PeproTech Inc.
Originally published online as doi:10.1189/jlb.0604349 on March 22, 2005

Published online before print March 22, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0604349v1
77/6/984    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Florian, S.
Right arrow Articles by Valent, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Florian, S.
Right arrow Articles by Valent, P.
(Journal of Leukocyte Biology. 2005;77:984-992.)
© 2005 by Society for Leukocyte Biology

Evaluation of normal and neoplastic human mast cells for expression of CD172a (SIRP{alpha}), CD47, and SHP-1

Stefan Florian*, Minoo Ghannadan*, Matthias Mayerhofer*, Karl J. Aichberger*, Alexander W. Hauswirth*, Gerit-Holger Schernthaner*, Dieter Printz{dagger}, Gerhard Fritsch{dagger}, Alexandra Böhm*, Karoline Sonneck*, Maria-Theresa Krauth*, Michael R. Müller{ddagger}, Christian Sillaber*, Wolfgang R. Sperr*, Hans-Jörg Bühring§ and Peter Valent*,1

* Departments of Internal Medicine I, Division of Hematology & Hemostaseology, and
{ddagger} Surgery, Medical University of Vienna, Austria;
{dagger} St. Anna Children’s Hospital, Vienna, Austria; and
§ Department of Internal Medicine II, University of Tübingen, Germany

1 Correspondence: Department of Internal Medicine I, Division of Hematology & Hemostaseology, Medical University of Vienna, Währinger Gürtel 18-20, A-1097 Vienna, Austria. E-mail: peter.valent{at}meduniwien.ac.at


arrow
ABSTRACT
 
Signal regulatory proteins (SIRPs) and tyrosine phosphatases have recently been implicated in the control of receptor tyrosine kinase (RTK)-dependent cell growth. In systemic mastocytosis (SM), neoplastic cells are driven by the RTK KIT, which is mutated at codon 816 in most patients. We examined expression of SIRP{alpha}, SIRP{alpha} ligand CD47, and Src homology 2 domain-containing protein tyrosine phosphatase-1 (SHP-1), a tyrosine phosphatase-type, negative regulator of KIT-dependent signaling, in normal human lung mast cells (HLMC) and neoplastic MC obtained from nine patients with SM. As assessed by multicolor flow cytometry, normal LMC expressed SIRP{alpha}, CD47, and SHP-1. In patients with SM, MC also reacted with antibodies against SIRP{alpha} and CD47. By contrast, the levels of SHP-1 were low or undetectable in MC in most cases. Corresponding data were obtained from mRNA analysis. In fact, whereas SIRP{alpha} mRNA and CD47 mRNA were detected in all samples, the levels of SHP-1 mRNA varied among donors. To demonstrate adhesive functions for SIRP{alpha} and CD47 on neoplastic MC, an adhesion assay was applied using the MC leukemia cell line HMC-1, which was found to bind to immobilized extracellular domains of SIRP{alpha}1 (SIRP{alpha}1ex) and CD47 (CD47ex), and binding of these cells to CD47ex was inhibited by the CD172 antibody SE5A5. In summary, our data show that MC express functional SIRP{alpha} and CD47 in SM, whereas expression of SHP-1 varies among donors and is low compared with LMC. It is hypothesized that CD172 and CD47 contribute to MC clustering and that the "lack" of SHP-1 in MC may facilitate KIT-dependent signaling in a subgroup of patients.

Key Words: mastocytosis • SCF • c-kit • signal transduction


arrow
INTRODUCTION
 
Mast cells (MC) are multifunctional effector cells of the immune system [1 2 3 ]. These cells originate from CD34+ hematopoietic progenitor cells [4 5 6 ]. Differentiation and survival as well as the secretory properties of MC are regulated by stem cell factor (SCF), also termed MC growth factor or KIT ligand [7 8 9 10 11 ]. The SCF receptor (KIT, CD117) is the product of the c-kit proto-oncogene and belongs to the subtype III of receptors of tyrosine kinase (RTK) [12 13 14 ]. SCF receptors are expressed on mature MC as well as on MC progenitors [15 16 17 ]. Binding of SCF to KIT is associated with a number of signal transduction events including activation of phosphatidylinositol 3-kinase, the Janus tyrosine kinase/signal transducer and activator of transcription pathway, and the Ras-Raf-mitogen-activated protein kinase pathway [18 19 20 21 22 23 24 ]. Functional defects in the SCF gene or c-kit gene in mice are associated with a MC-deficient phenotype [25 , 26 ]. Conversely, activating mutations in c-kit can lead to autonomous growth and growth of MC [27 28 29 ]. In patients with systemic mastocytosis (SM), the transforming c-kit mutation D816V is frequently detectable and is considered to play a key role in the pathologic increase and accumulation of neoplastic MC [30 31 32 33 ]. However, only little is known about mechanisms that underly "mutation-induced" activation of KIT and its role in malignant cell growth in patients with SM.

A number of recent studies have shown that various phosphatases and other regulatory proteins negatively influence KIT-dependent signaling [34 , 35 ]. In murine MC, activation of KIT is counteracted by the Src homology 2 (SH2) domain-containing protein tyrosine phosphatase-1 (SHP-1) [34 , 35 ]. Moreover, it has been shown that SHP-1 binds directly to KIT [35 ]. A remarkable observation has been that the transforming c-kit mutation D814V (the murine homologue of D816V) induces degradation and down-regulation of SHP-1 in transfected cells [36 ]. These data have led to the assumption that SHP-1 negatively regulates KIT signaling and that the c-kit mutation D814V affects this inhibitory pathway through depletion of SHP-1 in neoplastic cells [36 , 37 ].

Signal regulatory proteins (SIRPs) are transmembrane glycoproteins with multiple functional properties [38 , 39 ]. The extracellular portion of SIRP{alpha} (CD172a) serves as a receptor for the integrin-associated protein (IAP; CD47) [40 , 41 ]. The intracellular domains of the SIRPs are considered to regulate RTK signaling by interacting with SHP-1 and SHP-2 [42 ]. Notably, SIRP{alpha} (CD172a) serves as a substrate of activated RTKs and in its tyrosine-phosphorylated form, binds SHP-1 and SHP-2 through SH2-dependent interactions [42 ]. More recent data suggest that SIRP{alpha} (CD172a) may be a negative regulator of signaling and growth in myeloid progenitor cells [41 ].

All in all, a number of observations point to a potential role of functional interactions among SIRP, SHP-1, and KIT in normal MC and to critical defects in these interactions in transformed, neoplastic MC, at least in the murine system [34 35 36 37 ]. So far, however, little is known about expression of SIRPs and SHP-1 in normal and neoplastic human MC (MC). The aims of the present study were to investigate expression of SIRP{alpha}, CD47, and SHP-1 in normal MC and MC obtained from patients with SM.


arrow
MATERIALS AND METHODS
 
Monoclonal antibodies (mAb) and other reagents
The mAb 52 (anti-SHP-1), the phycoerythrin (PE)-labeled mAb YB5.B8 (CD117), 8G12 (CD34), WM53 (CD33), SK3 (CD4), UCHT1 (CD3), M5E2 (CD14), and HIB19 (CD19), and the peridium chlorophyll protein (PerCP)-labeled mAb 2D1 (CD45) as well as FACS lysing solution were purchased from Becton Dickinson (San Jose, CA). The mAb E124.2.8 [anti-immunoglobulin E (IgE)] and the allophycocyanin (APC)-labeled CD117 mAb 104D2D1 were purchased from Immunotech (Marseille, France), mAb G3 (anti-tryptase) from Chemicon (Temecula, CA), and mAb B6H12 (CD47) from PharMingen (San Jose, CA). The CD172a antibodies SE5A5, P3C4, and SE12B6, the SIRP{alpha}1-directed antibody SE7C2, the SIRPß-specific antibody B1D5, and the CD47-specific antibody CC2C6 were all produced at the University of Tübingen (Germany) [40 , 41 ]. The CD47 mAb BRIC126 was obtained from the Fifth International Workshop on Human Leukocyte Differentiation Antigens (Boston, MA). Recombinant human SCF was purchased from R&D Systems (Minneapolis, MN), collagenase type II from Worthington Biochemical Co. (Lakewood, NJ), fetal calf serum (FCS) and RPMI-1640 medium from PAA Laboratories (Linz, Austria), L-glutamine and Iscove’s modified Dulbecco’s medium (IMDM) from Gibco-Life Technologies (Gaithersburg, MD), fluorescein isothiocyanate (FITC)-goat F(ab')2 anti-mouse IgG from Caltag Laboratories (San Francisco, CA), AB serum from Sera Lab (Crawley Down, UK), and 3H-thymidine from Amersham (Buckinghamshire, UK). STI571 was provided by Novartis (Basel, Switzerland).

Patients and preparation of primary MC
In nine patients with SM, bone marrow MC were analyzed for expression of cell surface and cytoplasmic antigens. According to the World Health Organization (WHO) classification of mastocytosis [43 44 45 ], patients were diagnosed to have indolent SM (ISM; n=5), aggressive SM with an associated hematologic, clonal non-MC lineage disease (ASM-AHNMD; n=1), smoldering systemic mastocytosis (SSM; n=1), and aggressive SM without AHNMD (n=2; Table 1 ). The latter two patients progressed to MC leukemia (MCL). In these two patients, MC were isolated and purified to homogeneity (purity: >98%) using the PE-labeled mAb YB5.B8 and a FACSVantage cell sorter (Becton Dickinson). In eight of nine patients with SM, the c-kit point mutation D816V was detectable in bone marrow cells. In one patient with ASM, however, the c-kit mutation D816V was not detectable (Table 1) . For control purpose, bone marrow MC were also analyzed in two patients with non-Hodgkin’s lymphomas (NHL). Bone marrow was obtained from the iliac crest in all cases after written, informed consent was given.


View this table:
[in this window]
[in a new window]
 
Table 1. Patients’ Characteristics (At First Diagnosis)

Lung tissue was obtained from surgical specimens of patients with bronchiogenic carcinoma (n=6). All patients gave informed consent before surgery. MC were isolated according to published techniques [46 , 47 ]. First, tissue was cut into small pieces and washed extensively in Tyrode’s buffer. Tissue fragments were incubated in collagenase type II (2 mg/ml) for 120 min at 37°C. After enzyme digestion, cell suspensions were recovered, washed, and examined for the percentage of MC by Wright Giemsa or toluidine blue (TB) staining. Isolated MC were cultured in RPMI-1640 medium and 10% FCS at 37°C for at least 12 h before used for immunostaining or histamine release experiments.

Culture of HMC-1 cells and stimulation experiments
The MC leukemia cell line HMC-1 [48 ] was kindly provided by Joseph H. Butterfield (Mayo Clinic, Rochester, MN). HMC-1 cells were cultured in IMDM containing 10% FCS, L-glutamine, {alpha}-thioglycerol, and antibiotics at 37°C and 5% CO2. HMC-1 cells were re-thawed from an original stock every 4–8 weeks and passaged weekly. As control of "phenotypic stability", HMC-1 cells were checked periodically for the presence of metachromatic granules, expression of surface KIT, and the down-modulating effect of interleukin (IL)-4 (100 U/ml, 48 h) on KIT [15 ]. These control experiments were done prior to each set of experiments, and only HMC-1 cells exhibiting all features of the original clone [15 , 48 ] were used. In stimulation experiments, HMC-1 cells were cultured in the presence or absence of cladribine (2CdA; 100 ng/ml), cerivastatin (10 µM), atorvastatin (10 µM), cyclosporin-A (CSA; 3 µg/ml), rapamycin (20 nM), prednisolone (3 µg/ml), STI571 (Imatinib; 1 µM), interferon-{alpha} (IFN-{alpha}; 100 U/ml), IFN-{gamma} (100 U/ml), or IL-4 (100 U/ml) for 2 or 24 h at 37°C and 5% CO2.

Evaluation of cell-surface and cytoplasmic antigens by flow cytometry
Flow cytometry experiments were performed according to established techniques [49 , 50 ]. In all experiments (except whole bone marrow stainings), cells were preincubated in AB serum (30 min, 4°C). HMC-1 cells and cultured MC were analyzed by single-color flow cytometry. Surface marker expression on lung MC (LMC) was analyzed by two-color staining using unconjugated "first step" mAb, FITC-conjugated "second step" antibody, and a PE-labeled anti-KIT (CD117) mAb as described [50 ]. Expression of surface antigens on bone marrow MC was determined by three- or four-color staining technique using conjugated mAb (CD2-FITC, CD25-FITC, CD2-PE, CD117-PE, CD34-PE, CD45-PerCP, CD117-APC) as reported [50 ]. In brief, 106 bone marrow cells were incubated with combinations of mAb for 15 min at room temperature. Then, erythrocytes were lysed by incubating cells in 2 ml FACS lysing solution (Becton Dickinson). After washing, cells were examined by flow cytometry on FACSCalibur or FACScan (Becton Dickinson). MC were defined as CD117++ cells. For control purpose, CD3+ cells (T cells), CD4+ cells, CD14+ cells, CD19+ cells (B cells), and CD33+ cells were examined for expression of SIRP{alpha} and CD47 by multicolor flow cytometry. Staining reactions were controlled by isotype-matched antibodies.

To analyze surface marker expression on individual MC (lung, n=2), a TB/immunofluorescence (IF) double-staining technique was applied as described [47 , 49 ]. Briefly, cells were incubated with mAb for 30 min (4°C), washed in phosphate-buffered saline (PBS), and then were exposed to FITC-conjugated goat F(ab')2 anti-mouse antibody. After washing, cells were fixed in glutaraldehyde (0.025%) for 1 min, washed in PBS, and stained with TB (0.0125%) for 8 min. Then, cells were washed again and examined under a fluorescence microscope (Olympus, Hamburg, Germany).

Expression of cytoplasmic antigens, i.e., tryptase (positive control) and SHP-1 in LMC and bone marrow MC, was analyzed by multicolor flow cytometry as described [51 ]. Prior to antibody labeling, cells were subjected to erythrocyte lysis using FACS lysing solution. Then, cells were washed in PBS and saponin (1:100) (Sigma Chemical Co., St. Louis, MO) and incubated with mAb G3 against tryptase or mAb 52 against SHP-1 for 30 min. In a next step, cells were washed in saponin (1:100) and exposed to fluorescein-labeled goat F(ab')2 IgG anti-mouse antibody for 30 min. After washing in saponin and in PBS, cells were incubated with the PE-CD117 mAb YB5.B8 and the PerCP-labeled mAb 2D5 (CD45) and were then washed in PBS. In case of bone marrow cells, a combination of PE-CD34, PerCP-CD45, and APC-CD117 mAb was used. MC were recognized as CD117++/CD45+/CD34– cells.

Northern blotting and reverse transcriptase-polymerase chain reaction (RT-PCR)
Total RNA was extracted from HMC-1 cells and the REH cell line using Trizol® (Invitrogen, Carlsbad, CA), according to the manufacturer’s instructions. Northern blotting was performed essentially as described [52 ]. In brief, 15 µg RNA was size-fractionated on 1.0% formaldehyde-agarose gels and transferred to synthetic membranes (Hybond N, Amersham), as described by Chomczynski [53 ]. The membranes were prehybridized in rapid-hyb buffer (Amersham) and then incubated with probes generated by PCR using primers specific for CD47, CD172a, and SHP-1 (see below). Probes were labeled with 32P using the MegaprimeTM kit (Amersham). Blots were washed twice in 0.2x saline sodium citrate [SSC; 1xSSC=150 mM NaCl and 15 mM sodium citrate, pH 7.0) and 0.1% sodium dodecyl sulfate (SDS) at 42°C for 1 h. Bound radioactivity was visualized by exposure to Biomax MS film® (Eastman Kodak, Rochester, NY) at –80°C using intensifying screens (Eastman Kodak).

RT-PCR was performed on HMC-1 cells and on sorted, purified bone marrow MC (>98% purity) obtained from two patients with MCL (PCR conditions: 35 cycles, annealing temperature 60°C). cDNA synthesis was performed using the ProtoScript first strand cDNA synthesis kit (New England Biolabs, Beverly, MA) according to the manufacturer’s instructions. The following primers were applied: SIRP{alpha}, forward 5'-AAACATCTATATTGTGGTG-3', reverse 5'-CCATTCACTTCCTCGGGACCTG-3'; SHP-1, forward 5'-GAGAGTTTGCAGAAGCAGGAGG-3', reverse 5'-CCTTGTGTTTGGACGAGGTGC-3'; CD47, forward 5'-AAAACACTTAAAT ATAGATCCGGTG-3', reverse 5'-TCACGTCTTACTACTCTCCAAATCG-3'; CD117, forward 5'-TTTCTTACCAGGTGGCAAAGG-3', reverse 5'-TTTGCAATAGGATGGTGGCTG-3'.

Proliferation assay
The effects of CD172a mAb and a CD47 mAb on proliferation of HMC-1 cells were evaluated in 3H-thymidine incorporation experiments according to an established technique [54 ]. In brief, cells (5x104 cells per well) were placed in 96-well microtiter plates (Costar, Cambridge, MA) and incubated with mAb against CD172a (1:10, 1:100, 1:200) or CD47 (1:10, 1:100, 1:200) at 37°C and 5% CO2 for 24 h. Then, 1 µCi 3H-thymidine (Amersham) was added to each well and kept for 12 h (37°C). Cells were then harvested on filter membranes (Packard Bioscience, Meriden, CT) in a Filtermate 196 harvester (Packard Bioscience). Filters were air-dried, and the bound radioactivity was counted in a ß-counter (Top-Count NXT, Packard Bioscience).

Construction of CD47 extracellular and alkaline phosphatase (AP) fusion protein
The putative extracellular domain of human CD47, including the signal peptide, was PCR-amplified by primers C3 (5'ATGATAAGCTTCCTGCATGTGGCCCCTGGTAGCGG9) and C4 (5'TTGATTAGATCTATTTGGAGAAAACCATGA) from reverse-transcribed T84 cDNA. The DNA fragment was cloned into the mammalian expression vector AP-tag2 [55 ], which contains the catalytic domain of human placental AP at the C terminus through BglII and HindIII restriction sites. After transformation, at least three independent clones were isolated, and the protein-coding region was confirmed by DNA sequencing. Transient transfection of COS-7 cells was performed using a standard diethylaminoethyl-dextran method [56 ]. Protein expression and secretion were monitored by assaying AP activity [55 ] in cell-culture medium. Expressed CD47-AP fusion protein was affinity-purified on anti-CD47 sepharose and eluted with tetraethylammonium/HCl (at pH 10), followed by neutralization, concentration, and dialysis. As assessed by SDS-polyacrylamide gel electrophoresis, the recombinant protein had a molecular mass of 50–60 kD. The purified AP-CD47 fusion protein was reactive with a panel of inhibitory anti-CD47 mAb (C5/D5, B6H12, BRIC 126), confirming the existence (conservation) of functional epitopes. Axel Ullrich (Department of Molecular Biology, Max-Planck-Institute, Martinsried, Germany) kindly provided the extracellular domain of SIRP{alpha}1 (SIRP{alpha}1ex) [41 ].

Cell-adhesion and cell-aggregation assay
Adhesion of HMC-1 cells to CD47ex and SIRP{alpha}1ex was analyzed as described previously for other myeloid cells [41 ]. Briefly, various dilutions of the SIRP{alpha}1ex and CD47ex fusion proteins were immobilized onto nitrocellulose-coated plastic dishes (35 mm diameter) by air-drying. Nonspecific binding of cells was prevented by PBS containing 1% bovine serum albumin. A total of 3 x 106 cells in serum-free medium was allowed to adhere to the immobilized protein for 1 h at 37°C. Nonadherent cells were removed by gently rinsing the dishes with warm PBS. Cell-binding was evaluated under a Zeiss Axiovert microscope (Carl Zeiss, Göttingen, Germany). To inhibit cell adhesion, immobilized SIRP{alpha}1ex or CD47ex protein was preincubated with the SIRP-reactive mAb SE5A5 [41 ] or the CD47-reactive mAb CC2C6 [41 ] for 30 min at 37°C prior to incubation with immobilized SIRP{alpha}1ex or CD47ex.

To further demonstrate the functional significance of CD47-CD172a-based adhesion of MC, we analyzed spontaneous aggregation of HMC-1 cells in the presence or absence of the two blocking mAb, SE12B6 (CD172a) and CC2C6 (CD47). In a first step, cells were incubated in 20% AB serum to reduce nonspecific antibody binding via Fc receptors. Then, HMC-1 cells were incubated with mAb against CD2, CD18, CD29, CD43, CD44, CD48, CD54, and CD58 (in select experiments, cells were also exposed to CD9, CD50, CD59, CD63, and CD82) for 30 min (4°C) to block (other) binding sites potentially involved in cell–cell adhesion. After washing, cells were maintained in control medium (IMDM) or medium containing the mAb SE12B6 (CD172a) and CC2C6 (CD47; each 100 µg/ml) for 30 min (4°C). After exposure to mAb, cells were resuspended in 1 ml IMDM plus 10% FCS and placed in six-well culture plates. Cluster formation was determined under an inverted microscope after 1, 10, 30, and 90 min (37°C) and was expressed as clusters/field. Aggregates were defined as coherent clusters consisting of at least 20 cells.


arrow
RESULTS
 
Expression of SIRP{alpha} (CD172a) and CD47 on the surface of primary LMC
As assessed by flow cytometry, primary human KIT+ LMC were found to express SIRP{alpha} (CD172a) and CD47 on their cell surface (Fig. 1 ; Table 2 ). In all donors examined, LMC were recognized by the SIRP{alpha}1/2-directed CD172a mAb SE12B6 (Table 2 ; Fig. 1 ). The CD172a mAb SE5A5, P3C4, and SE7C2 (SIRP{alpha}1-specific) were found to stain MC in a subset of donors (Table 2) . LMC failed to react with the SIRPß (CD172b)-specific mAb B1D5 (not shown). In all samples (donors) examined, LMC were found to react with a mAb against CD47 (Table 2 ; Fig. 1 ). Expression of SIRP{alpha} and CD47 on LMC was also demonstrable by combined TB/IF staining with identical results compared with flow cytometry. In fact, morphologically identifiable TB-positive LMC were found to react with the SIRP{alpha} mAb SE5A5, SE12B6, and SE7C2 as well as with an antibody against CD47 in two donors examined. Apart from MC, monocytes/macrophages (CD14+) were also found to express SIRP{alpha} and CD47 in lung cell suspensions, whereas T cells (CD3+, CD4+) expressed only CD47 but did not express detectable SIRP{alpha}. CD19+ B cells were found to react with the mAb SE12B6 but did not react with the other SIRP antibodies. Blood-derived granulocytes expressed CD47 and SIRP{alpha} in all cases examined (not shown).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. Expression of SIRP{alpha} (CD172a) and CD47 on human LMC. Dispersed LMC were stained by two-color flow cytometry using a PE-labeled, KIT-specific mAb (YB5.B8) for MC detection, the CD172a mAb SE12B6 (A), the SIRP{alpha}1-directed mAb SE7C2 (B), and the CD47 mAb B6H12 (C). The plots show the gated population of MC defined as KIT++ cells.


View this table:
[in this window]
[in a new window]
 
Table 2. Reactivity of MC with mAb

Neoplastic bone marrow MC in SM as well as the MC leukemia-derived cell line HMC-1 express surface SIRP{alpha} (CD172a) and CD47
As assessed by flow cytometry, HMC-1 cells were found to express CD172a and CD47 on their surface, confirming previous data [57 ]. Thus, similar to LMC, HMC-1 cells were found to react with the SIRP{alpha}-reactive mAb SE5A5, SE12B6, and P3C4 (Table 2 ; Fig. 2A 2B 2C ). In addition, in eight of nine patients with SM, bone marrow MC were found to be recognized by mAb against SIRP{alpha} (Table 2 ; Fig. 2D and 2E ). In one SM patient, bone marrow MC did not react with any of the CD172a mAb tested, however. It is of interest that in this particular patient, the c-kit mutation D816V was not detectable, whereas MC in all other patients displayed the c-kit mutation D816V. In control patients without SM (NHL), bone marrow MC were found to express SIRP{alpha} on their surface (Table 2) . All neoplastic MC analyzed (primary bone marrow MC in patients with SM and HMC-1 cells; see Fig. 2C and 2F ) as well as non-neoplastic bone marrow MC were found to react with an antibody against CD47 without major differences in staining intensity (observed among donors) determined by FACS analysis (Table 2) .



View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. Expression of CD172a and CD47 on HMC-1 cells and primary, neoplastic MC. (A–C) HMC-1 cells were stained with the CD172a mAb SE5A5 (A), the SIRP{alpha}1-reactive mAb SE7C2 (B), and the CD47 mAb B6H12 (C). (D–F) Primary bone marrow-derived MC obtained from a patient with systemic mastocytosis were analyzed by three-color flow cytometry using the CD172a mAb SE5A5 (D), the SIRP{alpha}1-directed mAb SE7C2 (E), the CD47 mAb B6H12 (F), a PerCP-conjugated CD45 mAb, and a PE-labeled CD117 (anti-KIT) mAb for MC detection. MC were defined as CD45+/KIT+ cells.

Neoplastic MC express SIRP{alpha} mRNA and CD47 mRNA
As assessed by Northern blotting, the HMC-1 cell line (which is derived from a patient with MC leukemia) was found to express SIRP{alpha} mRNA and CD47 mRNA (Fig. 3 ). In control experiments, the REH cell line did not express SIRP{alpha} mRNA (negative control, not shown). To confirm this for primary MC, highly purified (FACS-sorted >98% pure) bone marrow MC obtained from two patients with MCL were analyzed for expression of SIRP{alpha} and CD47 by RT-PCR. As shown in Figure 4B and C , these neoplastic MC were found to express CD172a mRNA and CD47 mRNA. These data provide evidence for expression of SIRP{alpha} and CD47 in neoplastic MC at the mRNA level.



View larger version (76K):
[in this window]
[in a new window]
 
Figure 3. SIRP and CD47 mRNA expression in the HMC-1 MC line. Northern blot analysis of HMC-1 cells. mRNA expression was analyzed by Northern blotting using cDNA-based probes (generated by PCR), specific for SIRP{alpha}, CD47, and SHP-1. rRNA was used as a relative size marker, and ß-actin as a loading control.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 4. RT-PCR analysis of expression of CD47 mRNA, CD172a mRNA (SIRP{alpha}), and SHP-1 mRNA in neoplastic MC. mRNA samples of HMC-1 cells (A) and of pure populations of primary, neoplastic MC obtained from two patients with systemic mastocytosis (B and C; corresponding to patients #1 and #3 in Table 1 , respectively) after transformation to MC leukemia. mRNA expression was analyzed by RT-PCR using primers specific for SHP-1, SIRP{alpha}, CD47, and CD117 (=positive control). Nonspecific amplification of genomic DNA was excluded in HMC-1 cells (A) by ommitting the RT step (–).

Functional role of expression of SIRP{alpha} (CD172a) and CD47 on neoplastic MC
To demonstrate functional significance of CD47 and CD172a on neoplastic MC, adhesion of HMC-1 cells to immobilized extracellular protein domains was analyzed (Fig. 5 ). As shown in Figure 5A , HMC-1 cells bound to immobilized SIRP{alpha}1ex. The binding was completely inhibited by the CD47-specific, blocking antibody CC2C6 (Fig. 5C) . In consecutive experiments, it was found that HMC-1 cells also bind to immobilized CD47ex protein (Fig. 5B) and that binding to CD47ex is inhibitable by the SIRP{alpha}-specific blocking antibody SE5A5 (Fig. 5D) . These data suggest that CD47 and CD172a on neoplastic MC (HMC-1) exhibit adhesive and ligand-specific properties.



View larger version (92K):
[in this window]
[in a new window]
 
Figure 5. Binding of HMC-1 cells to SIRP{alpha}1ex and CD47ex. HMC-1 cells were incubated on extracellular domains of SIRP{alpha}1 (SIRP{alpha}1ex) and CD47 (CD47ex) bound to nitrocellulose-coated plastic dishes in the presence or absence of blocking antibodies. After incubation, nonadherent cells were removed. HMC-1 cells were found to bind to immobilized SIRP{alpha}1ex (A) and to immobilized CD47ex (B). (C) Binding of HMC-1 cells to SIRP{alpha}1ex was inhibited by the CD47-specific blocking antibody CC2C6. Similarily, binding of HMC-1 cells to CD47ex was inhibited by the SIRP-specific blocking antibody SE5A5 (D).

To directly show that CD172a and CD47 are involved in aggregation of (neoplastic) MC, we examined cluster formation of HMC-1 cells exposed to SIRP{alpha} and CD47 antibodies. In the absence of antibodies, HMC-1 cells were found to form cell aggregates after 30 min. When incubated with various CD antibodies directed against cell–cell adhesion receptors (except CD172 and CD47), HMC-1 cells still formed clusters and aggregates in three of five experiments (in the remaining two experiments, cell did not form clear aggregates), although cluster formation was only observed after 90 min. This cluster formation was reduced significantly when HMC-1 cells were (in addition) exposed to antibodies against CD172a and CD47 (Fig. 6 ).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 6. Aggregation of HMC-1 cells exposed to SIRP{alpha} and CD47 antibody. After preincubation in AB serum and antibodies against various adhesion molecules (see text), HMC-1 cells were incubated in the absence (shaded bar) or in the presence (solid bar) of the blocking mAb SE12B6 (CD172a) and CC2C6 (CD47) in IMDM medium with 10% FCS at 37°C for 90 min. After incubation, cells were examined for cluster formation by microscopy. Results are expressed as clusters per field and represent the mean ± SDof three independent experiments. As visible, preincubation with mAb (CD47/CD172a) resulted in a significant decrease in cluster formation (*, P<0.05).

We next asked whether CD47 or CD172a could play a role in growth of neoplastic cells (HMC-1). However, none of the antibodies tested (CD172a, CD47) showed an effect on growth of HMC-1 cells as determined by the 3H-thymidine uptake assay (not shown).

Expression of SHP-1 in normal and neoplastic MC
As assessed by flow cytometry, SHP-1 was found to be expressed in normal HLMC, whereas MC in normal bone marrow expressed only little if any SHP-1 (Table 2) . In patients with SM, the levels of SHP-1 in neoplastic MC appeared to vary from donor to donor. In most patients with SM (seven out of eight tested), bone marrow MC did not express substantial amounts of SHP-1 (Table 2) . However, in one patient (patient #8=ISM), bone marrow MC expressed substantial amounts of SHP-1 as assessed by flow cytometry (Table 2 ; Fig. 7 ). Expression of SHP-1 mRNA in neoplastic MC was analyzed by RT-PCR. As shown in Figure 4B and C , SHP-1 mRNA was clearly detectable in a patient with ASM -> MCL in whom no c-kit mutation at codon 816 was found but was hardly detectable in highly enriched MC obtained from a second patient with MCL (#3) in whom the c-kit mutation was detected (Fig. 4B and 4C) . HMC-1 cells were found to express cytoplasmic SHP-1 (Table 2) as well as SHP-1 mRNA (Figs. 3 and 4A) . All these data suggest that the levels of expressed SHP-1 in bone marrow MC vary among donors without a clear correlation to the subtype of SM.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 7. Expression of cytoplasmic SHP-1 in MC. Cytoplasmic SHP-1 was detected in MC by flow cytometry. Intracellular staining was performed using saponin for cell permeabilization (for technical details, see text). (A) SHP-1 expression in isolated LMC, (B) bone marrow MC in a patient with mastocytosis without c-kit mutation D816V, and (C) bone marrow MC in a patient with mastocytosis exhibiting the c-kit mutation D816V.

Effects of cytokines and antineoplastic drugs on expression of SIRP{alpha} (CD172a), CD47, and SHP-1 in HMC-1 cells
To study the regulation of expression of SIRP{alpha}, CD47, and SHP-1 in neoplastic MC, the effects of various drugs (in part, proposed as potential therapy in SM) on expression of these molecules were analyzed. In these experiments, HMC-1 cells were incubated for 4 or 24 h with cytokines (IL-4, IFN-{alpha}, IFN-{gamma}) or antineoplastic drugs (2CdA, cerivastatin, atorvastatin, CSA, rapamycin, prednisone, Imatinib) and were then analyzed by flow cytometry. However, under the experimental conditions used, no effects of the cytokines or drugs on expression of SIRP{alpha}, CD47, and SHP-1 on HMC-1 cells were seen (not shown).


arrow
DISCUSSION
 
A number of recent data suggest that abnormal expression of and interactions among KIT, SHP-1, SIRP{alpha} (CD172a), and CD47 may contribute to the pathogenesis of myeloid neoplasms and MC proliferative disorders [34 35 36 37 ]. Most of the respective data have been obtained in murine cell systems [34 35 36 37 ]. However, with the exception of KIT, little is known so far about the expression and functional role of these antigens in normal and neoplastic MC. In the present article, we show that CD47 and KIT are invariably expressed in normal and neoplastic MC, whereas the levels of SHP-1 and CD172a in MC vary depending on the organ analyzed and (sub)type of disease. Especially SHP-1 is of interest in this regard, as this molecule has been described as a negative regulator of KIT-dependent signaling and as a target of the transforming c-kit mutation D814V, the murine homologue of D816V.

SIRP{alpha} is a transmembrane glycoprotein that binds CD47 [40 , 41 ] and supposedly regulates RTK-dependent signaling by interacting with SHP-1 and SHP-2 [41 , 42 ]. Recent data suggest that cultured (immature) MC express SIRP{alpha} and CD47 [39 ]. The data obtained in the present study confirm expression of SIRP{alpha}/CD172a and CD47 on normal MC and show that also neoplastic MC can express these antigens on their cell surface. In fact, MC in most patients with SM were found to react with mAb against CD172a and CD47. In two patients with SM, we were able to purify MC to near homogeneity and to confirm expression of CD47 and CD172a in MC at the mRNA level.

In one patient with aggressive SM, bone marrow MC did not express SIRP{alpha}/CD172a on their surface. This was a somehow unexpected result. It was also an interesting finding, as in this particular patient, the transforming c-kit mutation D816V was not detectable. This observation may point to the fact that expression of SIRP{alpha} on MC in SM is dependent not only on the cellular background but also on molecular defects that occur during disease evolution. It is also of interest that in this particular patient, only a few compact MC infiltrates were detected in bone marrow histologies at diagnosis. However, unfortunately, we were not able to purify enough cells from the bone marrow to perform adhesion experiments using CD47ex and CD172ex domain-based proteins. From a molecular point of view, the divergent expression of CD172a in this patient compared with all other patients with SM analyzed may have several explanations. First, the D816V c-kit mutation may indeed be important for continuous expression of CD172a on neoplastic MC. An alternative explanation would be that other (unknown) genetic defects that occurred in this patient induced the down-regulation (or increased the shedding) of SIRP{alpha}/CD172a in neoplastic MC. A third explanation would be that such specific gene defects led to changes in CD172a-epitope conformation or abnormal glycosylation or ganglioside exposure, so that the antibodies applied could not bind to their target epitopes on CD172a. This possibility seems unlikely, however, as all four anti-CD172a antibodies applied failed to react with bone marrow MC in this patient.

Recent data have shown that SIRP{alpha} (CD172a) is a natural ligand of CD47 and that CD47-CD172a interactions play a functional role in the aggregation of myeloid cells [40 , 41 ]. As neoplastic MC in SM typically form clusters and aggregates in internal tissues, we were interested to know whether CD47-CD172a interactions may also play a functional role in MC aggregation. To address this question, we performed adhesion experiments with HMC-1 cells and extracellular domains of CD47 and CD172a. Indeed, HMC-1 cells bound to both proteins, and this binding could be abolished by the SIRP-specific blocking antibody SE5A5 and the CD47-specific antibody CC2C6. Moreover, these antibodies were found to reduce cluster formation in HMC-1 cells. All in all, these data suggest that neoplastic MC express functional CD47 and CD172a, both of which may contribute to cluster formation of MC in SM (and possibly also in normal tissues).

Recent data suggest that SHP-1 binds to KIT and negatively influences KIT-dependent signaling [35 ]. Other studies have shown that the D814V c-kit mutation (murine homologue of human c-kit D816V) induces degradation of SHP-1 in transfected cells [36 ]. We therefore asked whether SHP-1 is detectable in neoplastic MC in our study. As assessed by flow cytometry, primary neoplastic MC in most patients with SM were found to express only low levels or to lack SHP-1. In two patients, expression of SHP-1 mRNA was examined by RT-PCR. It is interesting that SHP-1 mRNA was found to be expressed clearly in MC in the patient with c-kit D816V-negative SM, whereas the levels of SHP-1 mRNA were hardly detectable in the patient with c-kit D816V-positive SM. This observation would be in favor of previously published results suggesting that D814V (the murine homologue of D816V) promotes degradation of SHP-1 in murine cells [36 ]. Conversely, we also found that bone marrow MC obtained from patients without SM lack SHP-1 or express only low levels of this molecule. In addition, bone marrow MC in a patient with ISM carrying D816V as well as HMC-1 cells (also known to harbor c-kit D816V) were found to express detectable levels of SHP-1. Based on these observations, we conclude that apart from the D816V mutation, also other factors may be involved in the regulation of expression/degradation of SHP-1 in normal and neoplastic MC.

In this regard, it was also of interest to ask whether organ-specific factors may play a role in SHP-1 expression in MC. Thus, LMC were found to express substantial amounts of SHP-1 in this study, whereas bone marrow MC did not. It is also of interest that SM mostly develops in the bone marrow but not in the lung in these patients and that SHP-1 has already been proposed as a tumor suppressor antigen [58 ]. In light of these notions, it may be tempting to speculate that the organ-specific level of tyrosine-phosphatase-type tumor suppressors, such as SHP-1 in MC, can predispose for the development of a MC disorder.

So far, little is known about external factors regulating expression of SHP-1, SIRPs, or CD47. In the current study, we asked whether growth factors or drugs would modulate expression of SHP-1, CD172a, or CD47 in HMC-1 cells. However, none of the growth factors or drugs applied, including those used to treat aggressive SM (IFN-{alpha}, prednisone, and 2CdA) were found to increase or modulate expression of cytoplasmic SHP-1 or surface expression of CD172 or CD47 on MC. Thus, it is most likely that the beneficial (cytoreductive) effects of these drugs are not exerted through regulation of expression of these molecules.

In summary, our data show that neoplastic MC in most patients with SM express CD47 and SIRP{alpha} (CD172a), whereas expression of SHP-1 usually is low or cannot be detected in bone marrow MC in these patients. The heterogeneous expression of SIRP and SHP-1 may depend on organ-specific factors and the variability in gene defects (c-kit mutations) occurring in patients with SM. The exact pathogenetic and clinical implications of abnormal gene expression in neoplastic MC in SM remain to be determined.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by Fonds zur Förderung der Wissenschaftlichen Forschung in Österreich (FWF) Grant #P-14031, #P-16412, #P-12517, and SFB #F-018-09. S. F. and M. G. contributed equally to the study and manuscript. We thank Hans Semper for skillful technical assistance and Axel Ullrich for providing SIRP{alpha}1ex.

Received June 15, 2004; revised February 19, 2005; accepted February 22, 2005.


arrow
REFERENCES
 
    1
  1. Abraham, S. N., Arock, M. (1998) Mast cells and basophils in innate immunity Semin. Immunol. 10,373-381[CrossRef][Medline]
  2. 2
  3. Schwartz, L. B. (1985) The mast cell Kaplan, A. P. eds. Allergy 1,53-92 Churchill Livingstone Edinburgh, UK.
  4. 3
  5. Valent, P., Sillaber, C., Bettelheim, P. (1991) The growth and differentiation of mast cells Prog. Growth Factor Res. 3,27-41[CrossRef][Medline]
  6. 4
  7. Kitamura, Y., Yokoyama, M., Matsuda, H., Ohno, T., Mori, K. J. (1981) Spleen colony-forming cell as common precursor for tissue mast cells and granulocytes Nature 291,159-160[CrossRef][Medline]
  8. 5
  9. Kirshenbaum, A. S., Goff, J. P., Kessler, S. W., Mican, J. M., Zsebo, K. M., Metcalfe, D. D. (1992) Effect of IL-3 and stem cell factor on the appearance of human basophils and mast cells from CD34+ pluripotent progenitor cells J. Immunol. 148,772-777[Abstract]
  10. 6
  11. Agis, H., Willheim, M., Sperr, W. R., Wilfing, A., Kromer, E., Kabrna, E., Spanblochl, E., Strobl, H., Geissler, K., Spittler, A. (1993) Monocytes do not make mast cells when cultured in the presence of SCF. Characterization of the circulating mast cell progenitor as a c-kit+, CD34+, Ly–, CD14–, CD17–, colony-forming cell J. Immunol. 151,4221-4227[Abstract]
  12. 7
  13. Irani, A. M., Nilsson, G., Miettinen, U., Craig, S. S., Ashman, L. K., Ishizaka, T., Zsebo, K. M., Schwartz, L. B. (1992) Recombinant human stem cell factor stimulates differentiation of human mast cells from dispersed fetal liver cells Blood 80,3009-3016[Abstract/Free Full Text]
  14. 8
  15. Valent, P., Spanblöchl, E., Sperr, W. R., Sillaber, C., Zsebo, K. M., Agis, H., Strobl, H., Geissler, K., Bettelheim, P., Lechner, K. (1992) Induction of differentiation of human mast cells from bone marrow and peripheral blood mononuclear cells by recombinant human stem cell factor/kit-ligand in long-term culture Blood 80,2237-2245[Abstract/Free Full Text]
  16. 9
  17. Bischoff, S. C., Dahinden, C. A. (1992) c-kit ligand: a unique potentiator of mediator release from human lung mast cells J. Exp. Med. 175,237-244[Abstract/Free Full Text]
  18. 10
  19. Mitsui, H., Furitsu, T., Dvorak, A. M., Irani, A. A., Schwartz, L. B., Inagaki, N., Takei, M., Ishizaka, K., Zsebo, K. M., Gillis, S., Ishizaka, T. (1993) Development of human mast cells from umbilical cord blood cells by recombinant human and murine c-kit ligand Proc. Natl. Acad. Sci. USA 90,735-739[Abstract/Free Full Text]
  20. 11
  21. Costa, J. J., Demetri, G. D., Harrist, T. J., Dvorak, A. M., Hayes, D. F., Merica, E. A., Menchaca, D. M., Gringeri, A. J., Schwartz, L. B., Galli, S. J. (1996) Recombinant human stem cell factor (kit ligand) promotes human mast cell and melanocyte hyperplasia and functional activation in vivo J. Exp. Med. 183,2681-2686[Abstract/Free Full Text]
  22. 12
  23. Yarden, Y., Kuang, W. J., Yang-Feng, T., Coussens, L., Munemitsu, S., Dull, T. J., Chen, E., Schlessinger, J., Francke, U., Ullrich, A. (1987) Human proto-oncogene c-kit: a new cell surface receptor tyrosine kinase for an unidentified ligand EMBO J. 6,3341-3351[Medline]
  24. 13
  25. Zsebo, K. M., Williams, D. A., Geissler, E. N., Broudy, V. C., Martin, F. H., Atkins, H. L., Hsu, R. Y., Birkett, N. C., Okino, K. H., Murdock, D. C., Jacobsen, F. W., Langley, K. E., Smith, K. A., Takeischi, T., Cattanach, B. M., Galli, S. J., Suggs, S. V. (1990) Stem cell factor is encoded at the Sl locus of the mouse and is the ligand of the c-kit tyrosine kinase receptor Cell 63,213-224[CrossRef][Medline]
  26. 14
  27. Williams, D. E., Eisenman, J., Baird, A., Rauch, C., Ness, K. V., March, C. J., Park, L. S., Martin, U., Mochizuki, D. Y., Boswell, H. S., Burgess, G. S., Cosman, D., Lyman, S. (1990) Identification of a ligand for the c-kit proto-oncogene Cell 63,167-174[CrossRef][Medline]
  28. 15
  29. Sillaber, C., Strobl, H., Bevec, D., Ashman, L. K., Butterfield, J. H., Lechner, K., Maurer, D., Bettelheim, P., Valent, P. (1991) IL-4 regulates c-kit gene product expression in human myeloid and mast cell progenitors J. Immunol. 147,4224-4228[Abstract]
  30. 16
  31. Galli, S. J., Tsai, M., Wershil, B. K. (1993) The c-kit receptor, stem cell factor, and mast cells. What each is teaching us about the others Am. J. Pathol. 142,965-974[Abstract]
  32. 17
  33. Valent, P. (1994) The riddle of the mast cell: c-kit ligand as missing link? Immunol. Today 15,111-114[CrossRef][Medline]
  34. 18
  35. Taylor, M. L., Metcalfe, D. D. (2000) Kit signal transduction Hematol. Oncol. Clin. North Am. 14,517-535[CrossRef][Medline]
  36. 19
  37. Sattler, M., Salgia, R., Shrikhande, G., Verma, S., Pisick, E., Prasad, K. V., Griffin, J. D. (1997) Steel factor induces tyrosine phosphorylation of CRKL and binding of CRKL to a complex-containing c-kit, phosphatidylinositol 3-kinase, and p120(CBL) J. Biol. Chem. 272,10248-10253[Abstract/Free Full Text]
  38. 20
  39. Serve, H., Yee, N. S., Stella, G., Sepp-Lorenzino, L., Tan, J. C., Besmer, P. (1995) Differential roles of PI3-kinase and Kit tyrosine 821 in Kit receptor-mediated proliferation, survival and cell adhesion in mast cells EMBO J. 14,473-483[Medline]
  40. 21
  41. Miyazawa, K., Hendrie, P. C., Mantel, C., Wood, K., Ashman, L. K., Broxmeyer, H. E. (1991) Comparative analysis of signaling pathways between mast cell growth factor (c-kit ligand) and granulocyte-macrophage colony-stimulating factor in a human factor-dependent myeloid cell line involves phosphorylation of Raf-1, GTPase-activating protein and mitogen-activated protein kinase Exp. Hematol. 19,1110-1123[Medline]
  42. 22
  43. Okuda, K., Sanghera, J. S., Pelech, S. L., Kanakura, Y., Hallek, M., Griffin, J. D., Druker, B. J. (1992) Granulocyte-macrophage colony-stimulating factor, interleukin-3, and steel factor induce rapid tyrosine phosphorylation of p42 and p44 MAP kinase Blood 79,2880-2887[Abstract/Free Full Text]
  44. 23
  45. Weiler, S. R., Mou, S., Deberry, C. S., Keller, J. R., Ruscetti, F. W., Ferris, D. K., Longo, D. L., Linnekin, D. (1996) JAK2 is associated with the c-kit proto-oncogene product and is phosphorylated in response to stem cell factor Blood 87,3688-3693[Abstract/Free Full Text]
  46. 24
  47. Feger, F., Ribadeau Dumas, A., Leriche, L., Valent, P., Arock, M. (2002) Kit and c-kit mutations in mastocytosis: a short overview with special reference to novel molecular and diagnostic concepts Int. Arch. Allergy Immunol. 127,110-114[CrossRef][Medline]
  48. 25
  49. Kitamura, Y., Go, S., Hatanaka, K. (1978) Decrease of mast cells in W/Wv mice and their increase by bone marrow transplantation Blood 52,447-452[Abstract/Free Full Text]
  50. 26
  51. Kitamura, Y., Go, S. (1979) Decreased production of mast cells in Sl/Sld mice Blood 53,492-497[Free Full Text]
  52. 27
  53. Furitsu, T., Tsujimura, T., Tono, T., Ikeda, H., Kitayama, H., Koshimizu, U., Sugahara, H., Butterfield, J. H., Ashman, L. K., Kanayama, Y. (1993) Identification of mutations in the coding sequence of the proto-oncogene c-kit in a human mast cell leukemia cell line causing ligand-independent activation of c-kit product J. Clin. Invest. 92,1736-1744
  54. 28
  55. Kitayama, H., Kanakura, Y., Furitsu, T., Tsujimura, T., Oritani, K., Ikeda, H., Sugahara, H., Mitsui, H., Kanayama, Y., Kitamura, Y. (1995) Constitutively activating mutations of c-kit receptor tyrosine kinase confer factor-independent growth and tumorigenicity of factor-dependent hematopoietic cell lines Blood 85,790-798[Abstract/Free Full Text]
  56. 29
  57. Tsujimura, T., Hashimoto, K., Kitayama, H., Ikeda, H., Sugahara, H., Matsumura, I., Kaisho, T., Terada, N., Kitamura, Y., Kanakura, Y. (1999) Activating mutation in the catalytic domain of c-kit elicits hematopoietic transformation by receptor self-association not at the ligand-induced dimerization site Blood 93,1319-1329[Abstract/Free Full Text]
  58. 30
  59. Longley, B. J., Tyrrell, L., Lu, S. Z., Ma, Y. S., Langley, K., Ding, T. G., Duffy, T., Jacobs, P., Tang, L. H., Modlin, I. (1996) Somatic c-kit activating mutation in urticaria pigmentosa and aggressive mastocytosis: establishment of clonality in a human mast cell neoplasm Nat. Genet. 12,312-314[CrossRef][Medline]
  60. 31
  61. Nagata, H., Worobec, A. S., Oh, C. K., Chowdhury, B. A., Tannenbaum, S., Suzuki, Y., Metcalfe, D. D. (1995) Identification of a point mutation in the catalytic domain of the protooncogene c-kit in peripheral blood mononuclear cells of patients who have mastocytosis with an associated hematologic disorder Proc. Natl. Acad. Sci. USA 92,10560-10564[Abstract/Free Full Text]
  62. 32
  63. Longley, B. J., Metcalfe, D. D., Tharp, M., Wang, X., Tyrrell, L., Lu, S. Z., Heitjan, D., Ma, Y. (1999) Activating and dominant inactivating c-kit catalytic domain mutations in distinct forms of human mastocytosis Proc. Natl. Acad. Sci. USA 96,1609-1614[Abstract/Free Full Text]
  64. 33
  65. Boissan, M., Feger, F., Guillosson, J. J., Arock, M. (2000) c-Kit and c-kit mutations in mastocytosis and other hematological diseases J. Leukoc. Biol. 67,135-148[Abstract]
  66. 34
  67. Lorenz, U., Bergemann, A. D., Steinberg, H. N., Flanagan, J. G., Li, X., Galli, S. J., Neel, B. G. (1996) Genetic analysis reveals cell type-specific regulation of receptor tyrosine kinase c-Kit by the protein tyrosine phosphatase SHP1 J. Exp. Med. 184,1111-1126[Abstract/Free Full Text]
  68. 35
  69. Kozlowski, M., Larose, L., Lee, F., Le, D-M., Rottapel, R., Siminovitch, K-A. (1998) SHP-1 binds and negatively modulates the c-kit receptor by interaction with tyrosine 569 in the c-kit justamembrane domain Mol. Cell. Biol. 18,2089-2099[Abstract/Free Full Text]
  70. 36
  71. Piao, X., Paulson, R., van der Geer, P., Pawson, T., Bernstein, A. (1996) Oncogenic mutation in the Kit receptor tyrosine kinase alters substrate specificity and induces degradation of the protein tyrosine phosphatase SHP-1 Proc. Natl. Acad. Sci. USA 93,14665-14669[Abstract/Free Full Text]
  72. 37
  73. Valent, P., Ghannadan, M., Hauswirth, A. W., Schernthaner, G. H., Sperr, W. R., Arock, M. (2002) Signal transduction-associated and cell activation-linked antigens expressed in human mast cells Int. J. Hematol. 75,357-362[Medline]
  74. 38
  75. Kharitonenkov, A., Chen, Z., Sures, I., Wang, H., Schilling, J., Ullrich, A. (1997) A family of proteins that inhibit signalling through tyrosine kinase receptors Nature 386,181-186[CrossRef][Medline]
  76. 39
  77. Lienard, H., Bruhns, P., Malbec, O., Fridman, W. H., Daeron, M. (1999) Signal regulatory proteins negatively regulate immunoreceptor-dependent cell activation J. Biol. Chem. 274,32493-32499[Abstract/Free Full Text]
  78. 40
  79. Seiffert, M., Brossart, P., Cant, C., Cella, M., Colonna, M., Brugger, W., Kanz, L., Ullrich, A., Bühring, H. J. (2001) Signal-regulatory protein-{alpha} (SIRP{alpha}) but not SIRPß is involved in T-cell activation, binds to CD47 with high affinity, and is expressed on immature CD34+CD38– hematopoietic cells Blood 97,2741-2749[Abstract/Free Full Text]
  80. 41
  81. Seiffert, M., Cant, C., Chen, Z., Rappold, I., Brugger, W., Kanz, L., Brown, E. J., Ullrich, A., Bühring, H. J. (1999) Human signal-regulatory protein is expressed on normal, but not on subsets of leukemic myeloid cells and mediates cellular adhesion involving its counterreceptor CD47 Blood 94,3633-3643[Abstract/Free Full Text]
  82. 42
  83. Timms, J. F., Carlberg, K., Gu, H., Chen, H., Kamatkar, S., Nadler, M. J., Rohrschneider, L. R., Neel, B. G. (1998) Identification of major binding proteins and substrates for the SH2-containing protein tyrosine phosphatase SHP-1 in macrophages Mol. Cell. Biol. 18,3838-3850[Abstract/Free Full Text]
  84. 43
  85. Valent, P., Horny, H. P., Escribano, L., Longley, B. J., Li, C. Y., Schwartz, L. B., Marone, G., Nunez, R., Akin, C., Sotlar, K., Sperr, W. R., Wolff, K., Brunning, R. D., Parwaresch, R. M., Austen, K. F., Lennert, K., Metcalfe, D. D., Vardiman, J. W., Bennett, J. M. (2001) Diagnostic criteria and classification of mastocytosis: a consensus proposal Leuk. Res. 25,603-625[CrossRef][Medline]
  86. 44
  87. Valent, P., Akin, C., Sperr, W. R., Horny, H. P., Arock, M., Lechner, K., Bennett, J. M., Metcalfe, D. D. (2003) Diagnosis and treatment of systemic mastocytosis: state of the art Br. J. Haematol. 122,695-717[CrossRef][Medline]
  88. 45
  89. Valent, P., Akin, C., Sperr, W. R., Horny, H. P., Metcalfe, D. D. (2003) Mast cell proliferative disorders: current view on variants recognized by the World Health Organization Hematol. Oncol. Clin. North Am. 17,1227-1241[CrossRef][Medline]
  90. 46
  91. Schulman, E. S., MacGlashan, D. W., Peters, S. P., Schleimer, R. P., Newball, H. H., Lichtenstein, L. M. (1982) Human lung mast cells: purification and characterization J. Immunol. 129,2662-2667[Abstract]
  92. 47
  93. Valent, P., Ashman, L. K., Hinterberger, W., Eckersberger, F., Majdic, O., Lechner, K., Bettelheim, P. (1989) Mast cell typing: demonstration of a distinct hemopoietic cell type and evidence for immunophenotypic relationship to mononuclear phagocytes Blood 73,1778-1785[Abstract/Free Full Text]
  94. 48
  95. Butterfield, J. H., Weiler, D., Dewald, G., Gleich, G. J. (1988) Establishment of an immature mast cell line from a patient with mast cell leukemia Leuk. Res. 12,345-355[CrossRef][Medline]
  96. 49
  97. Agis, H., Füreder, W., Bankl, H. C., Kundi, M., Sperr, W. R., Willheim, M., Boltz-Nitulescu, G., Butterfield, J. H., Kishi, K., Lechner, K., Valent, P. (1996) Comparative phenotypic analysis of human mast cells, blood monocytes and blood basophils: dissection of three distinct myeloid cell lineages Immunology 87,535-543[CrossRef][Medline]
  98. 50
  99. Schernthaner, G. H., Jordan, J. H., Ghannadan, M., Agis, H., Bevec, D., Nunez, R., Escribano, L., Majdic, O., Willheim, M., Worda, C., Printz, D., Fritsch, G., Lechner, K., Valent, P. (2001) Expression, epitope analysis, and functional role of the LFA-2 antigen detectable on neoplastic mast cells Blood 98,3784-3792[Abstract/Free Full Text]
  100. 51
  101. Sperr, W. R., Jordan, J. H., Baghestanian, M., Kiener, H. P., Samorapoompichit, P., Semper, H., Hauswirth, A., Schernthaner, G. H., Chott, A., Natter, S., Kraft, D., Valenta, R., Schwartz, L. B., Geissler, K., Lechner, K., Valent, P. (2001) Expression of mast cell tryptase by myeloblasts in a group of patients with acute myeloid leukemia Blood 98,2200-2209[Abstract/Free Full Text]
  102. 52
  103. Mayerhofer, M., Valent, P., Sperr, W. R., Griffin, J. D., Sillaber, C. (2002) BCR/ABL induces expression of vascular endothelial growth factor and its transcriptional activator, hypoxia inducible factor-1{alpha}, through a pathway involving phosphoinositide 3-kinase and the mammalian target of rapamycin Blood 100,3767-3775[Abstract/Free Full Text]
  104. 53
  105. Chomczynski, P. (1992) One-hour downward alkaline capillary transfer for blotting DNA and RNA Anal. Biochem. 201,134-139[CrossRef][Medline]
  106. 54
  107. Valent, P., Besemer, J., Muhm, M., Majdic, O., Lechner, K., Bettelheim, P. (1989) Interleukin-3 activates human blood basophils via high affinity binding sites Proc. Natl. Acad. Sci. USA 86,5542-5546[Abstract/Free Full Text]
  108. 55
  109. Cheng, H. J., Flanagan, J. G. (1994) Identification and cloning of ELF-1, a developmentally expressed ligand for the Mek4 and Sek receptor tyrosine kinases Cell 79,157-168[CrossRef][Medline]
  110. 56
  111. Liu, Y., Merlin, D., Burst, S. L., Pochet, M., Madara, J. L., Parkos, C. A. (2001) The role of CD47 in neutrophil transmigration. Increased rate of migration correlates with increased cell surface expression of CD47 J. Biol. Chem. 276,40156-40166[Abstract/Free Full Text]
  112. 57
  113. Ghannadan, M., Hauswirth, A. W., Schernthaner, G. H., Muller, M. R., Klepetko, W., Schatzl, G., Sperr, W. R., Buhring, H. J., Valent, P. (2002) Detection of novel CD antigens on the surface of human mast cells and basophils Int. Arch. Allergy Immunol. 127,299-307[CrossRef][Medline]
  114. 58
  115. Wu, C., Sun, M., Liu, L., Zhou, G. W. (2003) The function of the protein tyrosine phosphatase SHP-1 in cancer Gene 306,1-12[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Y. Liu, I. Soto, Q. Tong, A. Chin, H.-J. Buhring, T. Wu, K. Zen, and C. A. Parkos
SIRP{beta}1 Is Expressed as a Disulfide-linked Homodimer in Leukocytes and Positively Regulates Neutrophil Transepithelial Migration
J. Biol. Chem., October 28, 2005; 280(43): 36132 - 36140.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jlb.0604349v1
77/6/984    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Florian, S.
Right arrow Articles by Valent, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Florian, S.
Right arrow Articles by Valent, P.