways regulating cytokine production in activated G6PD-deficient macrophages may play a role in modulating the inflammatory response to malaria or other infectious diseases.


arrow
ACKNOWLEDGEMENTS
 
This study was supported by NIH-National Institute of General Medical Sciences Grants GM-55005 and GM69861.

Received January 10, 2005; revised February 25, 2005; accepted March 11, 2005.


arrow
REFERENCES
 
    1
  1. Luzzatto, L., Mehta, A. (1995) Glucose 6-phosphate dehydrogenase deficiency Scriver, C. R. Beaudet, A. L. Sly, W. S. Valle, D. eds. The Metabolic and Molecular Bases of Inherited Disease ,3367-3398 McGraw Hill New York, NY.
  2. 2
  3. Spolarics, Z. (1998) Endotoxemia, pentose cycle, and the oxidant/antioxidant balance in the hepatic sinusoid J. Leukoc. Biol. 63,534-541[Abstract]
  4. 3
  5. Kletzien, R. F. (1994) Glucose-6-phosphate dehydrogenase: a housekeeping enzyme subject to tissue-specific regulation by hormones, nutrients, and oxidant stress FASEB J. 8,174-181[Abstract]
  6. 4
  7. Ruwende, C., Khoo, S. C., Snow, A. W., Yates, S. N., Kwiatkowski, D., Gupta, S., Warn, P., Allsopp, C. E., Gilbert, S. C., Peschu, N., et al (1995) Natural-selection of hemizygotes and heterozygotes for G6Pd deficiency in Africa by resistance to severe malaria Nature 376,246-249[CrossRef][Medline]
  8. 5
  9. Spolarics, Z., Siddiqi, M., Siegel, J. H., Garcia, Z. C., Stein, D. S., Ong, H., Livingston, D. H., Denny, T., Deitch, E. A. (2001) Increased incidence of sepsis and altered monocyte functions in severely injured type A– glucose-6-phosphate dehydrogenase-deficient African American trauma patients Crit. Care Med. 29,728-736[CrossRef][Medline]
  10. 6
  11. Beutler, E. (1996) G6PD: population genetics and clinical manifestations Blood Rev. 10,45-52[CrossRef][Medline]
  12. 7
  13. Garg, A. K., Aggarwal, B. B. (2002) Reactive oxygen intermediates in TNF signaling Mol. Immunol. 39,509-517[CrossRef][Medline]
  14. 8
  15. Haddad, J. J., Fahlman, C. S. (2002) Redox- and oxidant-mediated regulation of interleukin-10: an anti-inflammatory, antioxidant cytokine? Biochem. Biophys. Res. Commun. 297,163-176[CrossRef][Medline]
  16. 9
  17. Lavrovsky, Y., Chatterjee, B., Clark, R. A., Roy, A. K. (2000) Role of redox-regulated transcription factors in inflammation, aging and age-related diseases Exp. Gerontol. 35,521-532[CrossRef][Medline]
  18. 10
  19. Schafer, G., Cramer, T., Suske, G., Kemmner, W., Wiedenmann, B., Hocker, M. (2003) Oxidative stress regulates vascular endothelial growth factor-A gene transcription through Sp1- and Sp3-dependent activation of two proximal GC-rich promoter elements J. Biol. Chem. 278,8190-8198[Abstract/Free Full Text]
  20. 11
  21. Utsugi, M., Dobashi, K., Ishizuka, T., Endou, K., Hamuro, J., Murata, Y., Nakazawa, T., Mori, M. (2003) c-Jun N-terminal kinase negatively regulates lipopolysaccharide-induced IL-12 production in human macrophages: role of mitogen-activated protein kinase in glutathione redox regulation of IL-12 production J. Immunol. 171,628-635[Abstract/Free Full Text]
  22. 12
  23. Pandolfi, P. P., Sonati, F., Rivi, R., Mason, P., Grosveld, F., Luzzatto, L. (1995) Targeted disruption of the housekeeping gene encoding glucose 6- phosphate dehydrogenase (G6PD): G6PD is dispensable for pentose synthesis but essential for defense against oxidative stress EMBO J. 14,5209-5215[Medline]
  24. 13
  25. Jason, J., Archibald, L. K., Nwanyanwu, O. C., Bell, M., Buchanan, I., Larned, J., Kazembe, P. N., Dobbie, H., Parekh, B., Byrd, M. G., Eick, A., Han, A., Jarvis, W. R. (2001) Cytokines and malaria parasitemia Clin. Immunol. 100,208-218[CrossRef][Medline]
  26. 14
  27. Kurtis, J. D., Lanar, D. E., Opollo, M., Duffy, P. E. (1999) Interleukin-10 responses to liver-stage antigen 1 predict human resistance to Plasmodium falciparum Infect. Immun. 67,3424-3429[Abstract/Free Full Text]
  28. 15
  29. Winkler, S., Willheim, M., Baier, K., Schmid, D., Aichelburg, A., Graninger, W., Kremsner, P. G. (1998) Reciprocal regulation of Th1- and Th2-cytokine-producing T cells during clearance of parasitemia in Plasmodium falciparum malaria Infect. Immun. 66,6040-6044[Abstract/Free Full Text]
  30. 16
  31. Mordmuller, B., Turrini, F., Long, H., Kremsner, P. G., Arese, P. (1998) Neutrophils and monocytes from subjects with the Mediterranean G6PD variant: effect of Plasmodium falciparum hemozoin on G6PD activity, oxidative burst and cytokine production Eur. Cytokine Netw. 9,239-245[Medline]
  32. 17
  33. Liese, A. M., Siddiqi, M. Q., Siegel, J. H., Deitch, E. A., Spolarics, Z. (2002) Attenuated monocyte IL-10 production in glucose-6-phosphate dehydrogenase-deficient trauma patients Shock 18,18-23[CrossRef][Medline]
  34. 18
  35. Upperman, J. S., Pillage, G., Siddiqi, M., Zeevi, A., Kelly, N., Ford, H. R., Kammerer, C., Spolarics, Z. (2005) Dominance of high-producing IL-6 and low-producing IL-10 and IFN-{gamma} alleles in glucose-6-phosphate dehydrogenase-deficient trauma patients Shock 23,197-201[CrossRef][Medline]
  36. 19
  37. Gourley, I. S., Kurtis, J. D., Kamoun, M., Amon, J. J., Duffy, P. E. (2002) Profound bias in interferon-{gamma} and interleukin-6 allele frequencies in Western Kenya, where severe malarial anemia is common in children J. Infect. Dis. 186,1007-1012[CrossRef][Medline]
  38. 20
  39. Spolarics, Z., Condon, M. R., Siddiqi, M., Machiedo, G. W., Deitch, E. A. (2004) Red blood cell dysfunction in septic glucose-6-phosphate dehydrogenase-deficient mice Am. J. Physiol. Heart Circ. Physiol. 286,H2118-H2126[Abstract/Free Full Text]
  40. 21
  41. Sanders, S., Smith, D. P., Thomas, G. A., Williams, E. D. (1997) A glucose-6-phosphate dehydrogenase (G6PD) splice site consensus sequence mutation associated with C6PD enzyme deficiency Mutat. Res. 374,79-87[Medline]
  42. 22
  43. Liu, X. Y., Spolarics, Z. (2003) Methemoglobin is a potent activator of endothelial cells by stimulating IL-6 and IL-8 production and E-selectin membrane expression Am. J. Physiol. Cell Physiol. 285,C1036-C1046[Abstract/Free Full Text]
  44. 23
  45. Ramachandra, S., Metcalf, R. A., Fredrickson, T., Marti, G. E., Raveche, E. (1996) Requirement for increased IL-10 in the development of B-1 lymphoproliferative disease in a murine model of CLL J. Clin. Invest. 98,1788-1793[Medline]
  46. 24
  47. Siddiqi, M., Liu, X., Wilmanski, J., Spolarics, Z. (2005) Augmented cytokine responses in glucose-6-phosphate dehydrogenase deficient septic mice Redl, H. eds. Proceeding of the 11th European Shock Society ,203-209 Medimond International Proceedings Bologna, Italy.
  48. 25
  49. Leopold, J. A., Walker, J., Scribner, A. W., Voetsch, B., Zhang, Y. Y., Loscalzo, A. J., Stanton, R. C., Loscalzo, J. (2003) Glucose-6-phosphate dehydrogenase modulates vascular endothelial growth factor-mediated angiogenesis J. Biol. Chem. 278,32100-32106[Abstract/Free Full Text]
  50. 26
  51. Jain, M., Cui, L., Brenner, D. A., Wang, B., Handy, D. E., Leopold, J. A., Loscalzo, J., Apstein, C. S., Liao, R. (2004) Increased myocardial dysfunction after ischemia-reperfusion in mice lacking glucose-6-phosphate dehydrogenase Circulation 109,898-903[Abstract/Free Full Text]
  52. 27
  53. Nicol, C. J., Zielenski, J., Tsui, L. C., Wells, P. G. (2000) An embryoprotective role for glucose-6-phosphate dehydrogenase in developmental oxidative stress and chemical teratogenesis FASEB J. 14,111-127[Abstract/Free Full Text]
  54. 28
  55. Webb, B. L. J., Hirst, S. J., Giembycz, M. A. (2000) Protein kinase C isoenzymes: a review of their structure, regulation and role in regulating airways smooth muscle tone and mitogenesis Br. J. Pharmacol. 130,1433-1452[CrossRef][Medline]
  56. 29
  57. Talior, I., Yarkoni, M., Bashan, N., Eldar-Finkelman, H. (2003) Increased glucose uptake promotes oxidative stress and PKC-{delta} activation in adipocytes of obese, insulin-resistant mice Am. J. Physiol. Endocrinol. Metab. 285,E295-E302[Abstract/Free Full Text]
  58. 30
  59. Paola, D., Domenicotti, C., Nitti, M., Vitali, A., Borghi, R., Cottalasso, D., Zaccheo, D., Odetti, P., Strocchi, P., Marinari, U. M., Tabaton, M., Pronzato, M. A. (2000) Oxidative stress induces increase in intracellular amyloid ß-protein production and selective activation of ß I and ß II PKCs in NT2 cells Biochem. Biophys. Res. Commun. 268,642-646[CrossRef][Medline]
  60. 31
  61. Domenicotti, C., Paola, D., Vitali, A., Nitti, M., d’Abramo, C., Cottalasso, D., Maloberti, G., Biasi, F., Poli, G., Chiarpotto, E., Marinari, U. M., Pronzato, M. A. (2000) Glutathione depletion induces apoptosis of rat hepatocytes through activation of protein kinase C novel isoforms and dependent increase in AP-1 nuclear binding Free Radic. Biol. Med. 29,1280-1290[CrossRef][Medline]
  62. 32
  63. Ron, D., Kazanietz, M. G. (1999) New insights into the regulation of protein kinase C and novel phorbol ester receptors FASEB J. 13,1658-1676[Abstract/Free Full Text]
  64. 33
  65. Dempsey, E. C., Newton, A. C., Mochly-Rosen, D., Fields, A. P., Reyland, M. E., Insel, P. A., Messing, R. O. (2000) Protein kinase C isozymes and the regulation of diverse cell responses Am. J. Physiol. Lung Cell. Mol. Physiol. 279,L429-L438[Abstract/Free Full Text]
  66. 34
  67. Foey, A. D., Brennan, F. M. (2004) Conventional protein kinase C and atypical protein kinase C {zeta} differentially regulate macrophage production of tumor necrosis factor-{alpha} and interleukin-10 Immunology 112,44-53[CrossRef][Medline]
  68. 35
  69. Meisel, C., Vogt, K., Platzer, C., Randow, D., Liebenthal, C., Volk, H. D. (1996) Differential regulation of monocytic tumor necrosis factor-{alpha} and interleukin-10 expression Eur. J. Immunol. 26,1580-1586[Medline]
  70. 36
  71. Shaw, T. C., Thomas, L. H., Friedland, J. S. (2000) Regulation of IL-10 secretion after phagocytosis of Mycobacterium tuberculosis by human monocytic cells Cytokine 12,483-486[CrossRef][Medline]
  72. 37
  73. Bhattacharyya, S., Ghosh, S., Jhonson, P. L., Bhattacharya, S. K., Majumdar, S. (2001) Immunomodulatory role of interleukin-10 in visceral leishmaniasis: defective activation of protein kinase C-mediated signal transduction events Infect. Immun. 69,1499-1507[Abstract/Free Full Text]
  74. 38
  75. O’Sullivan, A., Chang, H. C., Yu, Q., Kaplan, M. H. (2004) STAT4 is required for interleukin-12-induced chromatin remodeling of the CD25 locus J. Biol. Chem. 279,7339-7345[Abstract/Free Full Text]
  76. 39
  77. Chambers, K. A., Parks, R. J., Angel, J. B. (2004) Disruption of MAP kinase activation and nuclear factor binding to the IL-12 p40 promoter in HIV-infected myeloid cells Clin. Exp. Immunol. 137,329-340[CrossRef][Medline]
  78. 40
  79. Brightbill, H. D., Plevy, S. E., Modlin, R. L., Smale, S. T. (2000) A prominent role for Sp1 during lipopolysaccharide-mediated induction of the IL-10 promoter in macrophages J. Immunol. 164,1940-1951[Abstract/Free Full Text]
  80. 41
  81. Tone, M., Powell, M. J., Tone, Y., Thompson, S. A., Waldmann, H. (2000) IL-10 gene expression is controlled by the transcription factors Sp1 and Sp3 J. Immunol. 165,286-291[Abstract/Free Full Text]
  82. 42
  83. Liu, Y. W., Tseng, H. P., Chen, L. C., Chen, B. K., Chang, W. C. (2003) Functional cooperation of simian virus 40 promoter factor 1 and CCAAT/enhancer-binding protein ß and {delta} in lipopolysaccharide-induced gene activation of IL-10 in mouse macrophages J. Immunol. 171,821-828[Abstract/Free Full Text]
  84. 43
  85. Oka, S., Kamata, H., Kamata, K., Yagisawa, H., Hirata, H. (2000) N-acetylcysteine suppresses TNF-induced NF-{kappa} B activation through inhibition of I {kappa} B kinases FEBS Lett. 472,196-202[CrossRef][Medline]
  86. 44
  87. Joshi, A. R. T., Chung, C. S., Song, G. Y., Lomas, J., Priester, R. A., Ayala, A. (2002) NF-{kappa} B activation has tissue-specific effects on immune cell apoptosis during polymicrobial sepsis Shock 18,380-386[CrossRef][Medline]
  88. 45
  89. Mazzeo, D., Sacco, S., Di Lucia, P., Penna, G., Adorini, L., Panina-Bordignon, P., Ghezzi, P. (2002) Thiol antioxidants inhibit the formation of the interleukin-12 heterodimer: a novel mechanism for the inhibition of IL-12 production Cytokine 17,285-293[CrossRef][Medline]
  90. 46
  91. Iijima, N., Yanagawa, Y., Iwabuchi, K., Onoe, K. (2003) Selective regulation of CD40 expression in murine dendritic cells by thiol antioxidants Immunology 110,197-205[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
R. Chandra, E. Villanueva, E. Feketova, G. W. Machiedo, G. Hasko, E. A. Deitch, and Z. Spolarics
Endotoxemia down-regulates bone marrow lymphopoiesis but stimulates myelopoiesis: the effect of G6PD deficiency
J. Leukoc. Biol., June 1, 2008; 83(6): 1541 - 1550.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Wen, J. Gu, S.-L. Li, M. A. Reddy, R. Natarajan, and J. L. Nadler
Elevated Glucose and Diabetes Promote Interleukin-12 Cytokine Gene Expression in Mouse Macrophages
Endocrinology, May 1, 2006; 147(5): 2518 - 2525.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. K. Middleton, T. Rubinstein, and E. Pure
Cellular and Molecular Mechanisms of the Selective Regulation of IL-12 Production by 12/15-Lipoxygenase
J. Immunol., January 1, 2006; 176(1): 265 - 274.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0105010v1
78/1/85    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wilmanski, J.
Right arrow Articles by Spolarics, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilmanski, J.
Right arrow Articles by Spolarics, Z.